InteractiveFly: GeneBrief
glass bottom boat/Transforming growth factor beta at 60A : Biological Overview | Regulation | Developmental Biology | Effects of Mutation | Evolutionary Homologs | References
|
Gene name - glass bottom boat Synonyms - Transforming growth factor beta at 60A Cytological map position - 60A1--60A3 Function - ligand Keywords - ectoderm, midgut, dorsal closure, imaginal discs |
Symbol - gbb FlyBase ID: FBgn0024234 Genetic map position - 2-[106] Classification - TGF-beta superfamily Cellular location - secreted |
| Recent literature | Hong, S. H., Kang, M., Lee, K. S. and Yu, K. (2016). High fat diet-induced TGF-beta/Gbb signaling provokes insulin resistance through the tribbles expression. Sci Rep 6: 30265. PubMed ID: 27484164
Summary: Hyperglycemia, hyperlipidemia, and insulin resistance are hallmarks of obesity-induced type 2 diabetes, which is often caused by a high-fat diet (HFD). However, the molecular mechanisms underlying HFD-induced insulin resistance have not been elucidated in detail. This study established a Drosophila model to investigate the molecular mechanisms of HFD-induced diabetes. HFD model flies recapitulate mammalian diabetic phenotypes including elevated triglyceride and circulating glucose levels, as well as insulin resistance. Expression of glass bottom boat (gbb), a Drosophila homolog of mammalian transforming growth factor-β (TGF-β), is elevated under HFD conditions. Furthermore, overexpression of gbb in the fat body produced obese and insulin-resistant phenotypes similar to those of HFD-fed flies, whereas inhibition of Gbb signaling significantly ameliorated HFD-induced metabolic phenotypes. tribbles, a negative regulator of AKT, is a target gene of Gbb signaling in the fat body. Overexpression of tribbles in flies in the fat body phenocopied the metabolic defects associated with HFD conditions or Gbb overexpression, whereas tribbles knockdown rescued these metabolic phenotypes. These results indicate that HFD-induced TGF-β/Gbb signaling provokes insulin resistance by increasing tribbles expression. |
Tian, A., Wang, B. and Jiang, J. (2017). Injury-stimulated and self-restrained BMP signaling dynamically regulates stem cell pool size during Drosophila midgut regeneration. Proc Natl Acad Sci U S A 114(13): E2699-E2708. PubMed ID: 28289209
Summary: Many adult organs rely on resident stem cells to maintain homeostasis. Upon injury, stem cells increase proliferation, followed by lineage differentiation to replenish damaged cells. Whether stem cells also change division mode to transiently increase their population size as part of a regenerative program and, if so, what the underlying mechanism is have remained largely unexplored. This study showed that injury stimulates the production of two bone morphogenetic protein (BMP) ligands, Dpp and Gbb, which drive an expansion of intestinal stem cells (ISCs) by promoting their symmetric self-renewing division in Drosophila adult midgut. BMP production in enterocytes is inhibited by BMP signaling itself, and BMP autoinhibition is required for resetting ISC pool size to the homeostatic level after tissue repair. This study suggests that dynamic BMP signaling controls ISC population size during midgut regeneration and reveals mechanisms that precisely control stem cell number in response to tissue needs. |
Jordan-Alvarez, S., Santana, E., Casas-Tinto, S., Acebes, A. and Ferrus, A. (2017). The equilibrium between antagonistic signaling pathways determines the number of synapses in Drosophila. PLoS One 12(9): e0184238. PubMed ID: 28892511
Summary: Using the Drosophila larval neuromuscular junction, this study shows a PI3K-dependent pathway for synaptogenesis which is functionally connected with other previously known elements including the Wit receptor, its ligand Gbb, and the MAPkinases cascade. Based on epistasis assays, the functional hierarchy within the pathway was determined. Wit seems to trigger signaling through PI3K, and Ras85D also contributes to the initiation of synaptogenesis. However, contrary to other signaling pathways, PI3K does not require Ras85D binding in the context of synaptogenesis. In addition to the MAPK cascade, Bsk/JNK undergoes regulation by Puc and Ras85D which results in a narrow range of activity of this kinase to determine normalcy of synapse number. The transcriptional readout of the synaptogenesis pathway involves the Fos/Jun complex and the repressor Cic. In addition, an antagonistic pathway was identified that uses the transcription factors Mad and Medea and the microRNA bantam to down-regulate key elements of the pro-synaptogenesis pathway. Like its counterpart, the anti-synaptogenesis signaling uses small GTPases and MAPKs including Ras64B, Ras-like-a, p38a and Licorne. Bantam downregulates the pro-synaptogenesis factors PI3K, Hiw, Ras85D and Bsk, but not AKT. AKT, however, can suppress Mad which, in conjunction with the reported suppression of Mad by Hiw, closes the mutual regulation between both pathways. Thus, the number of synapses seems to result from the balanced output from these two pathways. |
Anderson, E. N. and Wharton, K. A. (2017). Alternative cleavage of the bone morphogenetic protein (BMP), Gbb, produces ligands with distinct developmental functions and receptor preference. J Biol Chem [Epub ahead of print]. PubMed ID: 28924042
Summary: The family of TGF-beta and BMP signaling proteins are made as proprotein dimers, then cleaved by proprotein convertases to release the C-terminal domain as an active ligand dimer. Multiple proteolytic processing sites in Glass bottom boat (Gbb), the Drosophila BMP7 ortholog, can produce distinct ligand forms. Cleavage at the S1 or atypical S0 site in Gbb produces Gbb15, the conventional small BMP ligand, while NS site cleavage produces a larger Gbb38 ligand. It was hypothesized that the Gbb prodomain is involved not only in regulating the production of specific ligands but also their signaling output. Blocking NS cleavage increased association of the full-length prodomain with Gbb15, resulting in a concomitant decrease in signaling activity. Moreover, NS cleavage was required in vivo for Gbb-Decapentaplegic (Dpp) heterodimer-mediated wing vein patterning but not for Gbb15-Dpp heterodimer activity in cell culture. Gbb NS cleavage was also required for viability through its regulation of pupal ecdysis in a type II receptor Wishful thinking (Wit)-dependent manner. In fact, Gbb38-mediated signaling exhibits a preference for Wit over the other type II receptor Punt. Finally, Gbb38 was found to be produced when processing at the S1/S0 site is blocked by O-linked glycosylation in third instar larvae. These findings demonstrate that BMP prodomain cleavage ensures that the mature ligand is not inhibited by the prodomain. Furthermore, alternative processing of BMP proproteins produces ligands that signal through different receptors and exhibit specific developmental functions. |
Chlasta, J., Milani, P., Runel, G., Duteyrat, J. L., Arias, L., Lamire, L. A., Boudaoud, A. and Grammont, M. (2017). Variations in basement membrane mechanics are linked to epithelial morphogenesis. Development 144(23): 4350-4362. PubMed ID: 29038305
Summary: The regulation of morphogenesis by the basement membrane (BM) may rely on changes in its mechanical properties. To test this, an atomic force microscopy-based method was developed to measure BM mechanical stiffness during two key processes in Drosophila ovarian follicle development. First, follicle elongation depends on epithelial cells that collectively migrate, secreting BM fibrils perpendicularly to the anteroposterior axis. These data show that BM stiffness increases during this migration and that fibril incorporation enhances BM stiffness. In addition, stiffness heterogeneity, due to oriented fibrils, is important for egg elongation. Second, epithelial cells change their shape from cuboidal to either squamous or columnar. This study proves that BM softens around the squamous cells and that this softening depends on the TGFbeta pathway (the ligands Gbb and Dpp signalling to follicle cells). It was also demonstrated that interactions between BM constituents are necessary for cell flattening. Altogether, these results show that BM mechanical properties are modified during development and that, in turn, such mechanical modifications influence both cell and tissue shapes. |
Kanai, M. I., Kim, M. J., Akiyama, T., Takemura, M., Wharton, K., O'Connor, M. B. and Nakato, H. (2018). Regulation of neuroblast proliferation by surface glia in the Drosophila larval brain. Sci Rep 8(1): 3730. PubMed ID: 29487331
Summary: Despite the importance of precisely regulating stem cell division, the molecular basis for this control is still elusive. This study shows that surface glia in the developing Drosophila brain play essential roles in regulating the proliferation of neural stem cells, neuroblasts (NBs). Two classes of extracellular factors, Dally-like (Dlp), a heparan sulfate proteoglycan, and Glass bottom boat (Gbb), a BMP homologue, are required for proper NB proliferation. Interestingly, Dlp expressed in perineural glia (PG), the most outer layer of the surface glia, is responsible for NB proliferation. Consistent with this finding, functional ablation of PG using a dominant-negative form of dynamin showed that PG has an instructive role in regulating NB proliferation. Gbb acts not only as an autocrine proliferation factor in NBs but also as a paracrine survival signal in the PG. It is proposed that bidirectional communication between NBs and glia through TGF-β signaling influences mutual development of these two cell types. The possibility is discussed that PG and NBs communicate via direct membrane contact or transcytotic transport of membrane components. Thus, this study shows that the surface glia acts not only as a simple structural insulator but also a dynamic regulator of brain development. |
Berke, B., Le, L. and Keshishian, H. (2020). Target-dependent retrograde signaling mediates synaptic plasticity at the Drosophila neuromuscular junction. Dev Neurobiol. PubMed ID: 31950660
Summary: Neurons that innervate multiple targets often establish synapses with target-specific strengths, and local forms of synaptic plasticity. This study has examined the molecular-genetic mechanisms that allow a single Drosophila motoneuron, the ventral Common Exciter (vCE), to establish connections with target-specific properties at its various synaptic partners. By driving transgenes in a subset of vCE's targets, it was found that individual target cells are able to independently control the properties of vCE's innervating branch and synapses. This is achieved by means of a trans-synaptic growth factor secreted by the target cell. At the larval neuromuscular junction, postsynaptic glutamate receptor activity stimulates the release of the BMP4/5/6 homolog Glass bottom boat (Gbb). As larvae mature and motoneuron terminals grow, Gbb activates the R-Smad transcriptional regulator phosphorylated Mad (pMad) to facilitate presynaptic development.Manipulations affecting glutamate receptors or Gbb within subsets of target muscles led to local effects either specific to the manipulated muscle or by a limited gradient within the presynaptic branches. While presynaptic development depends on pMad transcriptional activity within the motoneuron nucleus, this study found that the Gbb growth factor may also act locally within presynaptic terminals. Local Gbb signaling and presynaptic pMad accumulation within boutons may therefore participate in a "synaptic tagging" mechanism, to influence synaptic growth and plasticity in Drosophila. |
Bauer, M., Aguilar, G., Wharton, K. A., Matsuda, S. and Affolter, M. (2023). Heterodimerization-dependent secretion of bone morphogenetic proteins in Drosophila. Dev Cell. PubMed ID: 37054707
Summary: Combinatorial signaling is key to instruct context-dependent cell behaviors. During embryonic development, adult homeostasis, and disease, bone morphogenetic proteins (BMPs) act as dimers to instruct specific cellular responses. BMP ligands can form both homodimers or heterodimers; however, obtaining direct evidence of the endogenous localization and function of each form has proven challenging. This study made use of precise genome editing and direct protein manipulation via protein binders to dissect the existence and functional relevance of BMP homodimers and heterodimers in the Drosophila wing imaginal disc. This approach identified in situ the existence of Dpp (BMP2/4)/Gbb (BMP5/6/7/8) heterodimers. Gbb was found to be secreted in a Dpp-dependent manner in the wing imaginal disc. Dpp and Gbb form a gradient of heterodimers, whereas neither Dpp nor Gbb homodimers are evident under endogenous physiological conditions. This study found that the formation of heterodimers is critical for obtaining optimal signaling and long-range BMP distribution. |
Zhang, W., Wang, D., Si, J., Jin, L. H. and Hao, Y. (2023). Gbb Regulates Blood Cell Proliferation and Differentiation through JNK and EGFR Signaling Pathways in the Drosophila Lymph Gland. Cells 12(4). PubMed ID: 36831328
Summary: The Drosophila lymph gland is an ideal model for studying hematopoiesis, and unraveling the mechanisms of Drosophila hematopoiesis can improve understanding of the pathogenesis of human hematopoietic malignancies. Bone morphogenetic protein (BMP) signaling is involved in a variety of biological processes and is highly conserved between Drosophila and mammals. Decapentaplegic (Dpp)/BMP signaling is known to limit posterior signaling center (PSC) cell proliferation by repressing the protooncogene dmyc. However, the role of two other TGF-β family ligands, Glass bottom boat (Gbb) and Screw (Scw), in Drosophila hematopoiesis is currently largely unknown. This study showed that the loss of Gbb in the cortical zone (CZ) induced lamellocyte differentiation by overactivation of the EGFR and JNK pathways and caused excessive differentiation of plasmatocytes, mainly by the hyperactivation of EGFR. Furthermore, it was found that Gbb was also required for preventing the hyperproliferation of the lymph glands by inhibiting the overactivation of the Epidermal Growth Factor Receptor (EGFR) and c-Jun N-terminal Kinase (JNK) pathways. These results further advance understanding of the roles of Gbb protein and the BMP signaling in Drosophila hematopoiesis and the regulatory relationship between the BMP, EGFR, and JNK pathways in the proliferation and differentiation of lymph gland hemocytes. |
Hossain, M. S., Yao, A., Qiao, X., Shi, W., Xie, T., Chen, C. and Zhang, Y. Q. (2023). Gbb glutathionylation promotes its proteasome-mediated degradation to inhibit synapse growth. J Cell Biol 222(9). PubMed ID: 37389657
Summary: Glutathionylation is a posttranslational modification involved in various molecular and cellular processes. However, it remains unknown whether and how glutathionylation regulates nervous system development. To identify critical regulators of synapse growth and development, this study performed an RNAi screen and found that postsynaptic knockdown of glutathione transferase omega 1 (GstO1) caused significantly more synaptic boutons at the Drosophila neuromuscular junctions. Genetic and biochemical analysis revealed an increased level of glass boat bottom (Gbb), the Drosophila homolog of mammalian bone morphogenetic protein (BMP), in GstO1 mutants. Further experiments showed that GstO1 is a critical regulator of Gbb glutathionylation at cysteines 354 and 420, which promoted its degradation via the proteasome pathway. Moreover, the E3 ligase Ctrip negatively regulated the Gbb protein level by preferentially binding to glutathionylated Gbb. These results unveil a novel regulatory mechanism in which glutathionylation of Gbb facilitates its ubiquitin-mediated degradation. Taken together, these findings shed new light on the crosstalk between glutathionylation and ubiquitination of Gbb in synapse development. |
Chen, X., Perry, S., Wang, B., Wang, S., Hu, J., Loxterkamp, E., Dickman, D., Han, C. (2023). Tissue-specific knockout in Drosophila neuromuscular system reveals ESCRT's role in formation of synapse-derived extracellular vesicles. bioRxiv,PubMed ID: 37808853
Summary: Tissue-specific gene knockout by CRISPR/Cas9 is a powerful approach for characterizing gene functions in animal development. However, this approach has been successfully applied in only a small number of Drosophila tissues. The Drosophila motor nervous system is an excellent model system for studying the biology of neuromuscular junction (NMJ). To expand tissue-specific CRISPR to the Drosophila motor system, this study presents a CRISPR-mediated tissue-restricted mutagenesis (CRISPR-TRiM) toolkit for knocking out genes in motoneurons, muscles, and glial cells. The efficacy of this toolkit was validated by knocking out known genes in each tissue, demonstrated its orthogonal use with the Gal4/UAS binary expression system, and showed simultaneous knockout of multiple redundant genes. Using these tools,an essential role for SNARE pathways in NMJ maintenance was demonstrated. Furthermore, it was demonstrated that the canonical ESCRT pathway suppresses NMJ bouton growth by downregulating the retrograde Gbbsignaling. Lastly, axon termini of motoneurons were found to rely on ESCRT-mediated intra-axonal membrane trafficking to lease extracellular vesicles at the NMJ. |
Li, M., Tian, A., Jiang, J. (2025). Numb provides a fail-safe mechanism for intestinal stem cell self-renewal in adult Drosophila midgut. Journal and Elife, 14 PubMed ID: 40202131
Summary: Stem cell self-renewal often relies on asymmetric fate determination governed by niche signals and/or cell-intrinsic factors but how these regulatory mechanisms cooperate to promote asymmetric fate decision remains poorly understood. In adult Drosophila midgut, asymmetric Notch (N) signaling inhibits intestinal stem cell (ISC) self-renewal by promoting ISC differentiation into enteroblast (EB). Previous work has shown that epithelium-derived Bone Morphogenetic Protein (BMP) promotes ISC self-renewal by antagonizing N pathway activity. This study showed that loss of BMP signaling (Decapentaplegic (Dpp) and Glass bottom boat (Gbb) heterodimers) results in ectopic N pathway activity even when the N ligand Delta (Dl) is depleted, and that the N inhibitor Numb acts in parallel with BMP signaling to ensure a robust ISC self-renewal program. Although Numb is asymmetrically segregated in about 80% of dividing ISCs, its activity is largely dispensable for ISC fate determination under normal homeostasis. However, Numb becomes crucial for ISC self-renewal when BMP signaling is compromised. Whereas neither Mad RNA interference nor its hypomorphic mutation led to ISC loss, inactivation of Numb in these backgrounds resulted in stem cell loss due to precocious ISC-to-EB differentiation. Furthermore, numb mutations resulted in stem cell loss during midgut regeneration in response to epithelial damage that causes fluctuation in BMP pathway activity, suggesting that the asymmetrical segregation of Numb into the future ISC may provide a fail-save mechanism for ISC self-renewal by offsetting BMP pathway fluctuation, which is important for ISC maintenance in regenerative guts. |
Transforming growth factor beta at 60A, known in the literature as 60A, is a member of the TGFbeta superfamily that bears a closer resemblence to vertebrate osteogenic protein (OP-1 or BMP-7) than to BMP-4 or to BMP-4's homolog in Drosophila, Decapentaplegic. Although the gene will be referred to here as Tgfbeta-60A, it is more correctly termed glass bottom boat (gbb). Other close relatives of Tgfbeta-60A in vertebrates are BMP-5 and BMP-6. It is likely that the two evolutionary lineages, one giving rise to Dpp and its homologs, and a second giving rise to Tgfbeta-60A and its homologs, diverged well before the divergence of insects and mammals (Wharton, 1991).
Little about Tgf-beta-60A was known beyond its expression pattern because mutants were unavailable, but a 1998 paper by Chen changed all that. Tgfbeta-60A expression had been previously found to be pronounced in mesodermal cells and in cells of the stomadeal and posterior midgut invaginations, foregut and hindgut cells and in the endodermal cells of the anterior and posterior midgut (Doctor, 1992). Chen sought out dominant enhancer mutations magnifying the effects of a hypomorphic allele of thick veins (tkv), a type I receptor for dpp. Hypomorphic alleles result in partial loss of function of a gene, and dominant enhancers worsten the phenotypic effects of these hypomorphic alleles. Enhancing mutations were found in Mad, Medea, punt and thick veins, all of which are known components of the dpp signaling pathway and in Tgfbeta-60A. Phenotypic analysis of Tgfbeta-60A single mutants and tkv 6;Tgfbeta-60A double mutants revealed both dpp-independent and dpp-dependent functions for Tgfbeta-60A. Tgfbeta-60A mutants lack the first constriction of the embryonic midgut and Antennapedia expression in parasegment 6, indicating that 60A is required for the formation of the first constriction, possibly through regulating Antp expression. This function is independent of dpp signaling, since mutations in dpp or its receptors only disrupt the formation of the second but not the first constriction. This also suggests that there is either redundancy or that a different receptor system is responsible for mediating Tgfbeta-60A signaling to pattern the first constriction. It would be interesting to see if AtrI (Childs, 1993), a type I receptor resembling the type I activin receptor, and STK-D (Ruberte, 1995), a type II receptor in Drosophila, both of unknown function, are mediators of 60A signaling at the site of the first constriction (Chen, 1998).
The fact that Tgfbeta-60A mutations are dominant enhancers of a sensitized dpp pathway implicates Tgfbeta-60A in potentiating dpp signaling (for review, see Raftery, 1999). This is most obvious in the visceral mesoderm of the midgut where dpp signaling is required to regulate homeotic gene expression and to maintain its own expression through a positive feedback mechanism. Although dpp signaling in the visceral mesoderm appears intact in Tgfbeta-60A mutants, a requirement for Tgfbeta-60A is revealed in tkv 6 Tgfbeta-60A double mutants. When dpp signaling is attenuated through a mutant tkv receptor, eliminating Tgfbeta-60A function reduces the signaling to below threshold level. The derepression of Sex combs reduced in the anterior midgut and the loss of expression of dpp target genes (wingless, Ultrabithorax and dpp) in the visceral mesoderm and labial in the endoderm are consistent with inadequate dpp signaling. A similar requirement for Tgfbeta-60A is observed during dorsal closure of the embryonic ectoderm. The enhanced phenotypes of the adult appendages closely resemble those of the Tgfbeta-60A hypomorphic mutants, suggesting that Tgfbeta-60A activity is also required for imaginal disc patterning. It is interesting that the imaginal discs are more sensitive than are mesoderm or endoderm to the reduction of Tgfbeta-60A function, as a 50% reduction in Tgfbeta-60A function is sufficient to produce a phenotype in a tkv 6 genetic background. This may reflect a differential threshold requirement for dpp signaling in different tissues (Chen, 1998).
Tgfbeta-60A may form functional heterodimers with Decapentaplegic. In a signaling system with multiple interacting dimeric ligands, the interpretation of any single mutant phenotypes must consider the effect of losing both homomeric and possible heteromeric ligands. Therefore, the functions of the dpp pathway may be a composite input from Dpp homodimers, and Dpp/Scw and Dpp/Tgfbeta-60A heterodimers. Alternatively, Tgfbeta-60A homodimers may function in an additive fashion with Dpp homodimers at sites of overlapping expression. However, the loss-of-function phenotypes of dpp are as severe as the loss-of- function phenotypes of its downstream components, such as tkv or Mad, suggesting that there is very little signaling, if any at all, from Tgfbeta-60A homodimers in dpp-dependent events. Therefore, it is unlikely that Tgfbeta-60A homodimers play a significant role in dpp-dependent processes. Rather, it is thought that Dpp/Tgfbeta-60A heterodimers form at sites of overlapping expression and participate with Dpp homodimers in multiple signaling events. The broad distribution of Tgfbeta-60A proteins provides an opportunity for forming Dpp/Tgfbeta-60A heterodimers. Unlike scw null mutations, no obvious disruption of dpp signaling is observed in Tgfbeta-60A null mutants, suggesting that Dpp/Tgfbeta-60A heterodimers are not as limiting as Dpp/Scw heterodimers, but function in partially redundant manner with Dpp homodimers (Chen, 1998).
Inhibition of postsynaptic glutamate receptors at the Drosophila NMJ initiates a compensatory increase in presynaptic release termed synaptic homeostasis. BMP signaling is necessary for normal synaptic growth and stability. It remains unknown whether BMPs have a specific role during synaptic homeostasis and, if so, whether BMP signaling functions as an instructive retrograde signal that directly modulates presynaptic transmitter release. This study demonstrates that the BMP receptor [(Wishful thinking (Wit)] and ligand (Gbb) are necessary for the rapid induction of synaptic homeostasis. Evidence is provided that both Wit and Gbb have functions during synaptic homeostasis that are separable from NMJ growth. However, further genetic experiments demonstrate that Gbb does not function as an instructive retrograde signal during synaptic homeostasis. Rather, the data indicate that Wit and Gbb function via the downstream transcription factor Mad and that Mad-mediated signaling is continuously required during development to confer competence of motoneurons to express synaptic homeostasis (Goold, 2007).
These data advance understanding of BMP signaling at the Drosophila NMJ in several important ways. First, it was demonstrated that BMP signaling is essential for the rapid, protein-synthesis-independent, induction of synaptic homeostasis identified at this NMJ. Because expression of UAS-wit in motoneurons restores synaptic homeostasis in the wit mutant and because suppression of Mad-mediated signaling in neurons blocks synaptic homeostasis, it is concluded that BMP signaling acts upon the motoneuron to enable the rapid induction of synaptic homeostasis. Next, it was shown that the requirement for BMP signaling during synaptic homeostasis is separable from BMP-dependent support of synaptic growth and baseline neurotransmission. Finally, the temporal and spatial requirements for BMP signaling was dissected. The data support the conclusion that Mad-mediated signaling is required constitutively, downstream of the Wit receptor, in order to maintain the competence of motoneurons to express homeostatic plasticity. Further, the data argue that Gbb is not the retrograde signal that directly acts upon the presynaptic motoneuron terminal to homeostatically modulate presynaptic release (Goold, 2007).
It has been hypothesized that Gbb could function as a homeostatic retrograde signal at the Drosophila NMJ. According to this model, Gbb would be released in proportion to the perturbation of postsynaptic muscle excitation in a glutamate receptor mutant and, thereby, instruct the degree of homeostatic compensation expressed by the presynaptic motoneuron terminal. In favor of this model, homeostatic compensation observed in a glutamate receptor mutant is blocked by the wit mutation. This study present two lines of evidence that are consistent with the necessity of BMP signaling for homeostatic compensation. First, it was confirmed that the rapid induction of homeostatic compensation following application of a use-dependent glutamate receptor antagonist, Philanthotoxin (PhTx) is blocked by null mutations in both wit and gbb. Furthermore, it was shown that muscle-specific rescue of the gbb null mutation is sufficient to restore the rapid induction of homeostatic compensation (Goold, 2007).
Despite these compelling genetic data, several experiments now argue against the possibility that Gbb functions as an instructive, retrograde signal that directly modulates presynaptic release during synaptic homeostasis. First, it was found that although muscle-specific rescue of the gbb null mutation is sufficient to restore synaptic homeostasis, so is neuron-specific rescue of the gbb null mutation. Thus, homeostatic compensation can occur even in the absence of muscle-derived Gbb. These data argue against a model in which Gbb functions as the instructive retrograde signal that directly modulates presynaptic release during synaptic homeostasis (Goold, 2007).
Next, it was demonstrated that homeostatic signaling is blocked by expression of DN-Glued in neurons, which disrupts retrograde axonal transport. In this experiment, Gbb signaling at the NMJ should, in theory, persist. Furthermore, it was established that an intact motor axon is not required for the rapid induction of synaptic homeostasis. Thus, it can be concluded that trans-synaptic Gbb signaling from muscle to nerve is not sufficient for the rapid induction of synaptic homeostasis (Goold, 2007).
Given that Wit and Gbb are necessary for synaptic homeostasis, how do they participate in the process if Gbb is not the instructive retrograde signal? This study demonstrates that Mad is necessary for synaptic homeostasis, and evidence is providied that Mad-mediated signaling is required in the motoneuron. In addition, neuronal expression of UAS-Gbb restores homeostatic compensation in the presence of the DN-Glued transgene. These results suggest that the reason DN-Glued disrupts synaptic homeostasis is because it interferes with the retrograde axonal transport of P-Mad downstream of the Wit receptor. This is consistent with the prior demonstration that neuronal expression of Gbb can restore nuclear P-Mad in the presence of UAS-DN-Glued. Because the induction of synaptic homeostasis does not require the motoneuron soma, it is concluded that Gbb does not function as an acute, retrograde signal. Rather, Gbb may be a muscle-derived signal that acts developmentally to confer the competence of motoneurons to express synaptic homeostasis. Thus, the identity of the homeostatic retrograde signal at the NMJ remains unknown. It remains possible that other TGF-β superfamily signaling molecules could function at the NMJ in this capacity, including myoglianin and maverick, though it has been shown that synaptic homeostasis is intact in the baboon receptor mutant (Goold, 2007).
There are several possible ways in which BMP signaling could confer competence for motoneurons to express homeostatic plasticity. One possibility is that the BMPs control a transcriptional program that is necessary for synaptic homeostasis. For example, BMPs are potent regulators of cell fate during embryonic development. Perhaps the ability of motoneurons to express synaptic homeostasis is related to the maintenance of their cellular or electrical identity. An alternate possibility is that BMPs control the expression of essential presynaptic proteins that are required for synaptic homeostasis. For example, it has been shown in other systems that target-dependent TGF-β signaling can modulate neuronal ion channel expression. It has been demonstrated that CaV2.1 calcium channels are required for synaptic homeostasis at the Drosophila NMJ. However, it is considered unlikely that BMPs control synaptic homeostasis through the regulation of CaV2.1 channel expression because there is not a strong correlation between altered baseline synaptic transmission and the expression of synaptic homeostasis. Furthermore, overexpression of a GFP-tagged CaV2.1 calcium channel (cacophony-GFP) is unable to restore synaptic homeostasis when coexpressed with UAS-dad. Finally, BMP signaling could influence the expression of synaptic homeostasis by targeting the rate of spontaneous miniature release. Spontaneous release events that persist in the absence of evoked neurotransmission are sufficient to induce homeostatic compensation at the Drosophila NMJ. However, no strong correlation is found between baseline mEPSP frequency and whether or not a mutant NMJ is able to express synaptic homeostasis. Although the wit mutants show a severe decrease in mEPSP rate compared to wild-type, the expression of UAS-dad or UAS-DN-Glued both block synaptic homeostasis without severely impairing baseline mEPSP rate. Ultimately, continued forward genetic investigation of homeostatic signaling may be required to identify the BMP-dependent mechanisms that control the expression of synaptic homeostasis (Goold, 2007).
BMP signaling is required for NMJ growth, baseline neurotransmission, and NMJ stability in addition to being required for synaptic homeostasis. It is a challenge, therefore, to determine whether BMP signaling has a specific function during synaptic homeostasis versus a more general role during synapse development. This study presents several lines of evidence that BMP signaling may have a separable function during synaptic growth versus synaptic homeostasis. First, it was demonstrated that synaptic homeostasis can occur at BMP mutant synapses that show severely impaired synaptic growth. For example, the gbb hypomorphic mutant has a decrease in bouton number that is just as severe as the gbb null mutant, but the gbb hypomorphic mutant shows normal homeostatic compensation. As another example, animals in which UAS-gbb and UAS-DN-Glued are coexpressed have a severe decrease in bouton number but normal homeostatic compensation. Thus, it is concluded that normal BMP-dependent synaptic growth is not required for the expression of synaptic homeostasis (Goold, 2007).
It was also possible to dissociate BMP-dependent baseline transmission from both synaptic growth and synaptic homeostasis. (1) Muscle-specific rescue of the gbb null mutation significantly restores synaptic growth and rescues synaptic homeostasis, but baseline transmission remains at levels observed in the null mutant. (2) Motoneuron-specific rescue of the wit mutation (OK371-GAL4) similarly rescues bouton number and synaptic homeostasis, although baseline transmission remains severely impaired. (3) Animals in which UAS-gbb and UAS-DN-Glued are coexpressed have a severe decrease in baseline transmission but normal homeostatic compensation. (4) Results were obtained that show the converse effect. When UAS-dad is expressed for 1.5 days at the end of larval development, both synaptic homeostasis and baseline transmission are significantly impaired, but synaptic bouton numbers remain wild-type. From these data it is concluded that impaired synaptic homeostasis is not a secondary consequence of BMP-dependent functional NMJ development. It also appears that there may be distinct effects of BMP signaling on the anatomical versus functional development of the NMJ. One possibility, consistent with BMPs being a classical morphogen, is that different levels of the ligand could initiate specific transcriptional programs with distinct effects on bouton number, baseline transmission, and homeostatic plasticity. It is also possible that the site of action of BMP signaling will play an important role in specifying signaling outcome (Goold, 2007).
It has been speculated that synaptic homeostasis might function, over the course of development, to ensure that the muscle cell is normally depolarized by the NMJ. How can one explain the observation that csp and syx/+ mutations have decreased baseline neurotransmitter release but normal acute synaptic homeostasis in response to PhTx application, or other genotypes explored in this study that show impaired baseline transmission and normal acute synaptic homeostasis? It has been demonstrated that the acute induction of synaptic homeostasis is independent of evoked neurotransmission. Thus, synaptic homeostasis may not function to modulate the absolute amplitude of evoked neurotransmitter release. Rather, synaptic homeostasis might be a rapid system to offset acute perturbations of postsynaptic receptor function. In this case, developmental programs that specify NMJ anatomy and active zone addition would achieve the reproducible development of the NMJ. Alternatively, the mechanisms of acute homeostatic compensation following PhTx application may be separable, either temporally or molecularly, from the other potential mechanisms that monitor and homeostatically control evoked EPSP amplitudes (Goold, 2007).
The data also suggest a possible link between the expression of homeostatic plasticity and the mechanisms of neuromuscular degenerative disease. Genetic mutations that impair retrograde axonal transport have been shown to cause familial amyotrophic lateral sclerosis. It has also been shown that, in Drosophila and mice, mutations that disrupt dynein-dynactin complex function lead to neuromuscular synapse degeneration. It is hypothesized that impaired retrograde axonal transport deprives motoneurons of muscle-derived trophic support leading to motoneuron degeneration. This study has demonstrated that impaired retrograde axonal transport blocks the expression of homeostatic plasticity at the NMJ. This deficit can be restored by expression of BMPs in the central nervous system, bypassing retrograde axonal transport as the source of BMPs to the motoneuron cell body. It is tempting to speculate that impaired synaptic homeostasis at the NMJ may play a role in the progression of motoneuron disease associated with impaired retrograde axonal transport (Goold, 2007).
Finally, the data could have relevance to the sustained expression of homeostatic plasticity in regions of the adult nervous system. BMPs and downstream signaling proteins such as the Smads continue to be expressed in the adult nervous system. In particular, BMPs are secreted into the cerebral spinal fluid at concentrations that are relevant for neuronal signaling. It is, therefore, interesting to speculate that circulating levels of BMPs might sustain the competence of neurons to express homeostatic plasticity without driving morphological plasticity in the adult nervous system (Goold, 2007).
Bone morphogenetic proteins (BMPs) are synthesized as proproteins that undergo proteolytic processing by furin/subtilisin proprotein convertases to release the active ligand. This study examined processing of BMP5/6/7/8 proteins, including the Drosophila orthologs Glass Bottom Boat (Gbb) and Screw (Scw) and human BMP7. Gbb and Scw have three functional furin/subtilisin proprotein convertase cleavage sites; two between the prodomain and ligand domain, which are called the Main and Shadow sites, and one within the prodomain, which is called the Pro site. In Gbb each site can be cleaved independently, although efficient cleavage at the Shadow site requires cleavage at the Main site, and remarkably, none of the sites is essential for Gbb function. Rather, Gbb must be processed at either the Pro or Main site to produce a functional ligand. Like Gbb, the Pro and Main sites in Scw can be cleaved independently, but cleavage at the Shadow site is dependent on cleavage at the Main site. However, both Pro and Main sites are essential for Scw function. Thus, Gbb and Scw have different processing requirements. The BMP7 ligand rescues gbb mutants in Drosophila, but full-length BMP7 cannot, showing that functional differences in the prodomain limit the BMP7 activity in flies. Furthermore, unlike Gbb, cleavage-resistant BMP7, although non-functional in rescue assays, activates the downstream signaling cascade and thus retains some functionality. These data show that cleavage requirements evolve rapidly, supporting the notion that changes in post-translational processing are used to create functional diversity between BMPs within and between species (Fritsch, 2012).
While the results of this study support the conventional dogma that proteolytic processing and dissociation of the prodomain are essential steps in BMP activation, this study shows that different BMPs, even if closely related, can have distinct processing requirements. In particular, for the BMP5/6/7/8 proteins, a novel mechanism of prodomain shedding was identified involving Furin-mediated cleavage at a site within the prodomain, and evidence is provided that some BMPs can signal with part or all of the prodomain covalently attached (Fritsch, 2012).
Gbb processing occurs at three sites to give rise to an N-terminal pro-fragment, a C-terminal profragment, and the ligand domain. The processing event that must occur to activate Gbb is the separation of the ligand domain from the N-terminal pro-fragment, which can occur by cleavage at either the Pro site or the Main site. Thus, Gbb can function either as a fully processed ligand or with the C-terminal fragment of the prodomain covalently attached. An inhibitory role for the N-terminal part of the prodomain is not without precedent: functional studies on Myostatin/GDF8 have mapped the inhibitory domain of the protein to amino acids 42 to 115, and the recent crystal structure of TGF-β1 has also implicated this part of the protein in blocking ligand function (Fritsch, 2012).
Scw is processed at three cleavage sites orthologous to those in Gbb (Pro, Main and Shadow), but in this case, cleavage at both the Pro site and the Main site are required to produce a functional ligand. Cleavage at the Pro site is required for dissociation of the prodomain and for stable accumulation of the secreted ligand. Thus, when complexed with the prodomain, Scw is either inefficiently secreted or rapidly internalised following secretion, which is similar to what has been reported for members of the BMP2/4/Dpp group. Cleavage at the Main site is required for dissociation of the ligand domain from the Cterminal prodomain fragment, which, in Scw, inhibits ligand function. The inhibitory effect of the C-terminal prodomain region in Scw is a recent evolutionary adaptation, and could reflect either a newly evolved property of the prodomain or a newly evolved function of the Scw ligand domain with which this prodomain fragment interferes. Notably, a similar rapid functional divergence in the prodomain has also been reported for BMP15, where the prodomains of the mouse and human orthologs confer differential processing efficiencies to the pro-protein that may underlie the distinct functional properties of the ligand in these two species (Fritsch, 2012).
The data support the model that human BMP7 is processed at a single, low-probability Furin cleavage site that lies between the prodomain and ligand domain, and that cleavage at this site is essential for function. Curiously, while the Gbb-BMP7 ligand domain chimera fully rescues gbb mutants, full length BMP7 does not, suggesting that the BMP7 prodomain is incompatible with essential features of Gbb processing and signalling. Thus, while the Gbb and BMP7 ligands are functionally interchangeable, their pro-domains have diverged, presumably to fine-tune their activity to fulfil their endogenous functions (Fritsch, 2012).
Taken together these findings on Scw, Gbb and BMP7 illustrate how evolutionary plasticity in the prodomain sequence serves to modulate the activity of the ligand, which may be subject to stronger evolutionary constraints and thus unable to diverge sufficiently to provide functional diversity. The Furin-mediated cleavage of Gbb and Scw characterized in this study is one of a number of different prodomain processing events that have been shown to modulate the function of TGFβ superfamily ligands. For many ligands, the prodomain has been shown to remain noncovalently associated with the ligand, and a range of different functions have been ascribed to it, including targeting the complex for degradation or to the extracellular matrix. Indeed, the prodomains of BMP-4, -5, -7, -10 and GDF5 have been shown to interact with Fibrillin, and the GDF8 prodomain with Perlecan, and various strategies are deployed to dissociate this complex and release the active ligand. In vitro evidence suggests that for BMP7, the prodomain can be displaced by the Type II receptor. A more general strategy may be proteolytic cleavage of the prodomain. GDF11, GDF8 and BMP10 require proteolytic cleavage by the metalloproteinase Tolloid/BMP-1 to activate signalling in vivo or in tissue culture assays. The data suggest that an additional mechanism for activation is Furin/SPC cleavage of the prodomain (Fritsch, 2012).
The recent crystal structure of the pro-TGF-β1 dimer reveals that the two prodomains form a ring-like shape that wraps around the ligand dimer, altering its structure and shielding it from interaction with receptors. The prodomain ring is subdivided into C-terminal 'arms', an extended loop that encircles the tip of each ligand monomer, and two N-terminal, α-helical forearms that cross one another forming a straitjacket around the ligand. In the TGF-β1 model, the N-terminal straitjacket locks the ligand dimer into the prodomain ring, and mechanical force induced by interaction with extracellular matrix proteins unfastens the straitjacket to release the active ligand (Fritsch, 2012).
This model for the prodomain fold provides insight into the molecular basis for results on the processing requirements for Gbb, Scw and BMP7, and also raises intriguing questions. The Pro site in Gbb and Scw lies within the extended loop between the arm and straitjacket, and thus is in a key position to influence ligand accessibility and function. In the case of Gbb, cleavage at this site effectively opens the straitjacket and reveals the ligand dimer irrespective of cleavage at the Main/Shadow sites. Scw, on the other hand, cannot function even with the straitjacket removed in this way. This distinction suggests there is a difference between the arm domains of Gbb and Scw, the former of which is neutral to ligand function and the latter of which is inhibitory. Moreover, Scw requires cleavage at the Pro site to shed the prodomain and activate the ligand, while Gbb functions without this cleavage. Thus, Scw follows the TGF-β1 paradigm of requiring more than just cleavage at the Main site to shed the prodomain, while Gbb presents a distinct situation where cleavage at the Main site is sufficient for prodomain shedding (Fritsch, 2012).
The results with BMP7 also depart from the TGF-β1 paradigm where the prodomain locks the ligand into an inactive form. While cleavage-resistant BMP7 only retains a low level of signalling activity, the data show that it can activate the signalling pathway despite having the prodomain covalently attached. While the ability for a BMP pro-protein to bind to its receptor has been previously shown for BMP2 and BMP7 in vitro, the data provide the first evidence that a BMP pro-protein can signal in vivo without displacement of the prodomain (Fritsch, 2012).
The expression of cleavage-resistant TGFβ superfamily proteins has been shown to generate dominant negative effects by blocking secretion of the wild type protein. In these studies, it was assumed that the mutant proteins formed heterodimers with the wild type monomers, thus promoting their degradation within the cell. The results with cleavage resistant Gbb do not support this type of model for two reasons. First, cleavage resistant Gbb is secreted at normal levels, and thus is not degraded within the cell. Second, it was found that cleavage-resistant Gbb knocks down the function of endogenous Gbb, but not Dpp, with which it forms heterodimers. Thus, the dominant negative effect is exclusive to the homotypic ligand. This specificity has been reported previously, but it is not clear how it might arise for a protein that is known to function by forming heterodimers with other ligands. This suggests that either the relationship between dimerization and processing is different than currently thought, or that the mechanism underlying the dominant negative behaviour is not exclusively due to heterodimerization (Fritsch, 2012).
Phylogenetic analysis of the BMP5/6/7/8 proteins has shown that the processing sites are embedded in blocks of sequence that are poorly conserved even between closely related species. This feature is also a characteristic of the cleavage sites in the BMP2/4/Dpp proteins, and thus the domains that include the cleavage sites in the BMPs appear to be in constant flux, with the core and flanking sequences changing from one species to the next. Indeed, in both subgroups there is evidence that the arrangement of cleavage sites can change, presumably influencing the processing mechanism. For example, in the vertebrate BMP2/4 proteins, the S1 site is a high probability site and is cleaved first, while the S2 site is a low probability site and is only cleaved after processing at the S1 site. In Arthropods, these cleavage probabilities are reversed (and an additional cleavage site is added) and the order of cleavage is correspondingly inverted. Similarly, in the Gbb proteins, the Main site is typically a high probability site, and the Shadow site a low probability site, but in Glossina, Anopheles, and Tribolium, the cleavage probabilities are reversed, indicating that, in Gbb, it is the presence, and not the position of the site that is important. In this light, the Furin cleavage sites appear to evolve like transcription factor binding sites in a promoter where the key feature is maintaining the function of the element irrespective of the position, number, or affinity of the binding sites that comprise it. Given this, the plasticity in processing requirements the observations for the BMP5/6/7/8 proteins may well apply to other BMPs and be a general mechanism whereby the ligands are fine-tuned for their particular functions (Fritsch, 2012).
This study has taken advantage of the availability of the assembled genomic sequence of flies, mosquitos, ants and bees to explore the presence of ultraconserved sequence elements in these phylogenetic groups. Non-coding sequences found within and flanking Drosophila developmental genes were compared to homologous sequences in Ceratitis capitata and Musca domestica. Many of the conserved sequence blocks (CSBs) that constitute Drosophila cis-regulatory DNA, recognized by EvoPrinter alignment protocols, are also conserved in Ceratitis and Musca. Also conserved is the position but not necessarily the orientation of many of these ultraconserved CSBs (uCSBs) with respect to flanking genes. Using the mosquito EvoPrint algorithm, uCSBs shared among distantly related mosquito species were identified. Side by side comparison of bee and ant EvoPrints of selected developmental genes identify uCSBs shared between these two Hymenoptera, as well as less conserved CSBs in either one or the other taxon but not in both. Analysis of uCSBs in these dipterans and Hymenoptera will lead to a greater understanding of their evolutionary origin and function of their conserved non-coding sequences and aid in discovery of core elements of enhancers (Brody, 2020).
Phylogenetic footprinting of Drosophila genomic DNA has revealed that cis-regulatory enhancers can be distinguished from other essential gene regions based on their characteristic pattern of conserved sequences. Cross-species alignments have also identified conserved non-coding sequence elements associated with vertebrate developmental genes, and sequences that are conserved among ancient and modern vertebrates (e.g., the sea lamprey and mammals). Elements conserved between disparate taxa are considered to be 'ultraconserved elements'. Previous studies have identified ultra-conserved elements in dipterans, Drosophila species and sepsids and mosquitos. Comparison of consensus transcription factor binding sites in the spider Cupiennius salei and the beetle Tribolium castaneum have been shown to be functional in transgenic Drosophila (Brody, 2020).
This study describes sequence conservation of non-coding sequences within and flanking developmentally important genes in the medfly Ceratitis capitata, the house fly Musca domestica and Drosophila genomic sequences (see Genomic regions analyzed for presence of uCSBs). The house fly and Medfly have each diverged from Drosophila for ~100 and ~120 My respectively. This analysis reveals that, in many cases, CSBs that are highly conserved in Drosophila species, as detected using the Drosophila EvoPrinter algorithm, are also conserved in Ceratitis and Musca. Additionally, the linear order of these ultraconserved CSBs (uCSBs) with respect to flanking structural genes is also maintained. However, a subset of the uCSBs exhibits inverted orientation relative to the Drosophila sequence, suggesting that while enhancer location is conserved, their orientation relative to flanking genes is not (Brody, 2020).
For detection of conserved sequences in mosquitos, EvoPrinter algorithms were adapted to include 22 species of Anopheles plus Culex pipens and Aedes aegypti. Use of Anopheles species allows for the resolution of CSB clusters that resemble those of Drosophila. Comparison of Anopheles with Culex and Aedes, separated by ∼150 million years of evolutionary divergence, reveals uCSBs shared among these taxa. Although mosquitoes are considered to be Dipterans, uCSBs were identified conserved between mosquito species but these were generally not found in flies (Brody, 2020).
In addition, EvoPrinter tools were developed for sequence analysis of seven bee and thirteen ant species. Both ants and bees belong to the Hymenoptera order and have been separated by ~170 million years. Within the bees, Megachile and Dufourea are sufficiently removed from Apis and Bombus (~100 My) that only portions of CSBs are shared between species: these can be considered to be uCSBs. uCSBs are found that are shared between ant and bee species, and these are positionally conserved with respect to their associated structural genes. Finally, this study show sthat ant specific and bee specific CSB clusters that are not shared between the two taxa are in fact interspersed between shared uCSBs (Brody, 2020).
A previous study of 19 consecutive in vivo tested Drosophila enhancers, contained within a 28.9 kb intragenic region located between the vvl and Prat2 genes, revealed that each CSB cluster functioned independently as a spatial/temporal cis-regulatory enhancer (Kundu, 2013). Submission of this enhancer field to the RefSeq Genome Database of Ceratitis capitata via BLASTn revealed 17 uCSBs; all 17 regions were colinear and located between the Ceratitis orthologs of Drosophila vvl and Prat2 genes. In each case the matches between Ceratitis and Drosophila corresponded to either a complete or a portion of a CSB identified by the Drosophila EvoPrinter as being highly conserved among Drosophila species (Kundu, 2013). Submission of the same Drosophila region to Musca domestica RefSeq Genome Database using BLASTn revealed 13 uCSBs that were colinearly arrayed within the Musca genome. Nine of these Ceratitis and Musca CSBs were present in both species and corresponded to CSBs contained in several of the enhancers identified in a previous study of the Drosophila enhancer field (Kundu, 2013). The conservation within one of these embryonic neuroblast enhancers, vvl-41, is shown in the following figure (Ultra-conserved sequences shared among a Drosophila ventral veins lacking enhancer and orthologous DNA within the Ceratitis capitata and Musca domestica genomes.). Each of the CSB elements in vvl-41 that are shared between Dm and Ceratitis are in the same orientation with respect to the vvl structural gene. Three-way alignments of each of the other eight uCSBs within the vvl enhancer field that are shared between Dm, Ceratitis and Musca are shown in a supplemental figure. The uCSB of vvl-49 in Ceratitis is in reverse orientation with respect to the vvl structural gene. Many of the uCSBs in Musca are in a different orientation on the contig than in Dm, indicating microinversions. One of the two uCSBs in Ceratitis goosecoid was in reverse orientation compared to Drosophila CSBs, while three of the four uCSBs in Musca goosecoid were in reverse orientation. One uCSB each in Ceratitis and Musca castor was in reverse orientation compared to Drosophila castor. 10 of the 15 uCSBs in the Musca wingless non-coding region were in the reverse orientation compared to the orientation in Drosophila, while all uCSBs in Ceratitis Dscam2 were in forward orientation compared to the orientation in Drosophila. It is concluded that, except for microinversions, the order and orientation is the same, with respect to flanking genes of highly conserved non-coding sequences in select developmental determinants of Drosophila, Ceratitis and Musca (Brody, 2020).
Many of the non-coding regions in dipteran genomes contain uCSBs, especially in and around developmental determinants, and many of these are likely to be cis-regulatory elements such as those found in the vvl enhancer field. Another example is the prevalence of uCSBs found in the non-coding sequences associated the Dm hth gene locus. A previous study identified an ultraconserved region in hth shared between Drosophila and Anopheles. This study has identified additional hth uCSBs shared among Dm, Ceratitis and Musca. A 55,100 bp upstream region of Dm hth terminating just after the start of the first exon. A total of 11 CSBs shared between the three species, 5 CSBs were shared between Dm and Ceratitis but not Musca, and 6 CSBs were shared between Dm and Musca, but not Ceratitis. Ceratitis exhibited 4 uCSBs and Musca exhibited 8 uCSBs that were in reversed orientation with respect to the Drosophila orthologous regions. Additional genes analyzed in this paper were also analyzed for association with uCSBs in Ceratitis and Musca, and these results are summarized in the table. In some cases, for example wingless in Ceratitis, the presence of uCSBs could not be verified because of the incomplete assembly of the genome, leaving coding sequences and uCSBs on different contigs. In another case, Dscam2 in Musca, no uCSBs were identified (Brody, 2020).
EvoPrint analysis of Drosophila hth sequences immediately upstream and including the first exon, revealed a conserved sequence cluster associated with the transcriptional start site. Two of the longer CSBs were conserved in both Ceratitis and Musca, one shorter CSB was conserved only in Musca, and a second shorter CSB was conserved only in Ceratitis. Each of the uCSBs was in the same orientation with respect to the hth structural gene (Brody, 2020).
EvoPrinting combinations of species using A. gambiae as a reference species and multiple species from the Neocellia and Myzomyia series and the Neomyzomyia provides a sufficient evolutionary distance from A. gambiae to resolve CSBs. Phylogenic analysis has revealed the Anopheles species diverged from ~48 My to ~30 My while Aedes and Culex diversified from the Anopheles lineage in the Jurassic era or even earlier (Brody, 2020).
This study sought to identify uCSBs in selected mosquito developmental genes by comparing Anopheles species with Aedes and Culex. Non-coding sequences associated with the mosquito homolog of the morphogen wingless were examined to discover associated conserved non-coding sequences. A CSB cluster slightly more than 27,000 bp upstream of the A. gambiae wingless coding exons is shown (EvoPrint analysis of the intragenic region adjacent to the Anopheles Wnt-4 and wingless genes identifies ultra-conserved sequences shared with the evolutionary distant Culex pipiens and Aedes aegypti genomes). CSB orientation in A. gambiae was reversed with respect to the ORF when compared to the orentations of both Culex and Aedes CSBs. It is noteworthy that this EvoPrint, carried out using multiple Anopheles, consists of a cluster of CSBs, resembling EvoPrints carried out using Drosophila species. This general pattern of CSB clusters separated by poorly conserved 'spacers' is prevalent among other developmental determinants in mosquitos. uCSBs, conserved in Culex and Aedes, coincide with CSBs revealed by EvoPrint analysis of Anopheles non-coding sequences. A supplemental figure illustrates an EvoPrinter scorecard for the non-coding wingless-associated CSB cluster described in the above figure. Scores for the first four species, all members of the gambiae complex, are similar to that of A. gambiae against itself, with subsequent scores reflecting increased divergence from A. gambiae. Culex and Aedes are distinguished from the other species by their belonging to a distinctive branch of the mosquito evolutionary tree, the Culicinae subfamily and their low scores against the A. gambiae input sequence. No uCSBs were detected associated with gbb or gsc, while uCSBs were readily detected associated with vvl, cas and hth. A single uCSB in Aedes cas and two uCSBs in Culex cas exhibited a reverse configuration compared to the uCSBs in Anopheles. One uCSB in Culex vvl and no uCSBs in Aedes vvl exhibited a reverse configuration compared to the uCSB in Anopheles. Finally, all uCSBs in Culex and Aedes hth were in forward orientation compared to Anopheles. None of the uCSBs shared between Drosophila, Ceratitis and Musca were conserved in mosquitos, with the exception of a single uCSB associated with a 3'UTR (CTTCGTTTTTGCAAGAGGCCCATATAGCTCGCCAA) that is fully conserved in the Dipteran species tested, A possible explanation for this lack of conservation is the observation that mosquitos are only distantly related to Diptera (Brody, 2020).
Bees and ants are members of the Hymenoptera Order, representing the Apoidea (bee) and Vespoidea (ant) super-families. Current estimates suggest that the two families have evolved separately for over 100 million years. To identify conserved sequences either shared by bees and ants or unique to each family, EvoPrinter alignment tools were developed for seven bee and 13 ant species and searched for CSBs that flank developmental determinants. Three approaches were employed to identify/confirm conserved elements and their positioning within bee and ant orthologous DNAs. First, EvoPrinter analysis of bee and ant genes identified conserved sequences in either bees or ants and ultra-conserved sequence elements shared by both families. Second, BLASTn alignments of the orthologous DNAs identified/confirmed CSBs that were either bee or ant specific or shared by both. Third, side-by-side comparisons of ant and bee EvoPrints and BLASTn comparisons revealed similar positioning of orthologous CSBs relative to conserved exons (Brody, 2020).
To identify conserved sequences within bee species EvoPrints of the honey bee (Apis mellifera) genes were generated using other Apis and Bombus species. Using EvoPrints of the Dscam2 locus, clusters of conserved sequences were resolved. Dscam2 is implicated in axon guidance in Drosophila and in regulation of social immunity behavior in honeybees. The EvoPrint scorecard revealed a high score (close relationship) with the homologous region in the other two Apis species. The more distant Bombus species score lower by greater than 50%, and Habropoda represents a step down from the more closely related Bombus species. Megachile shows a significantly lower score reflecting its more distant relationship to Apis mellifera. The relaxed EvoPrint readout reveals two CSB clusters. Only one sequence cluster, the lower 3' cluster, is conserved in all six test species examined, while the 5' cluster is present in all species except Megachile. BLAST searches confirmed that the 3' cluster was absent from Megachile, a more distant species Dufourea novaeangliae, and all ant species in the RefSeq genome database. BLASTn alignments also revealed conservation of the 3' cluster in D. novaeangliae, the wasp species Polistes canadensis and two ant species, Vollenhavia emeryi and Dinoponera quadriceps (Brody, 2020).
EvoPrinter analysis of bee and ant genes that are orthologs of Drosophila neural development genes goosecoid (gsc) and castor (cas) revealed conserved non-coding DNA that is unique to either bees or ants or conserved in both. EvoPrints of the Hymenoptera orthologs identify non-coding conserved sequence clusters that contained core uCSBs shared by both ant and bee superfamilies, and these uCSBs are frequently flanked by family-specific conserved clusters. For example, analysis of the non-coding sequence upstream of the Wasmannia auropunctata (ant) cas first exon identifies both a conserved sequence cluster that contains ant and bee uCSBs and an ant specific conserved cluster that has no counterpart found in bees. It is likely that the ant specific cluster was deleted in bees, since BLASTn searches of Wasmannia against the European paper wasp Polistes dominula reveals conservation of a core sequence corresponding to this cluster. The combined evolutionary divergence in the gsc and cas EvoPrints, accomplished by use of multiple test species, reveals that many of the amino acid codon specificity positions are conserved while wobble positions in their ORFs are not. The lack of wobble conservation indicates that the combined divergence of the test species used to generate the prints afford near base pair resolution of essential DNA (Brody, 2020).
Cross-group/side-by-side bee and ant comparison of their conserved DNA was performed using bee specific and ant specific EvoPrints and by BLASTn alignments (see Side-by-side comparison of conserved sequences within the bee and ant glass bottom boat loci identify clusters of conserved and species-specific sequences.). This figure highlights the conservation observed among bee and ant exons and flanking sequence of the glass bottom boat (gbb, 60A) locus of Apis melliflera EvoPrinted with four bee test species and the Wasmannia auropunctata gbb locus EvoPrinted with three ant species. Position and orientation of these CSB clusters and uCSBs is conserved. Similarly, EvoPrinting a single exon and flanking regions of the Apis mellifera homothorax locus with four bee species and generating an ant specific EvoPrint of the orthologous ant sequence of the Ooceraea biroi homothorax locus with ten other ant species, reveals CSBs that are conserved in both Apis and Ooceraea, as well as sequences that are restricted to one of the two Hymenopteran families (Brody, 2020).
This study describes the use of EvoPrinter to detect the presence of ultraconserved non-coding sequences in flies, including Drosophila species, Ceratitis and Musca, in mosquitos and in Hymenoptera species. uCSBs of the three fly taxa have, for the most part, maintained their linear order suggesting a functional constraint on the order of regulatory sequences. For mosquitos, an older taxon than that of flies and the Hymenoptera, uCSBs are found to be shared between Anopheles, Culex and Aedes. Importantly, in Hymenoptera, uCSBs were found within clusters of conserved sequences shared between ants and bees. This conservation of core sequences in enhancers suggests that these morphologically divergent taxa share common regulatory networks. These approaches to detection of uCSBs in flies, mosquitos and ants and bees will lead to a greater understanding of their evolutionary origin and the function of their conserved non-coding sequences. Knowledge of clusters of CSBs and of uCSBs is an important tool for discovery of the core elements of enhancers and their sequence extent (Brody, 2020).
In most cases both nBLAST and the EvoPrinter algorithm had similar sensitivities and gave comparable results. However, it is recommended that the two techniques should be used in conjunction with one another to enhance CSB and uCSB detection. For example, by using both approaches, uCSBs were discovered that were identified by one tool but not both. The advantage of EvoPrinter is the presentation of an interspecies comparison as a single sequence, while the advantage of nBLAST is that it provides a sensitive detection of sequence homology in a one-on-one alignment. EMBOSSED Needle alignment gives an even more sensitive detection of shorter sequences and is of use once BLAT or EvoPrinter has been used to discover shared CSBs and/or CSB clusters (Brody, 2020).
Animals lacking Tgfbeta-60A function died at late larval/early pupal stages. One of the striking phenotypes of Tgfbeta-60A mutant larvae is a transparent appearance due to the lack of fat body. In roughly 50% of the Tgfbeta-60A larvae, the gastric caecae are reduced in length, consistent with the expression of Tgfbeta-60A in the gastric caecae (Doctor, 1992). These phenotypes are similar to those of the Mad mutant larvae. During embryogenesis, Tgfbeta-60A is expressed throughout the visceral mesoderm of the developing midgut (Doctor, 1992), suggesting a function for Tgfbeta-60A in gut development. Indeed, embryos lacking Tgfbeta-60A fail to form the first constriction. The homeotic gene Antennapedia (Antp) is expressed in the visceral mesoderm around the first constriction and is required for its formation. Antp expression was examined in Tgfbeta-60A mutant embryos. Consistent with the lack of the first constriction, Antp expression is greatly reduced. Thus, Tgfbeta-60A is required for the formation of the first constriction of the midgut, likely through positively regulating the expression of Antp in the visceral mesoderm. This function of Tgfbeta-60A is independent of dpp signaling, since mutations in dpp or its receptors are known to disrupt the formation of the second but not the first constriction (Chen, 1998).
The identification of mutations in Tgfbeta-60A as dominant enhancers of tkv 6 in the imaginal discs raises the possibility that Tgfbeta-60A is required for optimal signaling by the dpp pathway. To determine if there is a general requirement for Tgfbeta-60A in dpp signaling, the effects of Tgfbeta-60A mutations were examined on dpp signaling in the visceral mesoderm where both dpp and Tgfbeta-60A are expressed. dpp is expressed in two discrete domains in the visceral mesoderm. The anterior domain of dpp coincides with the gastric caecae primordia, which are immediately anterior to the expression domain of Sex combs reduced (Scr) in parasegment (ps) 4. The failure to initiate dpp expression in ps3 in dpp shv mutants results in anterior expansion of Scr expression and arrested outgrowth of the gastric caecae, indicating a role for dpp in repressing Scr in ps3. tkv 6 homozygotes are homozygous viable, so it is not surprising that all the midgut gene expression patterns examined are essentially normal. Scr expression in tkv 6 and Tgfbeta-60A mutants is normal. However, in tkv 6 and Tgfbeta-60A double mutants, the Scr expression extends anteriorly into ps3 as it does in dpp shv mutants, suggesting that Tgfbeta-60A activity is required in ps3 for optimal dpp signaling (Chen, 1998).
To test whether 60A also acts synergistically with dpp elsewhere in the midgut, the gene expression of dpp and Ultrabithorax (Ubx) in ps7 and wingless (wg) in the adjacent ps8 were examined. Parasegment 7 expression of dpp is activated by the homeotic gene Ubx and maintained by an autostimulatory circuit involving dpp, Ubx and wg. The proper expression of all three genes is interdependent and critical for maintaining a stable cellular differentiation commitment. The expression of dpp and wg in the visceral mesoderm is required for the induction of the homeotic gene labial (lab) in the underlying endoderm. The absence of dpp function in ps7 disrupts the autoregulatory loop and reduces the expression of Ubx, wg, dpp and lab in ps7, leading to the absence of the second constriction in dpp mutant embryos (Chen, 1998 and references).
Flies mutant for either tkv 6 or Tgfbeta-60A have
normal expression of dpp, wg and Ubx. However, in tkv 6 Tgfbeta-60A double mutants, dpp expression in ps3 and ps7 is greatly reduced. The initiation of dpp expression at earlier stages is not affected in the double mutants, suggesting that the reduction of dpp expression results from failure to maintain its expression at later stages. Similarly, in Mad mutants, the initiation of dpp expression in ps3 and ps7 is not affected but the maintenance of dpp expression does not occur. This is because dpp expression is activated directly by Ubx and only its maintenance requires positive feedback involving dpp signaling. In the double mutants, Ubx expression in ps7 and wg expression in ps8 are greatly reduced, suggesting the disruption of the positive regulatory loop. The reduction of dpp in ps3 in the double mutants may explain the observed derepression of Scr (Chen, 1998).
Ubx is required for repressing Antp in ps6. In Ubx mutants, the Antp domain is extended posteriorly into ps7, indicating a homeotic transformation of ps7 into ps6. A similar phenotype is observed for tkv null embryos. Consistent with the argument that a lack of Tgfbeta-60A compromises dpp signaling, there is also a posterior expansion of Antp in tkv 6 Tgfbeta-60A double mutants. Interestingly, due to the Tgfbeta-60A mutation, the endogenous Antp expression is absent: there is only ectopic Antp in ps7, where Ubx would normally be expressed (Chen, 1998 and references).
The expression of labial in the endoderm was also examined. Consistent with the gene expression changes in the visceral mesoderm, lab expression is not affected by tkv 6 or Tgfbeta-60A mutations. However, it is greatly reduced in tkv 6 Tgfbeta-60A double mutants. The gut of the double mutants only forms two chambers instead of the normal four chambers. This phenotype likely results from the failure to form the first constriction due to lacking Tgfbeta-60A function and the failure to form the second constriction due to lacking dpp signaling. It is unclear why the position of the only constriction observed in the double mutants is somewhat more anterior than a normal third constriction. The gene expression changes in the midgut of the tkv 6 Tgfbeta-60A double mutants are consistent with Tgfbeta-60A playing a role in augmenting Tgfbeta-60A signaling (Chen, 1998).
The Drosophila ovary is an attractive system to study how niches
control stem cell self-renewal and differentiation. The niche for germline
stem cells (GSCs) provides a Dpp/Bmp signal, which is essential for GSC
maintenance. bam is both necessary and sufficient for the
differentiation of immediate GSC daughters (cystoblasts). Bmp
signals directly repress bam transcription in GSCs in the
Drosophila ovary. Similar to dpp, gbb encodes another Bmp
niche signal that is essential for maintaining GSCs. The expression of
phosphorylated Mad (pMad), a Bmp signaling indicator, is restricted to GSCs and some cystoblasts, which have repressed bam expression. Both Dpp and Gbb signals contribute to pMad production. bam transcription is upregulated in GSCs mutant for dpp and gbb. In marked GSCs mutant for two essential Bmp signal
transducers (Med and punt) bam transcription is also elevated. Finally, Med and Mad are shown to directly bind to the bam silencer in vitro. This
study demonstrates that Bmp signals maintain the undifferentiated or
self-renewal state of GSCs, and directly repress bam expression in
GSCs by functioning as short-range signals. Thus, niche signals directly
repress differentiation-promoting genes in stem cells in order to maintain
stem cell self-renewal (Song, 2004).
This study reveals a new function for gbb in the regulation of GSCs in the Drosophila ovary. Loss of gbb function leads
to GSC differentiation and stem cell loss, similar to dpp mutants.
gbb is expressed in somatic cells but not in germ cells, suggesting
that gbb is another niche signal that controls GSC maintenance. Like dpp, gbb contributes to the production of pMad in GSCs and also functions to repress bam expression in GSCs. As in the wing imaginal disc, gbb also probably functions to augment the dpp signal in the regulation of GSCs through common receptors in the Drosophila ovary. In both dpp and gbb mutants, pMad accumulation in GSCs is severely reduced but not completely diminished. Since the dpp or gbb mutants used in this study do not carry complete loss-of-function mutations, it remains possible that complete elimination of either dpp or gbb function is sufficient for eradicating pMad accumulation in GSCs. Alternatively, both dpp and gbb signaling are required independently for full pMad accumulation in GSCs, and thus disrupting either one of them only partially diminishes pMad accumulation in GSCs. The lethality of null dpp and gbb mutants, and the
difficulty in completely removing their function in the adult ovary, prevent these possibilities from being tested directly (Song, 2004).
Interestingly, dpp overexpression results in complete suppression of cystoblast differentiation and complete repression of bam transcription in the germ cells, whereas gbb overexpression does not have obvious effects on cystoblast differentiation or bam transcription. Even though the UAS-gbb transgene and the c587 driver for gbb overexpression have been demonstrated to function properly, it is possible that active Gbb proteins are not produced in inner sheath cells and somatic follicle cells because of a lack of proper factors that are required for Gbb translation and processing in those cells, which could explain why the assumed gbb overexpression does not have any effect on cystoblast differentiation. However, since active Dpp proteins can be successfully achieved using the same expression method, and Dpp and Gbb are closely related Bmps, it is unlikely that active Gbb proteins are not produced in inner sheath cells and follicle cells. Alternatively, dpp and
gbb signals could have distinct signaling properties, and
dpp may play a greater role in regulating GSCs and cystoblasts.
Recent studies have indicated that Dpp and Gbb have context-dependent
relationships in wing development. In the wing disc, duplications of dpp are able to rescue many but not all of the phenotypes associated with gbb mutants, suggesting that dpp and gbb have not only partly redundant functions but also distinct signaling properties. In the wing and ovary, gbb and dpp function through two Bmp type I receptors, sax and tkv. The puzzling difference between gbb and dpp could be explained by context-dependent modifications of Bmp proteins, which render different signaling properties in different cell types. It will be of
great future interest to better understand what causes Bmps to have distinct signaling properties (Song, 2004).
All the defined niches share a commonality, structural asymmetry, which
ensures stem cells and their differentiated daughters receive different levels of niche signals. In order for a niche signal to function differently in a stem cell and its immediately differentiating daughter cell that is just one cell away, it has to be short-ranged and localized. This study shows that Bmp signaling mediated by Dpp and Gbb results in preferential expression of pMad and Dad in GSCs. Bmp signaling appears to elicit different levels of responses in GSCs and cystoblasts, suggesting that the cap cells are likely to be a source
for active short-ranged Bmp signals. These observations support the idea that Bmp signals are active only around cap cells. Consistently, when GSCs lose contact with the cap cells following the removal of adherens junctions they move away from the niche and then are lost. As
gbb and dpp mRNAs are broadly expressed in the other somatic
cells of the germarium besides cap cells, localized active Bmp proteins around cap cells could be generated by localized translation and/or activation of Bmp proteins. As they can function as long-range signals, it
remains unclear how Dpp and Gbb act as short-range signals in the GSC
niche (Song, 2004).
Bmp signaling and
bam expression are in direct opposition in Drosophila ovarian
GSCs. bam is actively repressed in GSCs through a defined transcriptional silencer. These observations lead to a model in which Bmp
signals from the niche maintain adjacent germ cells as GSCs by actively
suppressing bam transcription and thus preventing differentiation
into cystoblasts. The levels of pMad are correlated with the
amount of bam transcriptional repression in GSCs and cystoblasts. In the wild-type germarium, pMad is highly expressed in GSCs and some cystoblasts where bam is repressed. In other cystoblasts and differentiated germline cysts, pMad is reduced to very low levels, and thus bam transcriptional repression is relieved. In the GSCs mutant for dpp, gbb or punt, pMad levels are severely reduced, and bam begins to be expressed. The repression of bam transcription as a result of dpp overexpression seems to be a rapid process; bam mRNA is reduced to below detectable levels two hours after dpp is overexpressed. This suggests that repression of bam transcription by Bmp signaling could be direct. Furthermore, Med and Mad can
bind to the defined bam silencer in vitro, which also supports the
idea that Bmp signaling acts directly to repress bam transcription.
Dpp signaling has also been shown to repress brinker (brk) expression in the wing imaginal disc and in the embryo. The
repression of brk expression by Dpp signaling is mediated by the
direct binding of Mad and Med to a silencer element in the brk
promoter. Since the brk silencer is very similar to the
bam silencer, the results suggest that bam repression in
GSCs is also mediated directly by Dpp and Gbb in a similar manner (Song, 2004).
It remains unclear how the binding of Med and Mad to the bam
silencer results in bam transcriptional repression in GSCs. For the
brk silencer, Dpp signaling and Shn are both required to repress
brk expression in the Drosophila wing disc and embryo. Mad and Med belong to the Smad protein family, which are known to function as
transcriptional activators by recruiting co-activators with histone
acetyltransferase activity. In the wing disc, Shn is proposed to function as a switch factor that converts
the activating property of Mad and Med proteins into a transcriptional
repressor property. Possibly, the Mad-Med complex could also recruit Shn to the bam repressor element. Consistent with the possible role of Shn in repressing bam expression in GSCs is the observation that GSCs that lose shn function differentiate, and thus are lost.
Also, it remains possible that Mad and Med could recruit a repressor other
than Shn when binding to the bam repressor element. In the future, it will be very important to determine whether Shn itself is a co-repressor for Mad/Med proteins or whether it directly recruits a co-repressor to repress bam transcription in GSCs (Song, 2004).
Stem cells are responsible for replacing damaged or dying cells in various adult tissues throughout a lifetime. They possess great potential for future regenerative medicine and gene therapy. However, the mechanisms governing stem cell regulation are poorly understood. Germline stem cells (GSCs) in the Drosophila testis have been shown to reside in niches, and thus these represent an excellent system for studying relationships between niches and stem cells. Bmp signals from somatic cells are essential for maintaining GSCs in the Drosophila testis. Somatic cyst cells and hub cells express two Bmp molecules, Gbb and Dpp. Genetic analysis indicates that gbb functions cooperatively with dpp to maintain male GSCs, although gbb alone is essential for GSC maintenance. Furthermore, mutant clonal analysis shows that Bmp signals directly act on GSCs and control their maintenance. In GSCs defective in Bmp signaling, expression of bam is upregulated, whereas forced bam expression in GSCs causes the GSCs to be lost. This study demonstrates that Bmp signals from the somatic cells maintain GSCs, at least in part, by repressing bam expression in the Drosophila testis. dpp signaling is known to be essential for maintaining GSCs in the Drosophila ovary. This study further suggests that both Drosophila male and female GSCs use Bmp signals to maintain GSCs (Kawase, 2004). To determine the sources for Gbb and Dpp in the testis, RT-PCR was used to study the presence of gbb and dpp mRNAs in the purified hub
cells, somatic cyst cells and germ cells using fluorescent-activated cell
sorting (FACS). The hub cells were marked by the upd-gal4 driven
UAS-GFP expression. The somatic cyst cells and somatic stem cells were marked by the c587-gal4-driven UAS-GFP. vasa is a germline-specific gene. The germ cells were marked by a vasa-GFP transgene. The tips of the
testes were isolated and dissociated, and the GFP-positive cells were purified
from the dissociated testicular cells by FACS. As a control, vasa
mRNAs were present in the whole testis and isolated germ cells but were absent in the somatic cyst cells and hub cells. Interestingly,
gbb and dpp mRNAs were present in the hub cells and the
somatic cysts/somatic stem cells but were absent in the germ cells. In addition, dpp mRNAs appeared to be less abundant than gbb mRNAs in the
testis. These results indicate that both Dpp and Gbb are probably somatic
cell-derived Bmp signals that directly regulate GSC maintenance in the
testis (Kawase, 2004).
Retrograde BMP signaling in neurons plays conserved roles in synaptic efficacy and subtype-specific gene expression. However, a role for retrograde BMP signaling in the behavioral output of neuronal networks has not been established. Insect development proceeds through a series of stages punctuated by ecdysis, a complex patterned behavior coordinated by a dedicated neuronal network. In Drosophila, larval ecdysis sheds the old cuticle between larval stages, and pupal ecdysis everts the head and appendages to their adult external position during metamorphosis. This study found that mutants of the type II BMP receptor wit exhibited a defect in the timing of larval ecdysis and in the completion of pupal ecdysis. These phenotypes largely recapitulate those previously observed upon ablation of CCAP neurons, an integral subset of the ecdysis neuronal network. This study establish that retrograde BMP signaling in only the efferent subset of CCAP neurons (CCAP-ENs) is required to cell-autonomously upregulate expression of the peptide hormones CCAP, Mip and Bursicon β. In wit mutants, restoration of wit exclusively in CCAP neurons significantly rescued peptide hormone expression and ecdysis phenotypes. Moreover, combinatorial restoration of peptide hormone expression in CCAP neurons in wit mutants also significantly rescued wit ecdysis phenotypes. Collectively, these data demonstrate a novel role for retrograde BMP signaling in maintaining the behavioral output of a neuronal network and uncover the underlying cellular and gene regulatory substrates (Veverytsa, 2011).
Retrograde BMP signaling is required to maintain the behavioral output of neuronal networks. Collectively, these data show that retrograde BMP signaling upregulates the expression of a combination of peptide hormones, exclusively in the CCAP-EN subset of CCAP neurons and to a level required for those neurons to contribute to the normal execution of ecdysis behaviors. These findings in relation to the function of CCAP-ENs in ecdysis, as well as the utility of retrograde signaling as a conserved mechanism for differentiating neuronal identity and regulating behavior (Veverytsa, 2011).
A feed-forward peptide hormone cascade coordinates ecdysis. Larval and pupal pre-ecdysis is initiated by Ecdysis triggering hormone (ETH) from peripheral Inka cells stimulating Eclosion hormone (EH) secretion from brain Vm neurons. ETH and EH then act together on CCAP neurons to stimulate CCAP and Mip release. Work on the isolated Manduca central nervous system demonstrates that CCAP and MIP synergistically terminate pre-ecdysis and initiate ecdysis proper motor rhythm. This is supported by Drosophila studies; CCAP neuron ablation prolongs pre-ecdysis and ecdysis proper in larvae, and results in a deficit in the execution of the ecdysis program in pupae that reduces head and appendage eversion and extension. This role for CCAP neurons has largely been attributed to abdominal CCAP-INs acting locally on motoneurons. However, these observations indicate an essential role for BMP-dependent peptide hormone expression in CCAP-ENs. A detailed analysis of ETH-driven neuronal activity during Drosophila pupal ecdysis supports these conclusions. This study shows that T3 and A8/A9 CCAP neurons are active at the start of ecdysis proper, coincident with head eversion, and that A1-A4 CCAP neurons are active secondarily and throughout the remainder of ecdysis proper, coincident with appendage and head extension. It is suggested that the A1-A4 CCAP neurons active during pupal ecdysis proper and required for leg extension are CCAP-ENs. How would CCAP-ENs that secrete hormones into the hemolymph regulate ecdysis? It has been argued that hemolymph-borne CCAP, Mip and bursicon regulate heart rate, hemolymph pressure and cuticle expansion. However, these peptide hormones might also regulate the activity of central circuits, either indirectly or directly, as established for ETH. Genetic analysis of CCAP, Mip and bursicon peptide hormones and their receptors would provide valuable answers to these questions (Veverytsa, 2011).
CCAP-ENs require peripherally derived Gbb for BMP signaling and enhanced peptide hormone expression. CCAP-EN axons terminate on muscle 12. Muscle expresses Gbb and this study found that muscle-derived (but not neuronal-derived) Gbb significantly rescued BMP signaling and peptide hormone expression in CCAP-ENs. pMad immunoreactivity and GFP-Tkv (expressed from Ccap-GAL4) were also observed within type III boutons, indicative of local BMP signaling. Thus, together with reports that muscle-derived Gbb is sufficient for retrograde BMP signaling in motoneurons, the weight of evidence supports the somatic muscle as a primary target for Gbb access for CCAP-ENs. However, the possibility cannot be ruled out that other sources for Gbb exist, perhaps secreting the ligand into the circulating hemolymph. In this regard, it has been reported that, in gbb mutants, restoration of Gbb in another peripheral tissue, the fat body, failed to rescue BMP signaling in neurons, suggesting that distant signaling via the hemolymph is not sufficient. Further detailed analysis will be required to identify necessary and/or redundant roles for other tissues in neuronal BMP signaling (Veverytsa, 2011).
Although muscle is the likeliest target with respect to gbb, the muscle is unlikely to be the primary target for CCAP-EN peptide hormones. Ultrastructural analysis shows that type III boutons lie superficially on the muscle surface and that dense core vesicles exocytose towards the hemolymph and muscle. Furthermore, bursicon immunoreactivity is detectable in the hemolymph. CCAP-EN peptide hormones are known to target the wing, cuticle and cardiac and visceral muscle, but not the somatic muscle. This situation is unusual, as target-derived factors are typically viewed as influencing neuronal gene expression profiles pertinent to the target itself. Footpad-derived cytokines induce cholinergic differentiation of sympathetic neurons required for footpad sweat secretion. Axial differences in BMP4 ligand expression in the murine face direct subset-specific gene expression in innervating trigeminal neurons that shapes the formation of somatosensory maps. Activin and nerve growth factor in the developing skin induce expression of the hyperalgesic neuropeptide calcitonin gene-related peptide (CGRP) in nociceptive afferents (Veverytsa, 2011).
Without evidence for such a mutualistic relationship, what purpose could retrograde BMP-dependent gene expression play in CCAP-ENs? The tremendous cellular diversity of the nervous system is achieved through the progressive refinement of transcriptional cascades within increasingly diversified neuronal progenitor populations . Subsequently, retrograde signaling further differentiates the expression profile in postmitotic neurons. In such cases, unique access to extrinsic ligands allows for a certain mechanistic economy, enabling a somewhat common regulatory landscape to be adapted towards distinct gene expression profiles. In this context, it is postulated that retrograde BMP signaling functions to diversify the expression levels of peptide hormones in CCAP neurons. Drosophila interneurons and efferents can be sharply distinguished on the basis of BMP activity. Moreover, this study shows that BMP activation in CCAP-INs is capable of enhancing their peptide hormone expression, implicating a similar gene regulatory landscape in CCAP-ENs and CCAP-INs. Thus, the BMP dependence of CCAP, Mip and Bursß offers a simple solution to the problem of how to selectively enhance peptide hormone expression in CCAP-ENs (Veverytsa, 2011).
BMP signaling offers an additional advantage to neuronal diversification. Studies of axial patterning in Drosophila have unveiled a wealth of mechanisms that diversify and gauge transcriptional responses to BMP signaling. These mechanisms revolve around the outcome of pMad/Medea activity at a gene's cis-regulatory sequence, as influenced by their affinity for specific cis-regulatory sequences and local interactions with other transcription factors, co-activators and co-repressors. As a result, pMad/Medea activity can be extensively shaped to generate gene- and cell-specific responses and determine whether genes are on or off or up- or downregulated. This flexibility is likely to underpin the differential sensitivity of CCAP, Mip and Bursß to a common retrograde BMP signal within a single cell, as well as the utility of BMP signaling as a common retrograde regulator of subset-specific gene expression in distinct neuronal populations (Veverytsa, 2011).
Finally, the differential regulation of Bursα and Bursβ is intriguing because they are believed to only function as a heterodimer. Although the possibility of functional homodimers cannot be discounted, it is postulated that the selective BMP dependence of Bursβ might be an efficient mechanism for modulating the activity of the active bursicon hormone. This would be analogous, and perhaps orthologous, to the regulation of follicle-stimulating hormone in mammals. Its cyclical upregulation during the oestrous cycle is dictated by the regulation of only one of its subunits, FSHβ, by the TGFβ family ligand activin (Veverytsa, 2011).
Numerous studies have described the impact of retrograde signaling on neuronal network formation and function. During spinal sensory motor circuit development, retrograde neurotrophin signaling induces specific transcription factor expression in motoneurons and Ia afferents that is required for appropriate motor sensory central connectivity, which, when inoperative, results in ataxic limb movement. Similarly, murine trigeminal neurons utilize spatially patterned BMP4 expression in the developing face to target their centrally projecting axons in a somatotopically appropriate manner. Retrograde signaling also modulates physiologically responsive neuronal gene expression. In vertebrates, skin injury induces cutaneous activin and nerve growth factor expression, which retrogradely upregulates sensory neuron expression of CGRP, which mediates hyperalgesia. In sensory motor circuits of Aplysia, retrograde signals are required to upregulate presynaptic sensorin, a neuropeptide required for long-term facilitation of the sensorimotor synapse (Veverytsa, 2011).
The current evidence suggests that the function of BMP signaling is not mediated within a specific developmental window, but is required on an ongoing basis. The Ccap-GAL4 transgene is not active until late larval stage L1, after CCAP neuron network assembly and peptide hormone initiation. Yet, wit phenotypes were significantly rescued using Ccap-GAL4. Together with observation of persistent pMad immunoreactivity in CCAP-ENs, it is concluded that BMP signaling acts permissively to maintain the capacity of CCAP-ENs to contribute to ecdysis, rather than acting phasically at ecdysis to instructively activate ecdysis behaviors or enable CCAP-ENs to contribute. Such a maintenance role is supported by previous work showing that maintained expression of the neuropeptide FMRFa requires persistent retrograde BMP signaling. It was also found that type III synapses on muscle 12 have significantly fewer boutons and shorter branches in wit mutants, implicating a role for BMP signaling in CCAP-EN synaptic morphology, as first described for type I neuromuscular junctions in wit mutants. It will be of interest to investigate whether dense core vesicle exocytosis is also perturbed in wit mutants, akin to the reduced synaptic vesicle exocytosis at type I boutons in wit mutants (Veverytsa, 2011).
Hyperglycemia, hyperlipidemia, and insulin resistance are hallmarks of obesity-induced type 2 diabetes, which is often caused by a high-fat diet (HFD). However, the molecular mechanisms underlying HFD-induced insulin resistance have not been elucidated in detail. This study established a Drosophila model to investigate the molecular mechanisms of HFD-induced diabetes. HFD model flies recapitulate mammalian diabetic phenotypes including elevated triglyceride and circulating glucose levels, as well as insulin resistance. Expression of glass bottom boat (gbb), a Drosophila homolog of mammalian transforming growth factor-β (TGF-β), is elevated under HFD conditions. Furthermore, overexpression of gbb in the fat body produced obese and insulin-resistant phenotypes similar to those of HFD-fed flies, whereas inhibition of Gbb signaling significantly ameliorated HFD-induced metabolic phenotypes. tribbles, a negative regulator of AKT, is a target gene of Gbb signaling in the fat body. Overexpression of tribbles in flies in the fat body phenocopied the metabolic defects associated with HFD conditions or Gbb overexpression, whereas tribbles knockdown rescued these metabolic phenotypes. These results indicate that HFD-induced TGF-β/Gbb signaling provokes insulin resistance by increasing tribbles expression (Hong, 2016).
Abnormally high fat mass is a major risk factor for the development of diabetes. Previous studies emphasize that excess adiposity results in abnormal production of cytokines, growth factors, and hormones, which in turn causes secondary diseases like insulin resistance. This study has demonstrated that HFD-induced obesity triggered TGF-β signaling, which downregulates insulin signaling in the fat body. This study also demonstrated the role of tribbles, a novel target of TGF-β/Gbb signaling, in the development of insulin resistance (Hong, 2016).
Drosophila models were used in several recent studies of diet-induced obesity, insulin resistance, hyperglycemia, and hyperinsulinemia. In Drosophila larvae, a high-sugar diet induces type 2 diabetic phenotypes including hyperglycemia, high TG, and insulin resistance. Likewise, in adult flies, HFD feeding also induces high TG and altered glucose metabolism, and in mammals it causes cardiac dysfunctions like diabetic cardiomyopathy. This study has established a Drosophila model of obesity-induced insulin resistance, which has remarkable parallels with the mammalian system, and used it to observe and investigate the development of insulin resistance under chronic over-nutrition conditions. In addition, to study the Drosophila insulin-resistance phenotype in detail, this study has developed an ex vivo culture system (Hong, 2016).
When adult flies were fed a HFD, their short- and long-term metabolic responses were different: for example, expression and secretion of Dilp2 was increased by short-term HFD but decreased by long-term HFD. Insulin signaling, which was assayed by monitoring pAKT activation and expression of the dFOXO target genes d4E-BP and dInR, was activated in short-term but not long-term HFD, whereas TG and trehalose/glucose levels in hemolymph were increased by long-term HFD. Because these pathological phenotypes in flies were very similar to the phenotypes associated with insulin-resistant diabetes in mammals, it is concluded that HFD adult flies can be used as a model of type 2 diabetes (Hong, 2016).
In addition to increasing TG levels, HFD feeding in flies increased the expression of gbb. In mice, inhibition of TGF-β signaling by knockout of Smad3 protects against diet-induced obesity and diabetes. Inhibition of TGF-β signaling may improve adipose function and reverse the effects of obesity on insulin resistance. The TGF-β/Smad3 signaling also plays a key role in adipogenesis. However, it remains unclear how TGF-β signaling is related to the onset of diet-induced obesity and diabetes. This study examined the effects of Drosophila TGF-β family ligands on obesity. Of the genes that were tested, only gbb was upregulated by HFD. Gab regulates lipid metabolism and controls energy homeostasis by responding to nutrient levels (Ballard, 2010); consequently, gbb mutants have extremely low levels of fat in the fat body, resembling a nutrient-deprived phenotype
(Ballard, 2010). On the contrary, gbb overexpression increased the TG level, mimicking the effects of nutrient-rich conditions. These data suggest that TGF-β/Gbb signaling is involved in HFD-induced obesity. Indeed, overexpression of gbb in the fat body phenocopied the TG and trehalose/glucose levels in flies fed a HFD. However, Dilp2 expression was increased by gbb overexpression in the fat body, consistent with the effects of short-term but not long-term HFD (Hong, 2016).
Focused was placed on three negative regulators of insulin signaling, PTP1b, PTEN, and tribbles 3 (TRB3), which are involved in insulin resistance in obese mammals. tribbles was upregulated in gbb-overexpressing cells and flies. In mammals, Tribbles encodes an evolutionarily conserved kinase that plays multiple roles in development, tissue homeostasis, and metabolism. A mammalian Tribbles homolog, Tribbles homolog 3 (TRB3), is highly expressed in liver tissue under fasting and diabetic conditions, and inhibits insulin signaling by direct binding to Akt and blocking phosphorylation-dependent Akt activation. Indeed, the expression level of TRB3 is elevated in patients with type 2 diabetes and animal models of this disease. In the systemic sclerosis model, TGF-β signaling can induce mammalian TRB3 and activates TGF-β signaling-mediated fibrosi. Recent work showed that Drosophila tribbles, like mammalian TRB3, inhibits insulin-mediated growth by blocking Akt activation. In this study, tribbles expression was increased in HFD conditions in both mice and flies, as well as in TGF-β-treated human liver cells. tribbles knockdown rescued the diabetic phenotypes caused by HFD, consistent with previous findings in mammals. In addition, tribbles knockdown rescued the diabetic phenotypes caused by gbb overexpression. These data strongly suggest that the evolutionarily conserved tribbles gene is a novel downstream target of Gbb signaling, and that tribbles knockdown rescues diabetic phenotypes in flies. Therefore, future studies should seek to elucidate TGF-β-Trb3 signaling and its functions in mammalian adipocytes; the resultant findings could suggest new strategies for preventing type 2 diabetes (Hong, 2016).
In summary, This study established a Drosophila insulin-resistance model and demonstrated that Gbb signaling in the fat body plays a critical role in obesity-mediated insulin resistance by regulating tribbles expression. These results provide insights regarding the function of Gbb/TGF-β signaling in metabolic disease, and suggest that this pathway represents a promising therapeutic target for treatment of obesity and diabetes (Hong, 2016).
Expression of a Tgfbeta-60A cDNA in Drosophila S2 cells was used to determine that Tgfbeta-60A encodes a preproprotein precursor that is proteolytically processed to yield secreted amino- and carboxy-terminal polypeptides. The carboxy-terminal peptides are recovered as disulfide-linked homodimers (Doctor, 1992).
Structurally unrelated neural inducers in vertebrate and
invertebrate embryos have been proposed to function by
binding to BMP4 or Dpp, respectively, and preventing these
homologous signals from activating their receptor(s). The functions of various forms
of the Drosophila Sog protein were examined using the discriminating
assay of Drosophila wing development. Misexpression of Drosophila Sog, or its vertebrate counterpart Chordin, generates a very limited vein-loss
phenotype. This sog misexpression phenotype is very
similar to that of viable mutants of glass-bottom boat (gbb),
which encodes a BMP family member. Consistent with Sog
selectively interfering with Gbb signaling, Sog can block
the effect of misexpressing Gbb, but not Dpp in the wing.
In contrast to the limited BMP inhibitory activity of Sog,
carboxy-truncated forms of Sog,
referred to as Supersog, have been identified which when misexpressed cause a
broad range of dpp minus mutant phenotypes. Evidence is provided that Twisted gastrulation (Tsg) functions in the embryo to generate a
Supersog-like activity, perhaps by modifying the enzymic activity of Tolloid, the enzyme that processes Sog (Yu, 2000).
The predicted Sog protein is 1038
amino acids in length and contains four cysteine-rich (CR) domains
in the extracellular domain. The
metalloprotease Tld cleaves Sog at three major sites. Supersog1 is
an N-terminal fragment of Sog including CR1 plus another 114
amino acids, and contains an additional 33 amino acids derived from
vector sequences at its C terminus. Supersog2, which
contains the same amino acids as Supersog1 but terminates abruptly
at the end of Sog sequences, also generates Supersog phenotypes,
albeit slightly weaker than those observed with Supersog1. Supersog4 is an N-terminal fragment of Sog ending 80
amino acids before CR2 and includes 130 sog 3' UTR derived amino
acids (Yu, 2000).
In line with its
phenotypic effects, Supersog can block the effects of both misexpressing Dpp and Gbb in the wing. Vertebrate Noggin, in contrast, acts as a general inhibitor of Dpp signaling, which can interfere with the effect of overexpressing Dpp, but not Gbb. Evidence suggests that Sog processing occurs in vivo and is biologically relevant. Overexpression of intact Sog in embryos and adult wing primordia leads to the developmentally regulated processing of Sog. This in vivo processing of Sog can be duplicated in vitro by treating Sog with a combination of the metalloprotease Tolloid (Tld) plus Twisted Gastrulation (Tsg), another extracellular factor involved in Dpp signaling. In accord with this result, coexpression of intact Sog and Tsg in developing wings generates a phenotype very similar to that of Supersog. Evidence is provided that tsg functions in the embryo to generate a Supersog-like activity, since Supersog can partially rescue tsg minus mutants. Consistent with this finding, sog minus and tsg minus mutants exhibit similar dorsal patterning defects during early gastrulation. These results indicate that differential processing of Sog generates a novel BMP inhibitory activity during development and, more generally, that BMP antagonists play distinct roles in regulating the quality as well as the magnitude of BMP signaling (Yu, 2000).
The Drosophila short gastrulation gene encodes a large extracellular protein (Sog) that inhibits signaling by BMP-related ligands. Sog and its vertebrate counterpart Chordin contain four copies of a cysteine repeat (CR) motif defined by 10 cysteine residues spaced in a fixed pattern and a tryptophan residue situated between the first two cysteines. This study presents a structure-function analysis of the CR repeats in Sog, using a series of deletion and point mutation constructs, as well as constructs in which CR domains have been swapped. This analysis indicates that the CR domains are individually dispensable for Sog function but that they are not interchangeable. These studies reveal three different types of Sog activity: intact Sog, which inhibits signaling mediated by the ligand Glass bottom boat (Gbb), a more broadly active class of BMP antagonist referred to as Supersog, and a newly identified activity, which may promote rather than inhibit BMP signaling. Analysis of the activities of CR swap constructs indicates that the CR domains are required for full activity of the various forms of Sog but that the type of Sog activity is determined primarily by surrounding protein sequences. Cumulatively, this analysis suggests that CR domains interact physically with adjacent protein sequences to create forms of Sog with distinct BMP modulatory activities (Yu, 2004).
The Sog CR domains are defined by a set of 10 cysteine residues with a conserved spacing and a single tryptophan residue located between the first two cysteines. The function of the tryptophan residues was examined by mutating them individually or all to alanine. The finding that all four single W --> A mutants have wild-type Sog function as assayed by misexpression in the wing, either alone or when coexpressed with Tsg, indicates that none of these residues is individually essential for either Sog or Tsg + Sog (Supersog) activities. This finding is also consistent with the results of deleting the individual CR domains. When all four tryptophans were mutated to alanine, however, the Sog-like activity remained relatively unaffected but this mutant was greatly compromised in its ability to interact with Tsg to generate a Supersog-like activity. These results suggest that the tryptophan residues in two or more CRs can mediate functional interaction with Tsg and that Sog residues outside of the four conserved tryptophans are not sufficient on their own to mediate this interaction. However, deletion of the stem region also eliminates the functional Tsg interaction since a mutant lacking the stem and CR1 fails to interact with Tsg while a mutant lacking just CR1 interacts fully. The requirement for the stem region in interacting with Tsg is consistent with both CR and stem sequences being essential for Supersog activity (Yu, 2004).
Truncated forms of Sog consisting of CR1, the stem, and CR2 behave differently from either Sog or Supersog constructs when misexpressed in the wing or embryo. The strongest form of this novel Sog activity is observed when both CR3 and CR4 are deleted (e.g., SogCR1,2). Several lines of evidence suggest that Sog CR1,2 functions by promoting BMP signaling. (1) The effect of misexpressing SogCR1,2 on gene expression in wing discs is most similar to that of misexpressing an activated Sax receptor or the putative Sax ligand Gbb. This profile of gene response is quite distinct from that resulting from misexpression of activated or dominant-negative forms of the BMP receptor or EGF-receptor pathway, which is the other major signaling system regulating early vein development. (2) Misexpression of SogCR1,2 in pupal wings by heat shock results in significant ectopic expression of the rho gene, which is a good measure of BMP vs. EGF-R pathway activation during this stage. (3) Expression of SogCR1,2 in the early embryo broadens the dorsal expression domain of the BMP target gene zen (Yu, 2004).
One attractive model for a positive function of Sog such as that potentially mediated by SogCR1,2 is that in addition to binding to BMPs and preventing them from gaining access to the receptors, Sog might also act as a carrier of BMPs to either protect them from degradation or possibly transport them dorsally. Since the CR3 and CR4 domains appear to be those most critical to inhibition of Gbb/Scw activity, it is possible that the apparent positive activity of SogCR1,2 is the result of removing the Scw/Gbb inhibitory activity, while leaving a carrier function intact. The difference between the activity of SogCR1,2 and Supersog molecules, which lack the CR2 domain, might be explained if CR1 and CR2 can interact in SogCR1,2 to prevent CR1 and/or adjacent sequences from interacting with Dpp, thus neutralizing this remaining potential BMP inhibitory activity. It is currently unclear what relationship, if any, the SogCR1,2 activity has to the positive function of Sog required to sustain dorsal expression of race in the early embryo. SogCR1,2, unlike intact Sog, is unable to rescue race at a distance, but can broaden dorsal zen expression, which intact Sog does not do. The apparent differences between these activities may be the result of threshold-dependent effects in the early embryo or may reflect a fundamentally different mode of action (Yu, 2004).
An important question is whether truncated forms of Sog similar to SogCR1,2 or SogDeltaCR4 are generated and function in vivo. It is known that Tld can cleave Sog in vitro to generate products of approximately the same size as these constructs, and Sog-reactive bands of approximately the same size are observed in early embryos and pupal wings. In addition, forms of Chordin similar in structure to SogCR1,2 and Supersog are produced in humans as the result of alternative RNA splicing . Further analysis of the production and activity of SogCR1,2-like molecules will be required to determine the relevance of such forms in vivo and to determine the mechanism by which they may act on the BMP pathway (Yu, 2004).
Analysis of Sog mutants in which individual CRs are deleted or single conserved tryptophan residues are mutated to alanine suggests that the CR domains perform partially overlapping functions since none of them is absolutely essential for intact Sog activity (e.g., inhibition of Gbb/Scw) or for interaction with Tsg to create a Dpp inhibitory activity. Nonetheless, these experiments also suggest that the CR domains are not equivalent. For example, deletion of CR3 or CR4 had much greater effects in reducing the SOG-like activity than did deletion of CR1 or CR2. Moreover, the fact that Supersog, which contains only CR1, can inhibit Dpp while SogCR4 apparently interferes selectively with Gbb, suggested that CR1 might bind Dpp while CR4 bound Gbb. The results of the CR swap experiments performed in the contexts of SogCR4, Supersog1, and SogCR1,2 are quite informative in resolving this question and provide a surprising answer, namely that sequences adjacent to CR domains are the primary determinants of BMP specificity (Yu, 2004).
While replacing a CR domain in swap constructs typically resulted in greatly reduced activity or inactivity of UAS-transgenes tested as single- or multicopy insertions, those that had activity generated phenotypes similar to those of the parent constructs. These data suggest that the CRs are required in a context-specific fashion to boost the activity levels of the various forms of Sog. These findings, although limited in scope, suggest that the primary determinant of the quality of Sog activity lies within the sequences surrounding the CRs rather than within the CR domains themselves. These non-CR sequences may correspond to identified repetitive motifs such as the SR repeats or the circularly permuted SOG/CHRD domains. The simplest interpretation of this result is that CRs contribute to defining the strength and surrounding sequences determine the specificity of Sog activities. This model of Sog function is consistent with the finding that deletion of any single CR does not eliminate Sog-like activity (e.g., inhibition of Scw/Gbb) or the ability to interact with Tsg (e.g., inhibition of Dpp) and that both the CR1 domain and adjacent stem sequences are required for Supersog activity. The fact that the conserved tryptophans in the CR domains are required in aggregate, but not individually, for interaction with Tsg and that stem sequences are also required for this interaction lends additional support to the view that the CRs function in a partially redundant fashion in conjunction with non-CR sequences. One potential explanation for the results reported here is that the CR domains alone bind to BMPs, but do so with little selectivity. The surrounding sequences may provide specificity by interacting with only a subset of BMPs, thereby increasing the affinity of adjacent CRs for particular BMPs. Alternatively, surrounding sequences may alter the conformation of CR domains or sterically limit their interactions with BMPs, rendering them more selective. Further biochemical analysis will be required to determine the degree to which CRs affect affinity of the various Sog forms for particular BMPs and the mechanism by which surrounding sequences may confer specificity for binding particular BMPs (Yu, 2004).
In the early Drosophila embryo, Bone morphogenetic protein (BMP) activity is positively and negatively regulated by the BMP-binding proteins Short gastrulation (Sog) and Twisted gastrulation (Tsg). A similar mechanism operates during crossvein formation, utilizing Sog and a new member of the tsg gene family, encoded by the crossveinless (cv) locus. The initial specification of crossvein fate in the Drosophila wing requires signaling mediated by Dpp and Gbb, two members of the BMP family. cv is required for the promotion of BMP signaling in the crossveins. Large sog clones disrupt posterior crossvein formation, suggesting that Sog and Cv act together in this context. sog and cv can have both positive and negative effects on BMP signaling in the wing. Moreover, Cv is functionally equivalent to Tsg, since Tsg and Cv can substitute for each other's activity. It is also confirmed that Tsg and Cv have similar biochemical activities: Sog/Cv complex binds a Dpp/Gbb heterodimer with high affinity. Taken together, these studies suggest that Sog and Cv promote BMP signaling by transporting a BMP heterodimer from the longitudinal veins into the crossvein regions (Shimmi, 2005b).
One interesting aspect of BMP signaling in many developmental contexts is that its activity can be regulated at the extracellular level by a number of secreted factors. In Drosophila, these include the products of the short gastrulation (sog), twisted gastrulation (tsg), and tolloid (tld) genes. All three genes were identified as modulators of BMP signaling in the early embryo, and their developmental functions have been well characterized. At the blastoderm stage, BMP signals provided by the dorsally expressed Decapentaplegic (Dpp), and by the generally expressed Screw (Scw), a second ligand that forms a heterodimer with Dpp (Shimmi, 2005a), instruct cells to adopt either amnioserosa or dorsal ectoderm fate. Proper subdivision into these two cell types requires the action of Sog, Tsg, and Tld. Sog and Tsg are BMP-binding proteins that make a high-affinity complex with the Dpp/Scw heterodimer. This complex reduces BMP signaling in the dorsal-lateral regions by blocking the ability of the heterodimer to bind to receptors. Thus, a major role of the Sog/Tsg complex is to antagonize signaling, and similar activity has been found for the vertebrate homologs Chordin and Tsg (Shimmi, 2005b and references therein).
However, the Sog/Tsg complex also stimulates BMP signaling in the dorsal-most cells of Drosophila embryo; it is thought to do so by protecting the ligand from degradation and enabling it to diffuse over long distances. Since sog is expressed in ventral-lateral cells adjacent to the dorsal cells that express dpp, scw, and tsg, the net flux of Sog towards the dorsal side provides a driving force that concentrates BMP heterodimer in the dorsal-most region of the embryo. The ligand is then released for signaling by Tld, an extracellular metalloprotease that cleaves Sog in a BMP-dependent manner. Concentration of the heterodimer to the dorsal-most cells by this facilitated transport mechanism provides a high level signal that specifies amnioserosa cell fate, while dorsal-lateral cells receive less BMP signal and become dorsal ectoderm (Shimmi, 2005b and references therein).
The ability of Tsg to stimulate BMP signaling is apparently not limited to the early Drosophila embryo. Vertebrate Tsg can stimulate BMP signaling in some circumstances, and is required to stimulate high levels of BMP signaling during axis formation in the zebrafish embryo. However, in these cases, Tsg may act, not via a transport mechanism, but by antagonizing Chordin's ability to inhibit BMP signaling. Tsg increases the rate at which Chordin and Sog are cleaved and thus inactivated by Tolloid-like protease. Nonetheless, zebrafish Chordin can also apparently stimulate BMP signaling in some circumstances (Shimmi, 2005b and references therein).
This paper reports another context in which both Sog and a novel Tsg family member stimulate BMP signaling at the developing crossveins in the Drosophila pupal wing. The Drosophila wing has proven to be an attractive model system for elucidating molecular mechanisms that regulate growth and patterning. A major attribute of this system is the stereotypical array of veins that develop along the wing surfaces. These thickenings of the ectodermal cuticle serve both structural support roles for flight and act as channels for the supply of nutrients to the wing cells. For the geneticist, they provide a key set of morphological landmarks for identification of genes that affect the patterning process. Analysis of many classical mutations that alter vein cell fate and patterning have revealed the fundamental roles played by three highly conserved growth factor signaling pathways. For the five longitudinal veins (L1-L5) that form along the proximal-distal axis, a key initiating event is the localized expression of Epidermal growth factor (EGF) signaling components in the vein primordial cells during late imaginal disc development. In response to EGF receptor signaling, Delta is expressed along the veins and induces Notch to inhibit vein formation in neighboring cells. Subsequently, during pupal stages, EGF receptor signaling induces expression of dpp within the developing longitudinal veins. Expression of dpp in the longitudinal veins is required for maintenance of EGF receptor signaling and final vein differentiation, especially at the distal tips (Shimmi, 2005b and references therein).
In addition to the five longitudinal veins, two other shorter veins form perpendicular to the longitudinal veins; these are the anterior crossvein (ACV), which forms between L3 and L4, and the posterior crossvein (PCV), which forms between L4 and L5. Unlike the longitudinal veins, the crossveins do not rely on early EGF signaling for their initial specification. Instead, their formation is initiated during pupal stage by localized BMP signaling, which requires Dpp. However, in the case of the PCV, Dpp is not initially produced in the crossvein, but instead diffuses into the PCV region from the longitudinal veins. Dpp does not act alone during this process since mutations in glass bottom boat (gbb), a member of the BMP5/6/7 subfamily, also eliminate the PCV. Gbb is widely expressed during pupal wing development, but an analysis of gbb mutant clones has suggested that the active BMP component for PCV specification might be a heterodimer of Dpp and Gbb formed in the longitudinal veins, since the PCV is lost only when the clone includes cells of the longitudinal veins where Dpp is produced (Shimmi, 2005b and references therein).
Like the embryo, modulation of BMP signaling in the PCV also appears to involve several additional secreted proteins. For example, mutations in tolloid-related (tlr; also known as tolkin) and crossveinless 2 (cv-2) eliminate PCV formation by preventing BMP signals in the primordial PCV cells. The tlr gene encodes a Tolloid-like metalloprotease that is able to cleave Sog, while cv-2 encodes a protein containing 5 cysteine-rich (CR) domains, similar to the BMP-binding modules found in Sog (Shimmi, 2005b).
The similarity of these proteins to those involved in patterning the early Drosophila embryo suggests that correct specification of the PCV likely involves establishing a spatially regulated distribution of BMP ligand(s) through the activity of extracellular modulatory factors. This report provides additional evidence supporting this hypothesis by cloning the crossveinless (cv) gene and analyzing its function. cv encodes a new member of the tsg gene family. Like mutations in cv-2 and tlr, loss of cv prevents accumulation of phosphorylated Mad (pMad), the active form of the major transcription effector of BMP signaling, in the crossvein cells. In addition, ectopic expression studies were used to show that Cv and Tsg have functionally related activities, since each can substitute for the other in vivo, and ectopic expression of Cv and Sog phenocopies co-expression of Tsg and Sog. These observations led to a re-examination of the role of Sog during wing vein development. Previous clonal analyses suggested that Sog acts as a dedicated antagonist of BMP signaling and helps maintain longitudinal vein integrity. However, this study shows that Sog is in fact required for BMP signaling in the PCV, since large sog clones inhibit PCV formation. These data suggest that, as in the early embryo, Sog plays a dual role in promoting and inhibiting BMP signaling. In light of these results, the biochemical properties of Cv were examined, and it was found that, like Tsg, it can form a high-affinity oligomeric complex with Sog and BMP heterodimers (Shimmi, 2005b).
Taken together, these results suggest that similar mechanisms govern PCV development and early embryonic development. In the embryo, a Dpp/Scw heterodimer specifies amnioserosa fate following ligand transport from lateral to dorsal-most regions through the action of Sog and Tsg. Processing of the complex by Tld then enables signaling in a restricted spatial domain. It is speculated that formation of the PCV likely requires selective transport of a Dpp/Gbb heterodimer from the longitudinal veins to the PCV competent zone through the action of Sog and the Tsg-like protein Cv. As in the embryo, the Tolloid-related enzyme may release the ligand through processing of the Sog/Cv/BMP complex to generate a spatially restricted pattern of signaling in the PCV. This example illustrates how, in different developmental contexts, related molecules and common mechanistic processes can achieve new patterning outcomes (Shimmi, 2005b).
The formation of Drosophila wing veins is a very sensitive system for examining the activity of BMP signaling within the context of a developmental patterning process. Two distinct aspects of the BMP signaling process in veins have been recognized. (1) BMP signals are produced by the developing longitudinal veins where they act locally to help maintain the vein fate earlier specified by EGF signaling. (2) BMP signals produced in the longitudinal veins act at longer range to initiate BMP signaling in the crossveins. This study shows evidence that this long-range signaling requires the activity of both Sog and a Tsg-like molecule encoded by the cv gene. Thus, within the context of the crossveins, Cv and Sog play positive roles in BMP signaling. Based on analogy to the embryonic patterning system, these results suggest that Cv and Sog aid in the transport of BMP ligands from producing cells to receiving cells in the posterior crossvein competent zone (Shimmi, 2005b).
Since Tsg and Cv showed a similar domain structure, attempts were made to determine if they were functionally equivalent by expressing one in place of the other during either embryonic or pupal development. These experiments showed that these two products are, to some extent, genetically interchangeable. However, Tsg and Cv may have been optimized for a particular developmental function that likely represents interactions with a particular ligand, i.e., Dpp/Scw heterodimers in the case of Tsg and Dpp/Gbb heterodimers in the case of Cv. A recent phylogenetic comparison of the Cv and Tsg proteins from different insect species suggests that these two proteins fall into distinct families, one Cv-like and one Tsg-like). In addition, under conditions of overexpression, cv and tsg exhibit enhanced genetic interactions with different BMP ligands. For instance, cv interacts better with gbb than with dpp. While no difference was seen in the ability of Sog and Tsg versus Sog and Cv to bind to Dpp/Gbb heterodimers, these data are qualitative. Thus, it is possible that these two protein complexes could have different affinities for different ligands that are optimal for their particular developmental function (Shimmi, 2005b).
A similar observation has recently been made for Tld and Tlr proteins. These two metalloproteases show very similar overall structure and both cleave Sog in the same positions, but with different kinetics and site preferences. In this case, the two proteins cannot substitute for the other and it has been proposed that this represents optimization of catalytic activity for a fast (Tld in the embryo) or slow (Tlr in pupal wing vein) developmental function (Shimmi, 2005b).
In the early embryo, Tsg and Sog function together to help redistribute BMP signals from their broad initial distribution profiles throughout the dorsal half of the embryo into a narrow stripe of cells centered on the dorsal midline. In this model, Tsg and Sog play both positive and negative roles. The positive role comes via transport and the resulting increase in BMP concentration at the dorsal midline. The negative role comes from blocking access of the ligand to receptors in the lateral regions during BMP transport (Shimmi, 2005b).
The process of PCV formation appears remarkably similar, at least in terms of the BMP signaling components employed. Both Sog and the Tsg-like molecule Cv are required for BMP signaling, as indicated by the accumulation of pMad, in the developing crossveins. Thus, both Cv and Sog play positive roles in augmenting BMP signaling during crossvein formation. This positive role may also come from facilitating transport of BMPs, since co-expression of Cv and Sog in the posterior compartment resulted in ectopic vein formation and BMP signaling gains in the anterior compartment. Similar, although less penetrant, effects on anterior venation have been observed when Sog alone is misexpressed (Shimmi, 2005b).
In addition, Cv and Sog may also inhibit BMP signaling around the longitudinal veins. A sog mutant clonal analysis has demonstrated a requirement for Sog in keeping longitudinal veins straight and narrow. In the absence of Sog, the veins meandered. A similar effect on the longitudinal veins is seen when cv is lost, with an expansion in pMad accumulation around the longitudinal veins. Thus, Cv and Sog may function together to restrict the range of Dpp signaling along the longitudinal veins (Shimmi, 2005b).
Two other similarities between embryonic patterning and PCV formation are worth noting. In the embryo, the Tld metalloprotease is required to release ligand from the inhibitor complex of Sog and Tsg. Likewise, the Tolloid-related protease Tlr is required for PCV formation. Tlr is expressed in the pupal wings, when it is required for crossvein pMad, and has recently been shown to process Sog at the same three sites as does Tld (Serpe, 2005). Thus, it seems likely that Tlr is needed to release a BMP ligand for signaling in the PCV competent zone (Shimmi, 2005b).
There may also be strong similarities between the embryo and crossvein patterning in their use of ligands. In the embryo, both Dpp and Scw are needed to specify the amnioserosa, while for PCV specification, both Dpp and Gbb are required. Sog and Tsg show the highest affinity for the heterodimer of Dpp/Scw in the embryo, suggesting that this is the primary transported ligand. Similarly, the ligand with highest affinity for Cv and Sog is a heterodimer of Dpp and Gbb. Interestingly, gbb mutant clonal analysis has shown that the PCV is lost only when a gbb clone encompasses adjacent longitudinal vein material. Since the longitudinal veins serve as the source of Dpp during PCV specification, these observations are consistent with the notion that a heterodimer of Dpp and Gbb is the primary ligand that specifies PCV formation (Shimmi, 2005b).
Although similarities between embryonic dorsoventral patterning and PCV formation are striking, there are clear differences. The most notable is the geometry of the system. Why is the long-range signaling from the longitudinal veins limited to the crossvein regions? Examination of the expression patterns of several components may provide some clues. Tkv expression is reduced in the crossveins, and since binding to receptor is a major impediment to diffusion in wing discs, this might enhance net flux of ligand into the area of reduced Tkv expression. However, down-regulation of tkv in the PCV actually depends on high levels of BMP signal (Ralston, 2005). Therefore, it is not likely that reduced Tkv expression provides a channel for ligand flow; rather, it may reinforce a flux direction that is initiated by other means (Shimmi, 2005b).
In this regard, it is notable that sog expression is also reduced in the crossvein regions and this is independent of BMP signaling (Ralston, 2005). As in the embryo, Sog flux from areas of high expression, i.e., intervein regions in the wing, into areas of low expression, the crossvein zones, might provide the proper positional information. Consistent with this view is the observation that uniform expression of Sog eliminates the initial stages of crossvein development. However, there are inconsistencies in this simple model. While misexpression of Sog can lead to loss of the crossvein, normally positioned crossveins appear when Sog misexpression is coupled with ubiquitous expression of Cv-2 (Ralston, 2005), suggesting that crossvein positioning can be independent of the sog expression pattern. Similarly, loss of sog from clones does not induce ectopic crossveins (this study) (Shimmi, 2005b).
Another possibility is that the cleavage of Sog is spatially regulated. In the embryo, Tld is expressed in the dorsal domain, and since its ability to process ligand is dependent on the Dpp concentration, the processing rate will be highest at the dorsal midline. However, in the pupal wing, tlr is not expressed at higher levels in the crossvein zones; instead, it is high in the entire intervein. Therefore, it is not clear how the ligand would be released from a complex of Cv and Sog specifically in the crossveins. Moreover, uniform expression of tlr causes only mild expansion of the crossveins (Shimmi, 2005b).
Perhaps the key to understanding the differences between the embryonic patterning process and that of the crossveins will be determining the mechanism of action of other gene products that are required for crossvein formation. These include cv-c, cv-d, detached, and the cv-2 gene products. Among these genes, only the cv-2 product has been identified; it is a large secreted factor that contains CR domains, similar to those found in Sog, and is expressed in the developing crossveins. The major distinction between Sog and Cv-2 is that Cv-2 contains a Von Willebrand type D domain found on many blood-clotting proteins that is not present in Sog. In Chordin, the CR modules are responsible for BMP binding and vertebrate Cv-2 homologs have also been shown to bind BMPs. Depending on the assay used, vertebrate Cv-2 homologs can either inhibit or promote signaling. Cv-2 does not seem to be required in the early embryo, yet it is essential for crossvein formation. Drosophila Cv-2, like its vertebrate counterparts, can also bind BMPs and, although it is a secreted protein, Cv-2 can associate with the cell surface. One possibility is that it captures BMPs, perhaps from a Sog/Cv complex, and keeps them close to the cell surface and in this way promotes BMP signaling by keeping the local BMP concentration high. It may also play a more direct role as a coreceptor (Shimmi, 2005b).
Nonetheless, while cv-2 is expressed in the crossveins, and is required for BMP signaling there, ubiquitous expression of cv-2 does not disrupt the positioning of the crossveins, even when coupled with ubiquitous expression of sog. Thus, other genes must act in conjunction with or upstream of these BMP modulators to help establish the crossvein competent zone. It is interesting to note in this regard that mutations in CDC42 induce ectopic crossveins, suggesting that it might be involved in the process that selects the site of crossvein formation (Shimmi, 2005b).
Normally, tsg is expressed only in the early blastoderm embryo. However, sog is expressed at several other developmental stages. In fact, this was one of the motivations to look for additional Tsg homologs, so that it might be determined if Sog always utilizes a Tsg-like partner or whether in some developmental processes it might act alone. One late embryonic process in which Sog has been implicated is to regulate tracheal morphogenesis. As in vein formation, tracheal patterning requires input from the EGFR and Dpp pathways. However, in this case, each pathway is antagonistic to the other. Normally, sog is expressed as a dorsal stripe abutting the tracheal pits, and in sog mutant embryos, hyper-activation of Dpp leads to a loss of dorsal trunk and a reduction in visceral branches. It was therefore interesting that cv is also expressed in and around the tracheal pits, but tsg is not expressed at this stage. However, no alteration was observed in tracheal development in cv mutants. Indeed, these embryos appear fully viable and the resulting adults are fertile. These results suggest that Cv has no other essential role in development. The pattern of cv expression around the tracheal pits may reflect a prior evolutionary involvement in tracheal development that is now provided by Sog alone or perhaps by Sog in conjunction with some other unknown BMP modulatory factor (Shimmi, 2005b).
The Twisted gastrulation (Tsg) proteins are modulators of bone morphogenetic protein (BMP) activity in both vertebrates and insects. The crossveinless (cv) gene of Drosophila encodes a new tsg-like gene. Genetic experiments show that cv, similarly to tsg, interacts with short gastrulation (sog) to modulate BMP signalling. Despite this common property, Cv shows a different BMP ligand specificity as compared with Tsg, and its expression is limited to the developing wing. These findings and the presence of two types of Tsg-like protein in several insects suggest that Cv represents a subgroup of the Tsg-like BMP-modulating proteins (Vilmos, 2005).
A tsg-like gene (CG12410) was found on the first chromosome between CG3160 and CG3149. It encodes a protein with about 50% homology to the Tsg protein and the same molecular topology: two cysteine-rich (CR) domains connected by a variable hinge domain. A comparison of tsg-like genes in insects suggests two subgroups in the tsg-like family typified by cv and tsg. Of the five insects for which complete genomes are available, Drosophila melanogaster, Drosophila pseudoobscura and Drosophila simulans have both a tsg-like and a cv-like gene, whereas the mosquito and bee seem to have only a cv-like gene (Vilmos, 2005).
To determine the function of CG12410, the element EP1349 that shows no mutant phenotype was excised; it is located about 700 base pairs (bp) 5' of the exon containing the predicted start codon. Four strains were recovered that delete portions of CG12410 and all showed a recessive visible crossveinless phenotype with loss of the anterior crossveins (ACV) and the posterior crossveins. Two of the four mutants were strict recessive visibles (cv18, cv43), whereas the other two (cv34, cv51) showed semilethality (22% and 53%) not linked to the cv locus (Vilmos, 2005).
As flies heterozygous for cv18 and cv1 have the same phenotype as cv1 homozygotes, CG12410 is allelic to cv. Further evidence for allelism was obtained by rescuing both cv1 and cv18 hemizygotes with CG12410 using UAS>EP1349 under the control of the ptc>Gal4 driver (Vilmos, 2005).
Although the most obvious phenotype is the absence of crossveins and a delta at the tips of the L3 and L4 veins as originally described (Bridges, 1920; Waddington, 1940), it was also found that the longitudinal veins in cv mutants show poorly defined edges and trajectories often broadening and meandering along their length in a manner similar to that seen in sog- wing tissue, suggesting that cv has a role in refining the domains where veins and crossveins form (Vilmos, 2005).
The nature of the cv mutations was determined by PCR. As cv18, cv34, cv43 and cv51 alleles delete a region that extends from the P-element insertion site past the ATG start codon to the second intron of cv, these alleles are considered as physically verified nulls. The cv1 mutation is due to a 412 retrotransposon inserted in the second intron of cv that introduces two poly(A) addition signals that should terminate the cv transcript prematurely (Vilmos, 2005).
The cv52 and cv12 mutations show no phenotype; however, they delete all the DNA from the insertion to either the adjacent gene CG3160. Thus, regulatory sequences necessary for cv function do not extend past 475 bp upstream of the cv12 breakpoint (Vilmos, 2005).
Endogenous cv messenger RNA was detected only in the developing pupal wing, with no evidence of earlier expression. Expression of cv first appears as diffuse staining in the regions of the vein primordia 24-28 h after pupariation (APF) and later refines to stripes of 2-3 cells localized at the vein-intervein boundaries and disappears by 40 h APF. By comparison, dpp and the sog-like cv-2 are expressed in the vein domain at these times, whereas sog and gbb are expressed in the intervein regions with concentrations at the boundaries that are coincident with cv (Vilmos, 2005).
Expression of UAS>cv along the anterior-posterior (A/P) border rescues both the ACV and the PCV in cv mutants, whereas tsg does not rescue either crossvein. Thus, anterior expression of cv can restore function in posterior cells. Similarly, cv expressed in the embryo does not rescue tsg mutants. Thus, Tsg and Cv are not functionally interchangeable proteins (Vilmos, 2005).
It has been well documented that the loss of BMP signalling in wings produces two phenotypes, one being reduction of wing size and the other loss of veins. The first phenotype involves an early abrogation of long-range BMP signalling, whereas the second results from a late local loss of signalling in veins (Vilmos, 2005).
It has also been shown that Tsg can inhibit BMP-like ligands by synergizing with Sog, or in other environments can promote BMP activity by displacing an inhibitory fragment of Sog generated by proteolytic cleavage. To compare the activities of Cv and Tsg, transgene combinations were expressed under the control of the wing driver A9>Gal4. Excess cv alone can induce small fragments of extra veins and a delta phenotype, consistent with a mild pro-BMP activity. In contrast, coexpression of cv and sog produces a phenotype resembling early loss of BMP signalling in the organizer that runs along the A/P boundary (i.e. reduction in size and loss of intervein regions). Interestingly, coexpression of cv and sog along the A/P border affects structures throughout the wing, whereas expression of these proteins in the posterior compartment affects only posterior structures. The asymmetric activity of cv+sog suggests a restricted mobility due either to local inhibition of a long-range signal such as Dpp or Gbb or to the existence of an asymmetric inhibitor of diffusion of Cv/Sog-containing complexes (Vilmos, 2005).
It has been postulated that Cv might synergize with Cv-2, a second Sog-like protein; however, when Cv-2 is coexpressed with either Cv or Tsg, no evidence is seen of the strong inhibition of BMP signalling observed when Cv or Tsg is coexpressed with Sog. On further underscoring a difference between Sog and Cv-2, both Cv and Sog mutants show similar effects on wing veins (loss of crossveins and expanded vein tips), whereas Cv-2 mutants show loss of vein tips as well as crossveins. Thus, Cv-2 is not interchangeable with Sog (Vilmos, 2005).
To evaluate ligand specificity, the ability was tested of Cv and Sog to suppress the wing disruptions caused by overexpressing Dpp and Gbb. Expression of cv, tsg or sog alone has no detectable effect on the overexpression of dpp. However, when expressed together with sog, cv and tsg behave fairly differently when challenged with excess Dpp. Although tsg with sog can rescue the effect of excess dpp, cv with sog does not suppress the dpp overexpression phenotype at all. Cv and Tsg also differ in their effect on Gbb overexpression. Although Cv or Sog alone has no effect on Gbb overexpression, Cv together with Sog re-establishes the intervein tissue and the longitudinal veins with a series of expanded crossveins between L2 and L3. In contrast, Tsg alone suppresses fairly effectively the excess Gbb effect, whereas Tsg together with Sog leads to an intermediate level of rescue. These observations indicate that Cv and Tsg have distinct activities with respect to the Dpp and Gbb ligands and also different requirements for Sog to inhibit BMP (Vilmos, 2005).
Morphogen gradients ensure the specification of different cell fates by dividing initially unpatterned cellular fields into distinct domains of gene expression. It is becoming clear that such gradients are not always simple concentration gradients of a single morphogen; however, the underlying mechanism of generating an activity gradient is poorly understood. This study indicates that the relative contributions of two BMP ligands, Gbb and Dpp, to patterning the wing imaginal disc along its A/P axis, change as a function of distance from the ligand source. Gbb acts over a long distance to establish BMP target gene boundaries and a variety of cell fates throughout the wing disc, while Dpp functions at a shorter range. On its own, Dpp is not sufficient to mediate the low-threshold responses at the end points of the activity gradient, a function that Gbb fulfills. Given that both ligands signal through the Tkv type I receptor to activate the same downstream effector, Mad, the difference in their effective ranges must reflect an inherent difference in the ligands themselves, influencing how they interact with other molecules. The existence of related ligands with different functional ranges may represent a conserved mechanism used in different species to generate robust long range activity gradients (Bangi, 2006a).
Wing patterning in Drosophila requires a Bmp activity gradient created by two Bmp ligands, Gbb and Dpp, and two Bmp type I receptors, Sax and Tkv. Gbb provides long-range signaling, while Dpp signals preferentially to cells near its source along the anteroposterior (AP) boundary of the wing disc. How each receptor contributes to the signaling activity of each ligand is not well understood. This study shows that while Tkv mediates signals from both Dpp and Gbb, Sax exhibits a novel function for a Bmp type I receptor: the ability to both promote and antagonize signaling. Given its high affinity for Gbb, this dual function of Sax impacts the function of Gbb in the Bmp activity gradient more profoundly than does Dpp. It is proposed that this dual function of Sax is dependent on its receptor partner. When complexed with Tkv, Sax facilitates Bmp signaling, but when alone, Sax fails to signal effectively and sequesters Gbb. Overall, this model proposes that the balance between antagonizing and promoting Bmp signaling varies across the wing pouch, modulating the level and effective range, and, thus, shaping the Bmp activity gradient. This previously unknown mechanism for modulating ligand availability and range raises important questions regarding the function of vertebrate Sax orthologs (Bangi, 2006b).
These data clarify the respective roles of Sax and Tkv in mediating Bmp signaling during wing patterning. This analysis shows that Tkv is
responsible for mediating both Dpp and Gbb signals, and that Sax has a much
more complex role in wing patterning than previously appreciated; Sax not only
promotes signaling but also antagonizes signaling by limiting the availability
of primarily the Gbb ligand. Both the antagonistic and signal promoting
functions of Sax were revealed not only by gain-of-function studies but
importantly, also by loss-of-function analyses. Loss of the antagonistic
function of endogenous sax is evident: (1) as a broadening the pMad
profile when the wing disc completely lacks sax function; and (2) as a
non-autonomous increase in pMad levels in wild-type cells abutting the
boundary of sax null clones. Loss of Sax-mediated signaling itself is evident: (1) in sax mutant discs as a reduction in the peak pMad levels along the AP boundary; and (2) in sax clones as a cell-autonomous reduction in pMad accumulation. Gain-of-function or overexpression studies indicate that the balance of Sax and Tkv levels in wing disc cells is crucial for proper signaling and, thus, wing patterning. Altogether, these results indicate that Sax is important in modulating Bmp signaling across the wing disc by both mediating and blocking Bmp signals, and, thus, shaping the Bmp activity gradient. How can the novel function of Sax as an antagonist be reconciled at the molecular level with the ability of Sax to promote signaling (Bangi, 2006b)?
Given that Tkv is required for all Bmp signaling in the wing disc, the
simplest explanation for the fact that Sax signaling appears to depend on the
presence of Tkv is that Sax can only promote signaling in a receptor complex
also containing Tkv. Three different forms of Bmp receptor complexes can
potentially form in wing disc cells, those composed of two type II receptor
molecules and either two Tkv, two Sax or one molecule of each: Tkv-Tkv,
Sax-Sax and Tkv-Sax. Overexpressing Tkv or Sax in wing disc cells enabled shifting of the balance between the relative levels of these two molecules, artificially enriching for the formation of receptor complexes homomeric for type I molecules Tkv-Tkv or Sax-Sax. Disrupting the balance of endogenous Tkv to Sax levels by
overexpressing Sax immediately reveals the antagonistic function of Sax,
consistent with the idea that excess Sax could be sequestering ligand in
Sax-Sax receptor complexes which signal either very poorly or not at all.
However, overexpression of Tkv, enriching for Tkv-Tkv complexes with high
affinity for Dpp and lower affinity for Gbb, leads to increased signaling
given sufficient ligand. The third receptor complex, Tkv-Sax, probably
accounts for the contribution of Sax to the promotion of Bmp signaling and
probably signals in vivo more efficiently than Tkv-Tkv, based on the fact that
pMad levels are lower inside clones devoid of Sax than the pMad levels seen in
cells at an equivalent position along the AP axis elsewhere on the disc. Loss of Tkv, by definition, eliminates signaling by both Tkv-Tkv and Tkv-Sax, leaving only
Sax-Sax containing receptor complexes, which are clearly unable to elicit a
pMad-mediated signal on their own. Thus, the model predicts that removing Sax
function results in two opposing consequences: (1) a reduction in total Bmp
signaling caused by loss of Tkv-Sax complexes, and (2) an increased
availability of Bmp ligand and potential signaling caused by loss of Sax-Sax
complexes. Several biochemical studies support the putative existence of functional Sax-Tkv receptor complexes. Heteromeric complexes involving different vertebrate type I receptors have been shown to contribute to a single signaling receptor
complex and in Drosophila S2 cells both Sax and Tkv appear to be necessary to
produce a synergistic signal (Bangi, 2006b).
It is important to note that increasing wild-type Tkv levels in the
presence versus absence of excess ligand results in very different phenotypic
outcomes. In contrast to Sax, increasing Tkv in the presence of excess ligand
leads to a larger increase in Bmp signaling. However, at endogenous ligand
levels, as Tkv levels are experimentally increased, a loss of Bmp
signaling is seen that is indicative of the preference of Tkv for binding Dpp over Gbb. Clearly, both Gbb and Dpp become limiting in the presence of excess
Tkv, with low level Tkv overexpression preferentially limiting Dpp-dependent
signaling, while higher levels of overexpression limit both. Clearly, although
overexpression of ligand and receptor together reveals a significant
difference in the signaling ability of Tkv and Sax, overexpression of receptor
alone in the absence of increased ligand appears to reflect only receptor
ligand-binding preference (Bangi, 2006b).
Such experimental manipulations of Tkv levels can lead to the loss of Bmp
signaling by limiting the range of Bmp signaling, but unlike sax,
loss of endogenous tkv function never leads to an increase in Bmp
signaling. Furthermore, there is no indication that Tkv is required for or
involved in the antagonistic function of Sax. At endogenous levels, Sax-Sax
complexes, unlike Tkv-Tkv or Tkv-Sax complexes, appear to modulate the range
of Bmp signaling by sequestering ligand without any associated signaling, and,
thus, Sax identifies a new previously unrecognized Bmp modulator whose
signaling ability appears to depend on which receptor it partners (Bangi, 2006b).
The fact that both Dpp and Gbb are dependent on Tkv for signaling has
significant implications regarding the Bmp activity gradient, given that
removal of Tkv at any point along the gradient results in the loss of both Gbb
and Dpp signaling, not just Dpp signaling. When both ligands are present at
similar levels, the higher affinity of Dpp for Tkv means the contribution of
Dpp to total Bmp signaling will be more significant than that of Gbb, and
movement of Dpp across the wing disc will be affected more strongly by Tkv
than that of Gbb. Thus, Gbb should and does contribute more significantly to
the low points of the Bmp activity gradient, especially since competition with Dpp for binding to Tkv will also be lower in these regions (Bangi, 2006b).
These findings from receptor and ligand overexpresion experiments suggest
that both the antagonistic and signal promoting functions of Sax impact Gbb
signaling most significantly because of their preferential interaction. For
example, although localized loss of Sax from the peripheral cells of the wing
pouch leads to ectopic induction of brk, loss in more central cells
does not, suggesting that the relative contribution of Sax to overall Bmp
signaling is less in the central cells where Tkv must contribute more
significantly given the higher level of Dpp near the AP boundary. The greater
contribution of Sax to total signaling in the more peripheral cells of the
wing pouch is consistent with its higher affinity for Gbb and the long-range
nature of Gbb versus Dpp (Bangi, 2006b). Similarly, removal of Sax from just anterior compartment cells results in brk repression in both the anterior and
posterior compartments suggesting that in the absence of Sax,
anteriorly expressed Gbb can signal to the posterior-most cells of the wing
pouch to effectively repress brk expression beyond its normal domain.
This result indicates that endogenous Sax normally functions to not only
restrict the level of Gbb signaling but also the range of Gbb. The role that
Sax plays in promoting Gbb function, in particular, is detected only when
sax function is completely eliminated and gbb function is
also significantly compromised (Bangi, 2006b).
Given that Tkv is also required for mediating Gbb signals, of the two
proposed receptor complexes that could mediate Gbb signaling (Tkv-Tkv and
Tkv-Sax), which is preferentially used by Gbb in wild-type cells? It is clear
that Tkv-Sax complexes are not obligatory for Gbb signaling since Gbb signaling
is not abolished in sax mutants. The fact that removing Sax does not
cause a gbb loss-of-function phenotype indicates that enough Gbb is
made available by the loss of Sax antagonism and can signal to compensate for
losing that region of total signaling that Sax normally promotes. The fact that pMad levels within a sax clone are lower then endogenous levels indicates that signaling in the clone cells containing only Tkv-Tkv is less efficient than the neighboring cells that have wild-type levels of both Sax and Tkv (Bangi, 2006b).
A synergy has been observed between co-expressed constitutively active (CA)
Tkv and Sax in the early embryo and between Tkv and Sax in S2 cells in response to Dpp-Scw heterodimers, since only Dpp homodimers are able to signal efficiently in the absence of Sax. A likely, albeit minimal, contribution of
Dpp-Gbb heterodimers to long-range wing patterning has been detected
(Bangi, 2006a) making it is possible that Tkv-Sax complexes could respond to Dpp-Gbb
heterodimers and such complexes could be particularly efficient at signaling.
Given the dual function of Sax, the relative levels of Sax to Tkv are likely
to be crucial for establishing a synergistic interaction. The ability of
Tkv-Sax containing complexes to mediate ligand homodimers has not yet been
determined in vivo and it is also not yet completely clear if the antagonism
by Sax can affect heterodimers as well as homodimers. The current data indicate that
the ability of Sax to promote signaling must reside with Tkv-Sax-containing
complexes and the strong contribution of Gbb to the low points of the gradient
with a minimal contribution by Dpp leaves open the possibility that Dpp-Gbb can signal, in addition to Gbb-Gbb, to cells far from the AP boundary (Bangi, 2006b).
Overexpression studies in the follicle cells of the Drosophila
ovary produce the same results as those in the wing, indicating that the
ability of Sax to block Gbb signaling is not limited to the developing wing. However, in contrast to studies in the wing disc, loss of sax from the follicle cells, as well as the embryonic midgut and neuromuscular synapse produces mutant phenotypes indicative of a loss of ligand function. It is
possible that the contribution of Sax to signal promotion in these tissues may
be stronger than its antagonistic function. The phenotypic outcome of sax loss of function in a particular process probably depends on the relative numbers of Sax-Sax and Sax-Tkv complexes on the cell surface and the relative binding affinity of a given Bmp ligand for these two complexes. What regulates the composition of type I receptors in a signaling complex is not yet known (Bangi, 2006b).
The ability of the Sax to block Bmp signaling may reflect its requirement
to have input from another molecule to activate its kinase domain. When
activated by in vitro mutagenesis, Sax and its vertebrate orthologs Alk1/Alk2
(Acvrl1 and Acvr1 - Mouse Genome Informatics) are able to phosphorylate Bmp
specific R-Smads, but ligand-induced activation of Sax or Alk1/2 kinase has
not been reported. Interestingly, a ligand-induced Bmp receptor complex
containing Alk2 and ActRII is unable to phosphorylate Smad1. Furthermore, Alk1 has been shown to require a different type I receptor (Alk5) to activate its kinase domain. Although it has been suggest that the Alk2/ActRII complex might be unstable in vitro, it is also possible that activation of Alk2 (and of its Drosophila ortholog Sax) may depend on its partner type I receptor and/or which ligand is bound, or some other protein. Although Gbb fails to activate Sax-Sax, perhaps another Bmp ligand (i.e. Scw) can. Similarly, endoglin, related to the co-receptor
betaglycan, could be important in modulating Alk1-dependent signaling
given that mutations in either gene give rise to hereditary hemorrhagic
telangiectasia. Sax may require a different type I receptor partner, i.e.
Tkv, to activate its kinase or transduce a signal, and such a requirement may
be a universal feature of the Alk1/Alk2/Sax subgroup of Bmp type I
receptors (Bangi, 2006b).
The robustness of morphogen gradients may depend on negative-feedback
mechanisms to buffer against environmental and genetic fluctuations. Clearly,
Sax plays a crucial role in modulating the range of the Bmp activity gradient
from analysis at both the level of Bmp-dependent target gene expression and
the final pattern of the adult wing. The identification of the antagonistic
nature of a Bmp type I receptor to modulate signaling activity by sequestering
ligand without transducing a signal provides a new mechanism that contributes
to the robustness of the Bmp activity gradient. It is proposed that the dual
function of Sax is crucial for buffering the wing disc Bmp activity gradient
against local fluctuations in ligand levels (environmental, genetic or
experimentally induced). Whether this mechanism of signal modulation is
evolutionarily conserved remains to be determined, but the fact that the
vertebrate Sax orthologs Alk1 and Alk2 have been shown biochemically to
exhibit antagonistic behaviors in vitro is interesting. Detailed analysis of
these orthologs in developmental contexts will be crucial to determine whether
the robustness of vertebrate Bmp activity gradients also depends on the
modulation of ligand availability by specific receptors (Bangi, 2006b).
The BMP pathway is essential for scaling of the presynaptic motoneuron arbor to the postsynaptic muscle cell at the Drosophila neuromuscular junction (NMJ). Genetic analyses indicate that the muscle is the BMP-sending cell and the motoneuron is the BMP-receiving cell. Nevertheless, it is unclear how this directionality is established as Glass bottom boat (Gbb), the known BMP ligand, is active in motoneurons. This study demonstrates that crimpy (cmpy) limits neuronal Gbb activity to permit appropriate regulation of NMJ growth. cmpy was identified in a screen for motoneuron-expressed genes and encodes a single-pass transmembrane protein with sequence homology to vertebrate Cysteine-rich transmembrane BMP regulator 1 (Crim1). Cysteine-rich repeat (CRR)-containing single-pass transmembrane protein are present in a large number of BMP-interacting proteins in vertebrates and invertebrates. This structurally related family includes extracellular antagonists, such as Drosophila Short gastrulation (Sog) and vertebrate Chordin (Chrd), which are believed to interfere with receptor-ligand interactions. It also includes proteins such as gremlin and sclerostin that can interact with BMPs intracellularly and are thought to interfere with BMP activity, at least in part, by altering ligand activation or secretion. A targeted deletion of the cmpy locus was generated; loss-of-function mutants exhibit excessive NMJ growth. In accordance with its expression profile, tissue-specific rescue experiments indicate that cmpy functions neuronally. The overgrowth in cmpy mutants depends on the activity of the BMP type II receptor Wishful thinking, arguing that Cmpy acts in the BMP pathway upstream of receptor activation and raising the possibility that it inhibits Gbb activity in motoneurons. Indeed, the cmpy mutant phenotype is strongly suppressed by RNAi-mediated knockdown of Gbb in motoneurons. Furthermore, Cmpy physically interacts with the Gbb precursor protein, arguing that Cmpy binds Gbb prior to the secretion of mature ligand. These studies demonstrate that Cmpy restrains Gbb activity in motoneurons. A model is presented whereby this inhibition permits the muscle-derived Gbb pool to predominate at the NMJ, thus establishing the retrograde directionality of the pro-growth BMP pathway (James, 2011).
Gbb has been proposed to cue presynaptic motoneurons to the size of their postsynaptic muscle partners. However, muscles have not been established as the primary source of Gbb at the NMJ. In fact, motoneuron-derived Gbb has a crucial retrograde activity at the motoneuron-interneuron synapse, demonstrating that motoneuronal Gbb is active. The present work demonstrates that motoneurons express Cmpy, a Gbb antagonist. It is proposed that Cmpy restrains motoneuronal activity of Gbb at the NMJ, thus establishing the muscle as the predominant source of the pro-growth BMP signal. Potential mechanisms for Cmpy function at the NMJ and the relationship of Cmpy with intracellular and extracellular BMP antagonists are discussed (James, 2011).
Interest in CG13253/Crimpy was sparked by its restricted expression in the VNC and was reinforced by the presence of a predicted transmembrane domain and CRR. The presence of these two sequence elements renders Cmpy similar to vertebrate Crim1. In mice, Crim1 hypomorphs have been described and display pleiotropic defects in multiple organ systems (Pennisi, 2007). Notably, Crim1 is expressed in developing motoneuron and interneuron populations in the developing mouse and chick spinal cord, although LOF studies have not addressed a neuronal function. A Crim1 homolog has also been described in zebrafish, where it is linked to vascular and somitic development, and in C. elegans, where RNAi-mediated knockdown of crm-1 (cysteine-rich motor neuron protein 1) suggests a pro-BMP function in the control of body size (Fung, 2007). Cell culture studies provide evidence that Crim1 binds Bmp4/7 and antagonizes the production and processing of the preprotein in the Golgi (Wilkinson, 2003). Interestingly, Crim1 interacts with Bmp4/7 at the cell surface and inhibits BMP secretion into the medium (Wilkinson, 2003), raising the possibility that Crim1 antagonizes BMP signaling by multiple cellular mechanisms (James, 2011).
CRR-containing proteins are established modulators of BMP signaling in vertebrates and invertebrates. In Drosophila, posterior wing crossvein specification requires local activation of the BMP pathway, and loss of BMP signaling yields a crossveinless phenotype. BMP ligands are produced in neighboring longitudinal wing veins and are transported to the posterior crossvein. Ligand activity is differentially regulated by the secreted CRR-containing proteins Sog and Crossveinless 2 (Cv-2). Sog and Cv-2 both have pro- and anti-BMP activity, although their mode and range of action differ. Sog is proposed to act at long range, and its anti-BMP activity is thought to derive from sequestering BMPs from their receptors, whereas its pro-BMP activity is likely to arise from transporting BMP ligands through tissues. By contrast, Cv-2 is proposed to act at short range and binds heparan sulfate proteoglycans and the type I receptor Tkv (James, 2011).
The biphasic activities of Sog and Cv-2 serve to emphasize the complex modes of extracellular regulation of BMPs by CRR-containing proteins, as well as to draw attention to possible differences between BMP regulation in the wing and Cmpy-dependent BMP regulation at the NMJ. Although overexpression of Cmpy suppresses Gbb overexpression phenotypes in the wing, cmpy LOF mutants do not display wing vein phenotypes. Cmpy does not function during early embryogenesis, when the BMP homolog Decapentaplegic acts as a classical morphogen in dorsoventral patterning. In both the early embryo and the wing, BMP activity is shaped over many cell diameters by extracellular CRR-containing proteins. Sog and Cv-2 play essential extracellular roles in establishing the magnitude and directionality of BMP signaling. By contrast, Gbb is proposed to act locally at the NMJ to couple pre- and postsynaptic growth (James, 2011).
The close apposition of the cells that send and receive BMP at the NMJ might relieve a requirement for long-range extracellular regulation of the ligand. Instead, it is proposed that a primary challenge at the NMJ is to establish the cellular source of the BMP signal, as Gbb is present both in motoneurons and muscle. In this case, cell-autonomous regulation of the ligand could provide a mechanism for the motoneuron to discriminate between motoneuron- and muscle-derived pools. Consistent with this model, evidence is presented that Cmpy binds Gbb prior to processing and inhibits its growth-promoting activity in motoneurons. In this manner, the Cmpy-Gbb interaction might provide motoneurons with an effective mechanism for distinguishing autocrine and paracrine Gbb signals within the NMJ microenvironment (James, 2011).
CRR-containing BMP antagonists were initially identified from their extracellular roles in the establishment of BMP morphogenetic gradients. It will be interesting to determine whether additional CRR-containing proteins function intracellularly as more short-range BMP-dependent signaling interactions are thoroughly described. Consistent with this idea, several mammalian CRR-containing proteins bind precursor forms of BMP and inhibit BMP activity or secretion in a cell-autonomous manner. Gremlin is a BMP antagonist that is expressed in differentiated cells, including neurons. When co-expressed with Bmp4, gremlin binds to the precursor form of Bmp4 and inhibits secretion. sclerostin, another BMP antagonist, inhibits Bmp7 secretion when the proteins are co-expressed in osteocytes. These studies argue that intracellular modulation of ligand production contributes to BMP signaling directionality in vertebrates (James, 2011).
The work presented in this study suggests that Cmpy antagonizes Gbb activity in motoneurons prior to ligand secretion. To further delineate the Cmpy-Gbb relationship, it will be important to map their localization patterns in motoneurons using compartment-specific markers. Although attempts to generate anti-Cmpy antibodies have been unsuccessful, generation of transgenic flies carrying epitope-tagged Cmpy might enable an analysis of Cmpy subcellular localization. Cmpy-mediated inhibition of Gbb at the NMJ might rely upon restricted localization of Cmpy to this subcellular locale; however, the possibility that Cmpy regulates Gbb activity at the central synapse remains open. Investigation of the localization pattern of Cmpy in motoneurons will begin to address the issue of Cmpy function at these distinct synapses (James, 2011).
An analysis of Gbb distribution, trafficking and secretion in motoneurons in cmpy mutants will indicate the stage of Gbb processing at which Cmpy is likely to act. Studies on mammalian sclerostin provide precedent for an intracellular mechanism for BMP inhibition, as sclerostin sequesters Bmp7 preprotein, leading to its intracellular retention and proteasomal degradation. Interestingly, Cmpy contains only a single, low-threshold CRR. These motifs modulate interactions with mature secreted ligand, suggesting that sequences outside of the CRR mediate interactions with the precursor form of Gbb. Indeed, interaction of Cmpy with Gbb is dependent on C-terminal sequences, including an arginine/lysine-rich domain at the extreme C-terminus. Likewise, the intracellular interaction of gremlin with the precursor form of Bmp4 is not modulated by its cysteine-rich region, but rather by an arginine/lysine-rich domain. The sequence similarities between the BMP interaction domains in gremlin and Crimpy raise the possibility that these proteins antagonize BMP activity by a conserved mechanism (James, 2011).
This study has focused on Cmpy regulation of Gbb in the anatomical development of the NMJ. In addition, Gbb regulates baseline neurotransmission and synaptic homeostasis at the NMJ. Motoneurons precisely compensate for impaired postsynaptic neurotransmitter receptor sensitivity by increasing presynaptic neurotransmitter release. This homeostatic response requires Gbb, which is not itself the acute retrograde homeostatic signal but rather establishes the competence of motoneurons to receive the homeostatic signal. A number of genetic manipulations indicate that the roles of Gbb in regulating synaptic homeostasis, basal neurotransmission and NMJ morphology are separable. Perhaps surprisingly, neuron-specific Gbb rescues both synaptic homeostasis and baseline neurotransmitter release in gbb null animals. By contrast, whereas muscle-derived Gbb rescues synaptic homeostasis in gbb null animals, it does not significantly rescue baseline synaptic function, arguing that neuronal- and muscle-derived pools of Gbb serve distinct functions. Although the data indicate that Cmpy antagonizes autocrine Gbb signaling in motoneurons to restrain morphological expansion at the NMJ, it is likely that motoneuronal Gbb has an independent role in regulating functional development of the NMJ. If so, the Cmpy-Gbb complex might be active and could elicit a signaling outcome distinct from that of the muscle-derived pool of Gbb. Physiological analyses of cmpy mutants, as well as an investigation of Gbb trafficking and secretion at the NMJ in cmpy mutants, should provide crucial insight into this important question (James, 2011).
More broadly, this study is of relevance to the regulation of signal release in neurons. By definition, neurotransmitter is released from the presynaptic compartment and received by neurotransmitter receptors on the postsynaptic side. However, signaling pathway activity is not circumscribed in this way and may occur at short or long range at multiple subcellular positions. Hence, neurons are likely to possess fine-regulatory mechanisms controlling the release of, and response to, extracellular cues. The present work provides insight into the regulation of signaling molecules in neurons and suggests that the mechanisms that control signaling specificity in the developing nervous system are only beginning to be uncovered (James, 2011).
The sensitivity of the posterior crossvein in the pupal wing of Drosophila to reductions in the levels and range of BMP signaling has been used to isolate and characterize novel regulators of this pathway. This study shows that crossveinless d (cv-d) mutations, which disrupt BMP signaling during the development of the posterior crossvein, mutate a lipoprotein that is similar to the vitellogenins that comprise the major constituents of yolk in animal embryos. Cv-d is made in the liver-like fat body and other tissues, and can diffuse into the pupal wing via the hemolymph. Cv-d binds to the BMPs Dpp and Gbb through its Vg domain, and to heparan sulfate proteoglycans, which are well-known for their role in BMP movement and accumulation in the wing. Cv-d acts over a long range in vivo, and does not have BMP co-receptor-like activity in vitro. It is suggested that, instead, it affects the range of BMP movement in the pupal wing, probably as part of a lipid-BMP-lipoprotein complex, similar to the role proposed for the apolipophorin lipid transport proteins in Hedgehog and Wnt movement (Chen, 2012).
The evidence indicates that Cv-d, a member of the Cvd/160MEP family of Vtg-like lipoproteins, acts over a long range to promote BMP signaling in the developing PCV of the
Drosophila wing, probably after having been delivered to the
wing via the hemolymph. Cv-d binds both BMPs and HSPGs,
and Cv-d activity in vivo requires the presence of its BMP-binding
Vg domain. As Cv-d does not promote signaling in
vitro, in vivo it more likely acts by increasing the movement of
Dpp and Gbb from the LVs or their accumulation in the PCV
region. This is consistent with the initial BMP signaling defects
found near the center of cv-d mutant posterior cross veins (PCVs). The later
appearance of defects near the LVs may be caused by the LV-specific
expression of vein-inhibiting signals such as Delta and
Argos. cv-d1 and cv-d13 also reduce the number of adult jump muscle fibers, the development of which
is sensitive to changes in BMP signaling and loss of Crossveinless-Twisted gastrulation 2 (Cv-Tsg2). Thus, Cv-d probably regulates BMP signaling in at least two different contexts (Chen, 2012).
The activity of Cv-d in BMP signaling has interesting parallels
to the signaling activities of the Drosophila Apolipophorins,
which have a similar domain structure to Cv-d/160MEP proteins.
Apolipophorins shuttle lipids from the fat body and digestive tract to other tissues via the hemolymph, but their role is not limited to lipid delivery (Chen, 2012).
Apolipophorins can increase the range over which signaling
proteins move in the wing disc, an effect thought to be mediated
by diffusion of an extracellular complex that contains lipids,
Apolipophorins and lipid-linked signaling proteins such as
Hedgehog, Wnts and HSPGs. Although BMPs are not lipid-linked proteins, Cv-d
activity also requires both BMP and lipid binding motifs,
consistent with BMP movement via a lipid-lipoprotein complex.
The loss of Apolipophorins can also affect signaling by loss of
lipid delivery, and thus lipid-dependent intracellular signaling, such
as the lipid-mediated signal transduction triggered when Hedgehog
binds to its receptor Patched. However, the evidence does not support a similar role for Cv-d-mediated lipid delivery in BMP signaling. Lipids have not been linked to the
transduction of canonical BMP signaling, and reducing lipid
delivery to wings through lipid starvation or reduction in
Drosophila Apolipophorin expression greatly shrinks the size of
the wing but does not alter venation or BMP signaling. Cv-d complexes also carry less lipid than
apolipophorins. Lipid content in apolipophorin complexes is 30-
60%, but in complexes containing the Apis Cv-d homolog VHDL, it is only 10%. Like VHDL complexes, Cv-d complexes are higher density (lower lipid content) than Apolipophorin complexes (Chen, 2012).
The LDL-like receptors that mediate lipoprotein uptake do not
appear to play a role in PCV development. Loss of the LRP1,
LPR1&2, Megalin or the Vtg receptor Yolkless produces viable
adults with normal crossveins. The only remaining LDL receptors in Drosophila are CG8909/MEGF7,
which has been detected in neuronal tissue but not in
wing imaginal discs, and the LRP5/6 homolog Arrow, which is required for Wingless/Wnt signaling
during wing disc patterning but has no known role in BMP
signaling. Thus, it is likely that the effect of Cv-d
on BMP signaling is mediated by BMP binding, rather than via lipid delivery alone (Chen, 2012).
Although Vtgs are best known as the major components of yolk,
there is a growing awareness that Vtg-like lipoproteins can have
functions outside the yolk, such as immune protection and spermegg
recognition in vertebrates, and clotting and melanization in arthropod hemolymph. Cv-d demonstrates a new and important function in BMP signaling. Is this function shared by
other Vtg family proteins? Intriguingly, Xenopus Lipovitellin 1, a
Vg domain-containing fragment of VtgA2, was isolated as a
BMP4-binding protein, and purified VtgA2 bound to purified
BMP4 and ActivinA (but not to TGF-β1) in surface plasmon
resonance assays. Although the requirement for Vtg in the nutrition of early vertebrate embryos makes it difficult to interpret tests of Vtg function, the evolution of two
different Vtg-family proteins in insects, the yolk Vtg and Cvd/
160MEP families, may provide a 'natural experiment' that has
allowed separation of the yolk and non-yolk roles of this protein
family, demonstrating for the first time the importance of Vtg-BMP interaction (Chen, 2012).
Neuronal function depends on the retrograde relay of growth and survival signals from the synaptic terminal, where the neuron interacts with its targets, to the nucleus, where gene transcription is regulated. Activation of the Bone Morphogenetic Protein (BMP) pathway at the Drosophila larval neuromuscular junction results in nuclear accumulation of the phosphorylated form of the transcription factor Mad in the motoneuron nucleus. This in turn regulates transcription of genes that control synaptic growth. How BMP signaling at the synaptic terminal is relayed to the cell body and nucleus of the motoneuron to regulate transcription is unknown. This study shows that the BMP receptors are endocytosed at the synaptic terminal and transported retrogradely along the axon. Furthermore, this transport is dependent on BMP pathway activity, as it decreases in the absence of ligand or receptors. It was further demonstrated that receptor traffic is severely impaired when Dynein motors are inhibited, a condition that has previously been shown to block BMP pathway activation. In contrast with these results, no evidence was found for transport of phosphorylated Mad along the axons, and axonal traffic of Mad is not affected in mutants defective in BMP signaling or retrograde transport. These data support a model in which complexes of activated BMP receptors are actively transported along the axon towards the cell body to relay the synaptogenic signal, and that phosphorylated Mad at the synaptic terminal and cell body represent two distinct molecular populations (Smith, 2012).
Axonal transport is essential for neuronal function and survival. In Drosophila motoneurons the BMP pathway is activated at the synaptic terminal but ultimately results in regulation of transcription in the nucleus, thus this signaling pathway is dependent on
long-range signal propagation. The current results indicate that signal relay is mediated by a signaling endosome containing an activated receptor complex formed by Wit and Tkv (Smith, 2012).
A target-derived factor that is critical to ensure the survival and growth of selected
neurons, NGF, utilizes a receptor signaling endosome to propagate pathway activity. NGF binds its receptors at the synaptic terminal and the complex is
endocytosed and retrogradely transported along the axon in a Dynein dependent manner to
activate downstream effector molecules. This study has found evidence that the BMP
receptors colocalize with endosomal markers and are likely endocytosed at the synaptic terminal.
This is supported by the exclusive colocalization of the receptors with Rab4 at the synaptic
terminal, indicating that the receptors are subject to rapid membrane recycling in this subcellular
compartment. This result agrees with the source of the BMP ligand Gbb being the muscle and
signaling locally to the synaptic terminal. The BMP receptors colocalize
with each other and are actively transported along the axon. In addition, this study found that both
motoneuron BMP signaling and BMP receptor traffic are dependent on retrograde motor activity, similar to NGF signaling. Several published reports support these findings. First, TGF-β was found to be
transported along mammalian motoneuron axons. The dependence on Gbb for
endosome motility strongly suggests that the ligand is part of the signaling endosome complex.
Second, several studies have shown that the endocytic pathway regulates BMP signaling in
Drosophila motoneurons. Spichthyin (Spict) and Nervous wreck (Nwk) down-regulate the BMP
signal at the synaptic terminal and, when mutated, cause BMP dependent synaptic terminal
overgrowth. The late endosomal/lysosomal protein Spinster, when mutated, causes enhanced/ misregulated BMP pathway signaling resulting in synaptic terminal expansion. Loss of Vps35, an endocytic sorting
protein, leads to BMP dependent upregulation of synaptic size, and a
similar phenotype is observed in mutants of the novel endosomal protein Ema, with increased
levels of Tkv and pMad at the NMJ (Kim, 2010). Finally, a recent report has proposed that
sorting nexin SNX16 interacts with Nwk to regulate BMP signaling-dependent synaptic growth
through endocytic routing of activated Tkv (Rodal, 2011). Taken together, these reports
show that endocytic proteins regulate BMP signaling and that a signaling endosome is a
plausible mechanism for signal sorting and attenuation in this pathway. This again parallels the
situation of neurotrophin receptors and the endocytic pathway they share with neurotoxins (Smith, 2012).
An important question is the mechanism to preferentially select and transport active
signaling endosomes as opposed to other vesicles that contain BMP receptors. The receptors, Wit
and Tkv, could be transported individually, they could be in the same endosome without being in
a complex, or the receptors could be in an active complex. All of these endosomes can either be
degraded or destined for long-range trafficking, and in the case of those containing active
receptor complexes ultimately lead to the phosphorylation of Mad in the soma. The skewed
directionality of receptor traffic (2:1 ratio for retrograde to anterograde) is difficult to interpret
with the current knowledge, and a mechanism by which the transport machinery selects the
endosome that is positive for an active receptor complex and carries it to its final destination in
the cell body has yet to be determined. Somehow this mechanism must be linked to BMP
signaling itself, considering the diminished receptor traffic in the absence of either Wit or Gbb.
Adaptor proteins that function to attach cargo to motor proteins may provide a specialized
mechanism to preferentially select and transport active signaling endosomes, as has been shown
in other cases of axonal transport. In this regard it is worth noting that the
regulatory light chain of the Dynein complex Tctex interacts physically with the mammalian
orthologue of Wit, BMPR-II). Dynein light and intermediate chains also
interact with the NGF receptors TrkA and TrkB, further supporting the
parallelism between NGF and BMP signaling endosomes (Smith, 2012).
The existence of a BMP signaling endosome in Drosophila larval motoneurons also
raises questions as to how general this mechanism is for sorting and regulating the TGF-β signal.
Smad Anchor for Receptor Activation (SARA) is an endocytic protein that regulates the
subcellular distribution of Smad proteins and presents these R-Smads for phosphorylation to the
activated TGF-β receptor complex. In mammalian cells SARA regulates
TGF-β signaling by sorting the receptor complex to degradation or signaling pathways. In Drosophila wing imaginal discs, BMP signaling depends on SARA to
properly distribute a gradient of the morphogen Decapentaplegic (Dpp). SARA, the ligand Dpp,
and the type I receptor Tkv were found in a population of endosomes that associated with the
spindle machinery. This association allows equal distribution of the Dpp morphogen into the two
daughter cells during mitosis and proper activation of Mad. It seems then
that BMP signaling spatial regulation through endocytic traffic is a general phenomenon, and not
a specialization of extremely long cells such as motoneurons (Smith, 2012).
The dual localization of pMad at the synaptic terminal and nucleus has been well
characterized. This suggests that pMad is the molecular carrier of the signaling event,
purportedly transported from synaptic terminal to cell nucleus. While this model has been
proposed, no experimental evidence
supports it, and the current results show that axonal transport of pMad is an unlikely mechanism for
pathway relay. Similar to the situation with the BMP receptors, Mad was found in the cell body,
nucleus, axon and synaptic terminal. However, no evidence was found of the active form pMad
along the axon when ample signal is observed at the synaptic terminal and nucleus. Furthermore,
while disrupting Dynein retrograde motors abrogates BMP signaling and substantially interrupts
the axonal traffic of BMP receptors, axonal movement of Mad is not affected. It is possible that a
small amount - undetectable by standard imaging techniques - of pMad is present along the axon,
and it is also possible that a small fraction of the total YFP-Mad in the FRAP experiments is
subject to active retrograde traffic towards the nucleus. In neurotrophin signaling the
transcription factor CREB is transported along the axon with the receptor complex to act as a
second messenger. However, efforts to detect axonal colocalization of YFPMad
and Tkv-CFP containing endosomes have been unsuccessful (Smith, 2012).
The presence of Mad along the axons without detectable phosphorylation by the activated
receptor complex brings up the issue of substrate accessibility. It is possible that factors that help Mad phosphorylation, such as SARA are not present
or active in the axons. It is also possible that Mad cannot access the active receptor complex due to hindrance by the linkers between receptor and molecular motors.
It is worth noting β the two pMad populations show different immunofluorescence
patterns, punctate at the NMJ and diffuse in the nucleus. The molecular nature of these different pMad isoforms is unclear, but at least part of the difference may stem from single versus double phosphorylation of the SVS Mad sequence. This is conceptually similar to ERK
isoforms that are differentially phosphorylated by neurotrophin receptors at the synaptic terminal and the cell soma. An alternative explanation is that
identically phosphorylated forms of Mad bind different partners at NMJ and nucleus, and that the complex formed at the NMJ cannot be recognized by the monoclonal antibodies due to steric hindrance. It is proposed that synaptic pMad is a different population with a distinct local role, perhaps signaling through cross talk with other pathways, while nuclear pMad is the result of phosphorylation of Mad in the soma by activated receptors retrogradely transported from the synaptic terminal. Consistent with this
model of different pMad isoforms with different roles in larval motoneurons, a recent study
found that synaptic pMad is regulated differently than nuclear pMad. Synaptic pMad was found
to be absent in importin-beta11 mutants, but nuclear pMad was unaffected (Smith, 2012).
Identifying the mechanism by which the BMP signal is relayed along the axon is a first
step towards understanding the regulation of synaptic plasticity by this critical pathway.
Intriguingly, a recent study has linked Spinal Muscular Atrophy (SMA) and the BMP pathway.
Spinal Muscle Atrophy is a recessive hereditary neurodegenerative disease in humans that results
in early onset lethality, motor neuron loss, and skeletal muscle atrophy. Using a Drosophila
ortholog to model this disease, the Wit receptor and Mad transcription factor were identified to
modify the disease phenotype. It was proposed that increasing BMP
signaling could be a possible therapeutic approach for SMA patients. The current results describing the mechanism of BMP signaling in Drosophila motoneurons helps understand the pathological
consequences of pathway disruption and will open new avenues to understand human
neurodegenerative disorders that involve TGF-β signaling. Additionally, the current results suggest that signaling endosome traffic is a general mechanism in TGF-β signaling (Smith, 2012).
A Drosophila transgenic RNAi screen targeting the glycan genome, including all N/O/GAG-glycan biosynthesis/modification enzymes and glycan-binding lectins, was conducted to discover novel glycan functions in synaptogenesis. As proof-of-product,functionally paired heparan sulfate (HS) 6-O-sulfotransferase (hs6st) and sulfatase (sulf1), which bidirectionally control HS proteoglycan (HSPG) sulfation, were characterized. RNAi knockdown of hs6st
and sulf1 causes opposite effects on functional synapse development, with decreased (hs6st) and increased (sulf1) neurotransmission strength confirmed in null mutants. HSPG co-receptors for WNT and BMP intercellular signaling, Dally-like Protein and Syndecan, are differentially misregulated in the synaptomatrix of these mutants. Consistently, hs6st and sulf1 nulls differentially elevate both WNT (Wingless; Wg) and BMP (Glass Bottom Boat; Gbb) ligand abundance in the synaptomatrix. Anterograde Wg signaling via Wg receptor dFrizzled2 C-terminus nuclear import and retrograde Gbb signaling via synaptic MAD phosphorylation and nuclear import are differentially activated in hs6st and sulf1 mutants. Consequently, transcriptional control of presynaptic glutamate release machinery and postsynaptic glutamate receptors is bidirectionally altered in hs6st and sulf1 mutants, explaining the bidirectional change in synaptic functional strength. Genetic correction of the altered WNT/BMP signaling restores normal synaptic development in both mutant conditions, proving that altered trans-synaptic signaling causes functional differentiation defects (Dani, 2012).
It is well known that synaptic interfaces harbor heavily-glycosylated membrane proteins, glycolipids and ECM molecules, but understanding of glycan-mediated mechanisms within this synaptomatrix is limited. A genomic screen aimed to systematically interrogate glycan roles in both structural and functional development in the genetically-tractable Drosophila NMJ synapse. 130 candidate genes were screened, classified into 8 functional families: N-glycan biosynthesis, O-glycan biosynthesis, GAG biosynthesis, glycoprotein/proteoglycan core proteins, glycan modifying/degrading enzymes, glycosyltransferases, sugar transporters and glycan-binding lectins. From this screen, 103 RNAi knockdown conditions were larval viable, whereas 27 others produced early developmental lethality. 35 genes had statistically significant effects on different measures of morphological development: 27 RNAi-mediated knockdowns increased synaptic bouton number, 9 affected synapse area (2 increased, 7 decreased) and 2 genes increased synaptic branch number. These data suggest that overall glycan mechanisms predominantly serve to limit synaptic morphogenesis. 13 genes had significant effects on the functional differentiation of the synapse, with 12 increasing transmission strength and only 1 decreasing function upon RNAi knockdown. Thus, glycan-mediated mechanisms also predominantly limit synaptic functional development. A very small fraction of tested genes (CG1597; pgant35A, CG7480; veg, CG6657; hs6st, CG4451; sulf1, CG6725 and CG11874) had effects on both morphology and function. A large percentage of genes (~30%) showed morphological defects with no corresponding effect on function, while only 7% of genes showed functional alterations without morphological defects, and <5% of all genes affect both. These results suggest that glycans have clearly separable roles in modulating morphological and functional development of the NMJ synapse (Dani, 2012).
A growing list of neurological disorders linked to the synapse are attributed to dysfunctional glycan mechanisms, including muscular dystrophies, cognitive impairment and autism spectrum disorders. Drosophila homologs of glycosylation genes implicated in neural disease states include ALG3 (CG4084), ALG6 (CG5091), DPM1 (CG10166), FUCT1 (CG9620), GCS1 (CG1597), MGAT2 (CG7921), MPDU1 (CG3792), PMI (CG33718) and PPM2 (CG12151). Two of these genes, Gfr (CG9620) and CG1597, showed synaptic morphology phenotypes in the RNAi screen. Given that connectivity defects are clearly implicated in cognitive impairment and autism spectrum disorders, it would be of interest to explore the glycan mechanism affecting synapse morphology in Drosophila models of these disease states. Glycans are well known to modulate extracellular signaling, including ligands of integrin receptors, to regulate intercellular communication. In the genetic screen, several O-glycosyltransferases mediating this mechanism were identified to show morphological (GalNAc-T2, CG6394; pgant35A, CG7480, O-fut2, CG14789; rumi, CG31152) and functional (pgant5, CG31651; pgant35A, CG7480) synaptic defects upon RNAi knockdown. These findings suggest that known integrin-mediated signaling pathways controlling NMJ synaptic structural and functional development are modulated by glycan mechanisms. The screen showed CG6657 RNAi knockdown affects functional differentiation, consistent with reports that this gene regulates peripheral nervous system development. The corroboration of the screen results with published reports underscores the utility of RNAi-mediated screening to identify glycan mechanisms, and supports use of the screen results for bioinformatic/meta-analysis to link observed phenotypes to neurophysiological/pathological disease states and to direct future glycan mechanism studies at the synapse (Dani, 2012).
From this screen, the two functionally-paired genes sulf1 and hs6st were selected for further characterization. As in the RNAi screen, null alleles of these two genes had opposite effects on synaptic functional differentiation but similar effects on synapse morphogenesis, validating the corresponding screen results. The two gene products have functionally-paired roles; Hs6st is a heparan sulfate (HS) 6-O-sulfotransferase, and Sulf1 is a HS 6-O-endosulfatase. These activities control sulfation of the same C6 on the repeated glucosamine moiety in HS GAG chains found on heparan sulfate proteoglycans (HSPGs). At the Drosophila NMJ, two HSPGs are known to regulate synapse assembly; the GPI-anchored glypican Dally-like protein (Dlp), and the transmembrane Syndecan (Sdc). In contrast, the secreted HSPG Perlecan (Trol) is not detectably enriched at the NMJ, and indeed appears to be selectively excluded from the perisynaptic domain. In other developmental contexts, the membrane HSPGs Dlp and Sdc are known to act as co-receptors for WNT and BMP ligands, regulating ligand abundance, presentation to cognate receptors and therefore signaling. Importantly, the regulation of HSPG co-receptor abundance has been shown to be dependent on sulfation state mediated by extracellular sulfatases. Consistently, upregulation of Dlp and Sdc was observed in sulf1 null synapses, whereas Dlp was reduced in hs6st null synapses. In the developing Drosophila wing disc, HSPG co-receptors increase levels of the Wg ligand due to extracellular stabilization, and the primary function of Dlp in this developmental context is to retain Wg at the cell surface. Likewise, in developing Drosophila embryos, a significant fraction of Wg ligand is retained on the cell surfaces in a HSPG-dependent manner, with the HSPG acting as an extracellular co-receptor. Syndecan also modulates ligand-dependent activation of cell-surface receptors by acting as a co-receptor. At the NMJ, regulation of both these HSPG co-receptors occurs in the closely juxtaposed region between presynaptic bouton and muscle subsynaptic reticulum, in the exact same extracellular space traversed by the secreted trans-synaptic Wg and Gbb signals. It is therefore proposed that altered Dlp and Sdc HSPG co-receptors in sulf1 and hs6st mutants differentially trap/stabilize Wg and Gbb trans-synaptic signals at the interface between motor neuron and muscle, to modulate the extent and efficacy of intercellular signaling driving synaptic development (Dani, 2012).
HS sulfation modification is linked to modulating the intercellular signaling driving neuronal differentiation . In particular, WNT and BMP ligands are both regulated via HS sulfation of their extracellular co-receptors, and both signals have multiple functions directing neuronal differentiation, including synaptogenesis. In the Drosophila wing disc, extracellular WNT (Wg) ligand abundance and distribution was recently shown to be strongly elevated in sulf1 null mutants. Moreover, sulf1 has also recently been shown to modulate BMP signaling in other cellular contexts. Consistently, this study has shown increased WNT Wg and the BMP Gbb abundance and distribution in sulf1 null NMJ synapses. The hs6st null also exhibits elevated Wg and Gbb at the synaptic interface, albeit the increase is lower and results in differential signaling consequences. In support of this contrasting effect, extracellular signaling ligands are known to bind HSPG HS chains differentially dependent on specific sulfation patterns. It is important to note that the sulf1 and hs6st modulation of trans-synaptic signals is not universal, as Jelly Belly (Jeb) ligand abundance and distribution was not altered in the sulf1 and hs6st null conditions. This indicates that discrete classes of secreted trans-synaptic molecules are modulated by distinct glycan mechanisms to control NMJ structure and function (Dani, 2012).
At the Drosophila NMJ, Wg is very well characterized as an anterograde trans-synaptic signal and Gbb is very well characterized as a retrograde trans-synaptic signal. In Wg signaling, the dFz2 receptor is internalized upon Wg binding and then cleaved so that the dFz2-C fragment is imported into muscle nuclei. In hs6st nulls, increased Wg ligand abundance at the synaptic terminal corresponds to an increase in dFz2C punctae in muscle nuclei as expected. In contrast, the increase in Wg at the sulf1 null synapse did not correspond to an increase in the dFz2C-terminus nuclear internalization, but rather a significant decrease. One explanation for this apparent discrepancy is the 'exchange factor' model based on the biphasic ability of the HSPG co-receptor Dlp to modulate Wg signaling. In the Drosophila wing disc, this model suggests that the transition of Dlp co-receptor from an activator to repressor of signaling depends on Wg cognate receptor dFz2 levels, such that a low ratio of Dlp:dFz2 potentiates Wg-dFz2 interaction, whereas a high ratio of Dlp:dFz2 prevents dFz2 from capturing Wg. In sulf1 null synapses, a very great increase was observed in Dlp abundance (~40% elevated) with no significant change in the dFz2 receptor. In contrast, at hs6st null synapses there is a decrease in Dlp abundance (15% decreased) together with a significant increase in dFz2 receptor abundance (~25% elevated). Thus, the higher Dlp:dFz2 ratio in sulf1 nulls could explain the decrease in Wg signal activation, evidenced by decreased dFz2-C terminus import into the muscle nucleus. In contrast, the Dlp:Fz2 ratio in hs6st is much lower, supporting activation of the dFz2-C terminus nuclear internalization pathway. This previously proposed competitive binding mechanism dependent on Dlp co-receptor and dFz2 receptor ratios predicts the observed synaptic Wg signaling pathway modulation in sulf1 and hs6st dependent manner (Dani, 2012).
At the Drosophila NMJ, Gbb is very well characterized as a retrograde trans-synaptic signal, with muscle-derived Gbb causing the receptor complex Wishful thinking (Wit), Thickveins (Tkv) and Saxaphone (Sax) to induce phosphorylation of the transcription factor mothers against Mothers against decapentaplegic (P-Mad). Mutation of Gbb ligand, receptors or regulators of this pathway have shown that Gbb-mediated retrograde signaling is required for proper synaptic differentiation and functional development. Further, loss of Gbb signaling results in significantly decreased levels of P-Mad in the motor neurons. This study shows that accumulation of Gbb in sulf1 and hs6st null synapses causes elevated P-Mad signaling at the synapse and P-Mad accumulation in motor neuron nuclei. Importantly, sulf1 null synapses show a significantly higher level of P-Mad signaling compared to hs6st null synapses, and this same change is proportionally found in P-Mad accumulation within the motor neuron nuclei. These findings indicate differential activation of Gbb trans-synaptic signaling dependent on the HS sulfation state is controlled by the sulf1 and hs6st mechanism, similar to the differential effect observed on Wg trans-synaptic signaling. Genetic interaction studies show that these differential effects on trans-synaptic signaling have functional consequences, and exert a causative action on the observed bi-directional functional differentiation phenotypes in sulf1 and hs6st nulls. Genetic correction of Wg and Gbb defects in the sulf1 null background restores elevated transmission back to control levels. Similarly, genetic correction of Wg and Gbb in hs6st nulls restores the decreased transmission strength back to control levels. These results demonstrate that the Wg and Gbb trans-synaptic signaling pathways are differentially regulated and, in combination, induce opposite effects on synaptic differentiation (Dani, 2012).
Both wg and gbb pathway mutants display disorganized and mislocalized presynaptic components at the active zone (e.g. Bruchpilot; Brp) and postsynaptic components including glutamate receptors (e.g. Bad reception; Brec/GluRIID). Consistently, the bi-directional effects on neurotransmission strength in sulf1 and hs6st mutants are paralleled by dysregulation of these same synaptic components. Changes in presynaptic Brp and postsynaptic GluR abundance/distribution causally explain the bi-directional effects on synaptic functional strength between sulf1 and hs6st null mutant states. Alterations in active zone Brp and postsynaptic GluRs also agree with assessment of spontaneous synaptic activity. Null sulf1 and hs6st synapses showed opposite effects on miniature evoked junctional current (mEJC) frequency (presynaptic component) and amplitude (postsynaptic component). Further, quantal content measurements also support the observation of bidirectional synaptic function in the two functionally paired nulls. Genetic correction of Wg and Gbb defects in both sulf1 and hs6st nulls restores the molecular composition of the pre- and postsynaptic compartments back to wildtype levels. When both trans-synaptic signaling pathways are considered together, these data suggest that HSPG sulfate modification under the control of functionally-paired sulf1 and hs6st jointly regulates both WNT and BMP trans-synaptic signaling pathways in a differential manner to modulate synaptic functional development on both sides of the cleft (Dani, 2012).
This paper has presented the first systematic investigation of glycan roles in the modulation of synaptic structural and functional development. A host of glycan-related genes were identified that are important for modulating neuromuscular synaptogenesis, and these genes are now available for future investigations, to determine mechanistic requirements at the synapse, and to explore links to neurological disorders. As proof for the utilization of these screen results, this study has identified extracellular heparan sulfate modification as a critical platform of the intersection for two secreted trans-synaptic signals, and differential control of their downstream signaling pathways that drive synaptic development. Other trans-synaptic signaling pathways are independent and unaffected by this mechanism, although it is of course possible that a larger assortment of signals could be modulated by this or similar mechanisms. This study supports the core hypothesis that the extracellular space of the synaptic interface, the heavily-glycosylated synaptomatrix, forms a domain where glycans coordinately mediate regulation of trans-synaptic pathways to modulate synaptogenesis and subsequent functional maturation (Dani, 2012).
Distinct pools of the bone morphogenetic protein (BMP) Glass bottom boat (Gbb) control structure and function of the Drosophila neuromuscular junction. Specifically, motoneuron-derived Gbb regulates baseline neurotransmitter release, whereas muscle-derived Gbb regulates neuromuscular junction growth. Yet how cells differentiate between these ligand pools is not known. This study presents evidence that the neuronal Gbb-binding protein Crimpy (Cmpy) permits discrimination of pre- and postsynaptic ligand by serving sequential functions in Gbb signaling. Cmpy first delivers Gbb to dense core vesicles (DCVs) for activity-dependent release from presynaptic terminals. In the absence of Cmpy, Gbb is no longer associated with DCVs and is not released by activity. Electrophysiological analyses demonstrate that Cmpy promotes Gbb's proneurotransmission function. Surprisingly, the Cmpy ectodomain is itself released upon DCV exocytosis, arguing that Cmpy serves a second function in BMP signaling. In addition to trafficking Gbb to DCVs, it is proposed that Gbb/Cmpy corelease from presynaptic terminals defines a neuronal protransmission signal (James, 2014).
Growth factors regulate morphological and electrophysiological attributes of synapses. In Drosophila, the bone morphogenetic protein (BMP) pathway regulates neuromuscular junction (NMJ) development and function. In the traditional view, the pathway acts in a retrograde direction to coordinate pre- and postsynaptic growth. However, the pathway regulates more than morphological expansion: BMP pathway mutants also exhibit profound deficits in active zone organization, baseline neurotransmitter release, and synaptic homeostasis. These phenotypes suggest distinct functions for BMP signaling at the NMJ. Indeed, tissue-specific rescue experiments demonstrate that progrowth and protransmission functions are at least partially separable. Although muscle-specific expression of the BMP ligand Glass bottom boat (Gbb) rescues NMJ morphology in gbb mutants, it does not rescue baseline neurotransmission. Neuron-specific Gbb expression is required for normal baseline neurotransmitter release (Goold, 2007). These data raise the possibility of distinct ligand pools at the NMJ. How are pre- and postsynaptic pools of Gbb distinguished (James, 2014)? A previous study found that Crimpy (Cmpy) prevents motoneuron-derived Gbb from driving excessive growth at the NMJ (James, 2011).
Cmpy was identified in a screen for motoneuron-expressed genes and codes for a single-pass transmembrane protein that physically interacts with Gbb. It has sequence homology to the vertebrate transmembrane BMP-binding protein Crim1 (Cysteine-rich in motoneurons-1). Loss of Cmpy results in NMJ overgrowth, which is rescued by knockdown of Gbb in motoneurons. Thus, neuronal Gbb drives excessive NMJ growth in cmpy mutants. Because neuronal Gbb normally promotes neurotransmitter release, the finding that it promotes NMJ growth in cmpy mutants suggested a possible transformation of presynaptic Gbb from a proneurotransmission to a progrowth signal (James, 2014).
To shed light on the role of Cmpy in Gbb regulation, this study set out to characterize the presynaptic Gbb pool. In general, proteins are secreted from neurons via one of two major secretory routes: the constitutive secretory pathway (CSP) and the regulated secretory pathway (RSP). Vesicles in the CSP spontaneously fuse with the plasma membrane to release their contents. In contrast, vesicles in the RSP undergo Ca2+-regulated exocytosis in response to neuronal activity. These pathways bifurcate in the trans-Golgi network, where proteins destined for the RSP are packaged into dense core vesicles (DCVs) and trafficked to the synapse for activity-dependent release. In the absence of specialized sorting signals/cofactors delivering proteins to the RSP, they are shunted into the CSP for constitutive release (James, 2014).
This study found that neuronal Gbb is normally trafficked to presynaptic terminals at the NMJ. Levels of presynaptic Gbb are proportional to levels of Cmpy, and Cmpy and Gbb associate with dense core vesicles (DCVs). Arguing that Cmpy delivers neuronal Gbb to DCVs for Ca2+-regulated release, presynaptic Gbb release is absolutely dependent on both synaptic activity and Cmpy. These data provide evidence that Cmpy is a DCV sorting receptor for Gbb. The proposed transformation of presynaptic Gbb from proneurotransmission to progrowth signaling in cmpy mutants suggests that Cmpy marks the proneurotransmission pool. In support of this hypothesis, Cmpy is necessary for the ability of presynaptic Gbb to fully rescue neurotransmitter release in gbb mutants. Moreover, evidence is provided that the Cmpy ectodomain is secreted following nerve depolarization, arguing that Cmpy serves sequential functions in synaptic BMP signaling. It is proposed that Cmpy first delivers Gbb to DCVs and is then coreleased with Gbb to define a presynaptic proneurotransmission signal (James, 2014).
Crimpy prevents neuronal Gbb from driving excessive NMJ growth (James, 2011). To understand Cmpy-mediated regulation of Gbb, this study investigated its mechanism of action. Cmpy was found to control Gbb trafficking to presynaptic terminals, suggesting that it promotes Gbb function at synapses. Indeed, evidence is provided that Cmpy sorts Gbb into an activity-regulated pool that promotes baseline synaptic transmission. These studies suggest a mechanistic explanation for the proposed switch in signaling identity of neuronal Gbb in cmpy mutants. It is proposed that loss of Cmpy results in inappropriate NMJ growth because neuronal Gbb, which is normally destined for DCVs and released with the Cmpy ectodomain, is shunted into the CSP. It is further proposed that in cmpy mutants, constitutively secreted neuronal Gbb is misinterpreted by the neuron as muscle-derived progrowth signal, leading to NMJ overgrowth. This model is consistent with studies of protein trafficking in mammalian neurons, which have defined constitutive secretion as the default secretory pathway. For example, brain-derived neurotrophic factor (BDNF) secretion is regulated by neuronal activity. Sorting of BDNF into the regulated secretory pathway is mediated by Sortilin and Carboxypeptidase E. Loss of either protein results in BDNF missorting into the constitutive secretory pathway and enhanced constitutive release. Loss of intrinsic sorting signals also leads to missorting, because mutation of a dileucine-like sorting motif in the vesicular monoamine transporter 2 (VMAT2) diverts VMAT2 from the regulated to the constitutive secretory pathway. Consistent with the hypothesis that neuronal Gbb is missorted and constitutively released in the absence of Cmpy, abundant extracellular Gbb-HA is detected in the absence of stimulation in cmpy nulls (James, 2014).
Muscle-derived Gbb synchronizes morphological growth of pre- and postsynaptic cells, whereas neuron-derived Gbb regulates neurotransmitter release. This study found that Cmpy is required for activity-dependent release of Gbb. It is conceivable that either the location or timing of activity-dependent Gbb release at the NMJ is sufficient to define the presynaptic Gbb pool. It is alternatively possible that Gbb in DCVs in the regulated secretory pathway is processed differently than Gbb in the constitutive secretory pathway. In either case, Cmpy-dependent transport of Gbb to the regulated pathway would serve to mark motoneuron-derived Gbb. Further analysis of Gbb release and processing in cmpy mutants will define precisely the Cmpy-dependent DCV pool (James, 2014).
These studies suggest that Cmpy serves a second function in BMP signaling. The data suggest that a cleaved C-terminal fragment of Cmpy may be secreted with Gbb at the NMJ. Ectodomain shedding of Cmpy is consistent with the identification of a C-terminal cleavage product with Gbb-binding activity (James, 2011). In support of this model, the Cmpy C terminus is itself subject to activity-dependent release. Drosophila Crimpy shares sequence homology with the vertebrate transmembrane protein Crim1 (Cysteine-rich in motoneurons-1). Crim1 interacts with BMP4 and BMP7 and is expressed in motoneuron and interneuron populations in the developing spinal cord, though loss-of-function studies have not uncovered its neuronal function. Significantly, Crim1 is subject to a juxtamembrane cleavage that generates a secreted ectodomain that binds BMPs. Ectodomain shedding of Crim1 is consistent with the proposed secretion of the Cmpy ectodomain and suggests that the proteins serve similar functions. The proposed sequential roles for Cmpy in Gbb trafficking and signaling are also reminiscent of Sortilin's roles in successive aspects of neurotrophin signaling: Sortilin not only delivers BDNF into the regulated secretory pathway, but also forms a complex with the p75NTR receptor to drive cell death. Hence, Sortilin enables separation of proapoptosis and prosurvival signal transduction cascades. As an important test of Cmpy's signaling role, it will be critical to establish whether Cmpy cleavage is essential for its function and if a Cmpy-Gbb complex is secreted from neurons. Although Cmpy processing and release was detected, it is possible that full-length Cmpy acts as a BMP coreceptor and that Cmpy is cleaved only after its signaling function is complete. Testing for physical interactions between both cleaved and full-length Cmpy and the neuronal BMP receptors may shed light on the relationship between Cmpy processing and its biological activity (James, 2014).
The distinct signaling outcomes of muscle-derived progrowth signaling and neuron-derived protransmission signaling imply at least partially independent molecular cascades. Hence, it should, in principle, be possible to identify mutants required for growth, and not transmission, and vice versa (James, 2014).
Motoneurons express canonical members of the BMP signal transduction machinery, including the type II receptor Wishful thinking, the type I receptors Saxophone and Thickveins, the R-Smad Mad, and the co-Smad Medea. Loss-of-function mutations in these genes result in NMJ undergrowth and defective synaptic transmission, suggesting they regulate both synaptic size and strength. However, it is also possible that the transmission defects are secondary to the severe NMJ growth defects in these backgrounds, obscuring the identities of components dedicated to progrowth signaling. Conversely, genes required specifically for synaptic transmission would not have been identified in large-scale screens for aberrant NMJ morphology. Dissection of the roles of individual BMP signaling components in both muscle and neuron-derived Gbb signaling will be essential to tease apart the signal transduction cascades (James, 2014).
Regarding pathway directionality, firm evidence indicates that the progrowth pathway acts in a retrograde direction; however, the directionality of the protransmission pathway is incompletely defined. While an autocrine signaling mechanism provides the most parsimonious explanation for the current findings, a requirement for postsynaptic muscle in protransmission signaling cannot be ruled out. The data do not exclude the possibility that motoneuron-derived Gbb induces a postsynaptic signal that in turn promotes neurotransmitter release. Given the number and complexity of signaling interactions at the NMJ), it will be crucial to test if components of the BMP signal transduction machinery display postsynaptic requirements for neurotransmitter release (James, 2014).
BMP/TGF-β ligands regulate plasticity, cognition, and affective behavior in mammals. Arguing for local and specific synaptic action, mammalian BMP/TGF-β family members are sorted into secretory vesicles and subject to activity-dependent release. Given clinical interest in targeting synaptic functions of neuromodulators, a mechanistic understanding of Crimpy and its mammalian homologs will be of interest (James, 2014).
The bone morphogenetic protein (BMP) signaling network, comprising evolutionary conserved BMP2/4/Decapentaplegic (Dpp) and Chordin/Short gastrulation (Sog), is widely utilized for dorsal-ventral (DV) patterning during animal development. A similar network is required for posterior crossvein (PCV) formation in the Drosophila pupal wing. Although both transcriptional and post-transcriptional regulation of co-factors in the network appears to give rise to tissue-specific and species-specific properties, their mechanisms are incompletely understood. In Drosophila, BMP5-8 type ligands, Screw (Scw) and /aGlass bottom boat (Gbb), form heterodimers with Dpp for DV patterning and PCV development, respectively. Sequence analysis indicates that the Scw ligand contains two N-glycosylation motifs; one being highly conserved between BMP2/4 and BMP5-8 type ligands, and the other being Scw ligand-specific. The data reveal that N-glycosylation of the Scw ligand boosts BMP signaling both in cell culture and in the embryo. In contrast, N-glycosylation modifications of Gbb or Scw ligands reduce the consistency of PCV development. These results suggest that tolerance for structural changes of BMP5-8 type ligands is dependent on developmental constraints. Furthermore, gain and loss of N-glycosylation motifs in conserved signaling molecules under evolutionary constraints appear to constitute flexible modules to adapt to developmental processes (Tauscher, 2016).
This study provides insights into how evolutionary and developmental pressures shape molecules after their divergence from a common ancestor. A conserved N-glycosylation motif exists, which is specific for BMP-type ligands throughout various animal species. In addition, it was observed that the BMP5-8-type ligand Scw contains a unique N-glycosylation motif that helps to maintain a peak level of BMP signal in the embryo. In contrast, N-glycosylation modifications of BMP-type ligands reduce the consistency in PCV development. These observations provide insights into how evolutionarily conserved signaling molecules adapt to developmental processes (Tauscher, 2016).
The significance of N-glycosylation of the TGF-β-type ligands has been studied previously. For example, N-glycosylation of the BMP2 prodomain affects the folding and secretion of ligands, and non-glycosylated BMP2 and BMP6 produced in bacterial cells appear to be less active than the glycosylated ligands. Addition of an N-glycosylation motif in Nodal changes the stability of ligands, resulting in an increased signaling range. These facts suggest that N-glycosylation of ligands may play significant roles in vivo. However, these roles have been largely unexplored because of a lack of in vivo model systems. By employing both in vivo studies and cell-based experiments, this study has investigated how N-glycosylation modifications of the BMP-type ligands impact developmental processes. The in vivo rescue experiments revealed that these motifs are crucial for fly viability and are required to achieve peak level BMP signaling. Loss of the Scw-specific motif leads to a reduced impact on BMP signaling in the embryo compared with the effect of the conserved motif but also to less signaling capacity when compared to ScwWT, resulting in lower viability of g.scwN1Q rescued flies. On the other hand, integration of the Scw-specific N-glycosylation motif into its paralog Gbb (Scw-Gbb chimera) is not sufficient to provide functionality in the early embryo. This suggests that the critical changes responsible for the differing specificity of the Gbb and Scw ligands that developed after gene duplication may be differences in the primary sequences other than N-glycosylation motifs (Tauscher, 2016).
As reported in the case of Nodal, adding N-glycosylation sites to ligands may change protein stability/secretion and therefore may affect in vivo phenotypes. In the case of Scw, it is presumed that acquisition of the unique N-glycosylation motif has no drastic effect on protein stability/secretion, but instead directly affects the signaling outcome. First, equal amounts of differentially glycosylated ligands show different signaling intensities in the cell-based assay. Second, expression of differentially glycosylated ligands showed different signaling intensities in the embryo when they are expressed in identical genetic backgrounds. Third, the total protein levels in both cell lysates and supernatants for ScwWT, ScwN1Q and ScwN2Q are equivalent when they are expressed in S2 cells. Thus, these results suggest that changing the number and positions of N-glycosylation motifs may impact signaling intensities both in vivo and in vitro without significantly changing protein stability/secretion. In contrast, non-glycosylated Scw ligand (ScwN1_N2Q) appears to be less efficiently secreted. These facts suggest that at least one N-glycosylation site of Scw is crucial for maintaining protein stability/secretion, but their number or position may not be essential for secretion (Tauscher, 2016).
Interestingly, N-glycosylation of the ligands did not provide any advantage for PCV formation. Instead, the Scw ligand lacking both N-glycosylation motifs (ScwN1_N2Q) most efficiently restored the PCV-less phenotypes in gbb mutant wings. It is hypothesized that N-glycosylation of BMP ligands does not always benefit extracellular trafficking of ligands. Highly glycosylated ligands may interact with enriched extracellular matrix (ECM) at the basal side of wing epithelia and reduce the ligand mobility regulated by the BMP network. Alternatively, differential expression of key molecules may explain different phenotypes between embryogenesis and crossvein development. It has been previously reported that the heparan sulfate proteoglycan (HSPG) Dally impacts BMP signaling in various contexts. Dally plays a role in Dpp gradient formation in the wing imaginal disc by stabilizing Dpp and it increases the signaling of Gbb and Dpp in Drosophila S2 cells. In addition, lack of Dally and Dally-like protein (Dlp) affects PCV formation in the wing. Interestingly, HSPGs are absent within the first 3 hours of embryogenesis, which is the only time frame of scw expression. Based on these facts, it appears that Scw and HSPGs are mutually exclusive. This may partly explain why non-glycosylated Scw is functional for PCV development but not for embryonic DV patterning. Furthermore, the ScwN1_N2Q:Dpp heterodimer is likely to be a primary ligand responsible for BMP signaling in the PCV region. Since Dpp carries the conserved N-glycosylation motif, the ScwN1_N2Q:Dpp heterodimer contains one N-glycosylation site, although ScwN1_N2Q lacks N-glycosylation site. The N-glycosylation site of Dpp may help facilitate ScwN1_N2Q:Dpp heterodimer secretion (Tauscher, 2016).
Why is a unique N-glycosylation site acquired in the Scw ligand? scw is exclusively expressed in the early embryo, which is in contrast to the usually recurrent activity of signaling molecules at different stages of development. The favored model is that random mutations create differential N-glycosylation motifs in otherwise functionally redundant and conserved ligands. These novel motifs lead to structural changes that confer either advantages or disadvantages, depending on the developmental context. Since a positive feedback mechanism is crucial for DV patterning in Drosophila, acquisition of the unique N-glycosylation site could bring an advantage to Scw signaling. In contrast, in a wide range of species including humans, BMP2/4- and BMP5-8-type ligands are repeatedly utilized for development at different stages and in different positions. Therefore, to provide robustness and reproducibility in various contexts, vertebrate BMP2/4 and BMP5-8 contain only one N-glycosylation site to impose developmental constraints: stronger signaling than a non-glycosylated ligand, and less impeded extracellular trafficking than additionally glycosylated ligands. Consistently, Gbb has been shown to function at various developmental stages (Tauscher, 2016).
Although various co-factors of the BMP network have been identified among species, it remains to be addressed how they adapted to different developmental stages and different species. The scw allele was originally identified as a DV patterning defect and was determined to encode a BMP5-8-type protein. It was then proposed that scw originates from gene duplication of gbb in the branch leading to higher Diptera, a highly diverged branch in the arthropod lineage. Hence, gbb and scw provide an outstanding opportunity to investigate evolutionary divergence of protein structures. In Drosophila, gbb and scw are expressed in distinct patterns, but both function as co-factors of the BMP network. A recent study indicates both Gbb and Scw are utilized for DV patterning in the scuttle fly. gbb expression was also described in the early embryo of the lower Dipteran Clogmia albipunctata, in which the scw gene was not found. These facts indicate a possibility that Gbb acts as a co-factor of the BMP network for DV patterning in most arthropod species and that Scw evolved specifically for DV patterning in higher Diptera after duplication of the scw-like gene gbb. Further studies are needed to elucidate how Gbb lost the capacity to transduce signals in the Drosophila blastoderm embryo (Tauscher, 2016).
In summary, these data reveal that two BMP5-8-type ligands, Scw and Gbb, which function as co-factors of the BMP network, provide a unique model to investigate how orthologous proteins evolve under developmental and evolutionary constraints. Further studies in this context will help elucidate how evolutionarily conserved molecules generate diversified structures in the animal kingdom (Tauscher, 2016).
The Tgfbeta-60A transcripts and protein are first detected at the onset of gastrulation, in ectodermal and mesodermal cells and are observed throughout the extending germ band. Staining is particularly pronounced in mesodermal cells and in cells of the stomadeal and posterior midgut invaginations. The Tgfbeta-60a polypeptide is first detected after stage 7, somewhat later than the stage at which the mRNA is first detected. By germ band extension, the protein is readily detected in the extended germ band and, similar to mRNA localization, is most readly detected in cells of the mesoderm and of the stomodeal invagination and the posterior midgut. Neither mRNA nor polypeptide are observed prior to gastrulation, indicating that there is little maternal contribution. As the germ band retracts, and throughout later stages of embryonic development, the Tgfbeta-60A transcript and protein are most readily detected in cells of the developing foregut and hindgut. In particular, enhanced expression is observed in the endodermal cells of the anterior and posterior midgut of stage 12 embryos. At the same stage, mRNA and protein are also detected in cells of the visceral mesoderm and the gastric caecae. Following dorsal closure, mRNA becomes more difficult to detect, consistent with a decrease in transcript levels during late embryogenesis. During later stages of embryogenesis, the protein is readily detected in cells of the foregut and hindgut and in the anterior and posterior midgut (Doctor, 1992).
Amidated neuropeptides of the FMRFamide class regulate numerous physiological processes including synaptic efficacy at the Drosophila neuromuscular junction (NMJ). Mutations in wishful thinking (wit), a gene encoding a Drosophila Bmp type 2 receptor that is required for proper neurotransmitter release at the neuromuscular junction, also eliminates expression of FMRFa in that subset of neuroendocrine cells (Tv neurons) which provide the systemic supply of FMRFa peptides. Gbb, a Bmp ligand expressed in the segmentally repeated neurohemal organ associated with the ventral cord, provides a retrograde signal that helps specify the peptidergic phenotype of the Tv neurons. Supplying FMRFa in neurosecretory cells partially rescues the wit lethal phenotype without rescuing the primary morphological or electrophysiological defects of wit mutants. It is proposed that Wit and Gbb globally regulate NMJ function by controlling both the growth and transmitter release properties of the synapse as well as the expression of systemic modulators of NMJ synaptic activity (Marqués, 2003).
wishful thinking is primarily expressed in, and required for, proper nervous system function. Mutations in wit result in pharate lethality caused, in part, by defects in the growth and physiology of motoneuron synapses. Mutations in wit also affect the peptidergic phenotype of certain FMRFa-expressing cells found in the ventral cord. In particular, FMRFa expression is eliminated in the Tv neurons that contribute to the systemic supply of FMRFa peptides through release at the neurohemal organ. The regulation of FMRFa expression in Tv neurons is mediated by the Bmp ligand Gbb, since gbb null mutations also eliminate FMRFa expression in Tv neurons. Furthermore, supplying Gbb to the dorsal neurohemal cells restores FMRFa expression in Tv neurons. Since Tv neuron axons arborize onto the neurohemal cells, this strongly suggests that Gbb signals in a retrograde manner to specify the peptidergic phenotype of Tv neurons. Consistent with this view, overexpression in neuroendocrine cells of Dynamitin or a dominant-negative form of p150/Glued, both components of the Dynactin/Dynein motor complex was found to eliminate FMRFa expression in the Tv neurons. Finally, it is shown that providing FMRFa in neuroendocrine cells using the Gal4/UAS system partially rescues the lethal phenotype of wit mutants, even though they still exhibit structural and physiological synaptic defects. It is suggested that Bmp signaling provides a global cue that not only regulates the growth of the NMJ synapses locally but also controls their systemic modulation by the neuroendocrine system (Marqués, 2003).
The Drosophila genome contains seven TGFß type ligands. Three
of these, Dpp, Screw and Gbb, have been shown to transduce Bmp-type signals
(Mad) and to use the type I receptors Tkv and Sax. Two
others, Activin and Activin-like protein, transduce signals through Smad2. The signaling pathways used by Maverick and
Myoglianin remain untested. Among the three Bmp-type ligands, Gbb seemed a
likely candidate for controlling expression of FMRFa, since it is broadly
expressed, at least in embryos, and can signal through Wit to regulate P-Mad accumulation in motoneurons and tissue culture cells. gbb
is strongly expressed in the larval brain lobes and much more weakly in the
ventral ganglia. Interestingly, gbb shows enriched expression in the NHO relative to other ventral ganglia neurons. Thus, Gbb is expressed in the correct place to be a FMRFa regulating ligand (Marqués, 2003).
In Drosophila, FMRFamide peptides have been shown to enhance
synaptic transmission and muscle twitch tension when perfused onto standard
larval nerve-muscle preparations; however, their in vivo role(s) are not known as no
mutations in the FMRFa gene have been identified. As with most
neuropeptides, FMRFamide related peptides are thought to act as neuromodulators and neurohormones.
The Tv-produced FMRFamide related peptides are released into the hemolymph through the neurohemal
organ and hence are able to act on every tissue in the animal that is not
blocked to hemalymph contact. It has been hypothesized that the
lethality of wit mutants is due to the lack of proper synaptic
transmission at the NMJ, resulting in the animals not being able to eclose
from the pupal case. The lack of systemic FMRFamide described in this study would be
expected to further decrease synaptic efficiency and the ability of
wit mutants to eclose. The fact that loss of FMRFa does contribute to
the lethal phenotype is supported by the partial rescue of wit
mutants by overexpression of FMRFa. These results are consistent with
the view that in vivo, FMRFa peptides probably enhance NMJ synaptic activity
similar to their in vitro documented effects on standard larval
electrophysiological preparations (Marqués, 2003).
It is important to note that although the lethal phenotype is partially
reversed, the morphological and physiological synaptic defects reported for
wit mutants are not rescued by overexpression of FMRFa. The
simplest interpretation is that the excess of FMRFamide related peptides enhances the efficiency of wit mutant synapses in vivo without correcting the underlying developmental defects. Although one might expect a significant improvement of the electrophysiological phenotype, this is not detected, probably because the excess FMRFamide related peptides are either washed off the preparation during standard dissection
prior to recording or act for only short periods (Marqués, 2003).
How Wit signaling regulates FMRFa expression is not clear. Since
Smads are well known to act as transcriptional co-activators or co-repressors, the
simplest explanation is that Mad directly regulates activation of
FMRFa transcription, perhaps by forming a complex with Ap. However,
other indirect mechanisms are also possible and this issue will only be
resolved once the FMRFa promoter is fully characterized. It is also
not clear whether Gbb is the only ligand that regulates FMRFa
expression through Wit. In some developmental contexts, such as wing imaginal disc patterning, Gbb acts in combination with Dpp, another Bmp-type ligand. No expression of dpp has been detected in the NHO. However, it could be that one of the as yet uncharacterized ligands, Maverick or Myoglianin, could be a partner with Gbb in regulating FMRFa expression. Conversely, it seems clear that regulating the peptidergic phenotype of the six Tv neurons is not the only role of Gbb signaling. There are hundreds of neurons that receive Bmp signaling as indicated by P-Mad nuclear localization Most of them appear to be motoneurons, which require Wit/Gbb signaling to achieve proper synaptic growth but not to specify their neurotransmitter phenotype. Given that Smads act as co-transcriptional regulators, the fact that the same signal (nuclear translocation of P-Mad) results in different phenotypic outcomes in different neurons can probably be ascribed to the presence of a different set of transcription factors available in each cell type. The Tv neurons receiving the Bmp signal express apterous, a transcription factor required in those cells for FMRFa transcription, and maybe other factors that are required,
in addition to the Wit signal, to activate FMRFa (Marqués, 2003).
Another important issue to resolve is whether Gbb is constitutively
released from the NHO, or is synthesized and released as part of a feedback
mechanism to modulate muscle contractions. It might be that efficient muscle
contraction under normal conditions requires a constant level of FMRFamide related peptides that
are produced in response to a constitutive Gbb signal. Alternatively, Gbb
production or release might be regulated by a sensing mechanism that would
activate the pathway in response to an increased demand for FMRFamide related peptides, owing to
increased locomotor activity or other stimuli, such as compensating for a
synaptic developmental defect. Muscle-derived Gbb
acts through neuronal Wit to convey a retrograde signal essential for NMJ
synapse growth and maturation. In that context, it appears that the role of Bmp
signaling is to coordinate muscle growth with synapse maturation to ensure
proper synaptic efficiency. Thus, the
Wit/Gbb pathway acts as a two-step regulator of NMJ function. First, there is
a developmental role in which Wit signaling is required for proper synaptic
growth during larval development. Second,
Wit signaling is required to achieve the neuromodulatory effect of circulating
FMRFamide related peptides that are required for optimal synaptic transmission. Lack of either one
of these inputs probably results in a substantial decrease of the EJCs. These
two examples suggest that the Gbb/Wit pathway is of general importance in
neural retrograde signaling and it is speculated that it may be used in the
nervous system for other as yet uncharacterized developmental and
physiological purposes (Marqués, 2003).
Tv neurosecretory cells form part of a cluster of four
apterous-expressing neurons on each side of the three thoracic
ganglia. The axons of the Tv neurons extend proximally and dorsally to join
the contralateral axon, and form a median nerve that swells and arborizes onto a group of neurons and glial cells that constitute the neurohemal organ. In wit mutants, these structures develop normally, but the Tv neuron fail to activate FMRFa transcription. Using the Gal4/UAS system Wit's requirement for FMRFa expression was narrowed down to the Tv neurons. Since these neurons accumulate nuclear P-Mad, the results strongly suggest that Wit is required in the Tv neurons themselves, as opposed to forming part of an indirect signal relay mechanism. It appears likely that the source of Gbb in this signaling system is the NHO, since gbb is expressed in the NHO and replenishing Gbb in the NHO of gbb mutants rescues FMRFa expression in the Tv neurons. These experiments do not exclude the possibility that signaling might occur at the cell soma of the Tv neurons in vivo or that
the source of the diffusible ligand could be a different tissue under
physiological conditions. However, the dependence of nuclear P-Mad
accumulation and FMRFa expression in Tv neurons on Dynein-mediated
retrograde transport strongly suggests that signaling is taking place at the
Tv axon terminal. This dependency on Dynein motors is not a general
requirement for FMRFa expression in all neurons because subesophageal
ganglion neurons are not affected by overexpression of dominant-negative Glued or Dynamitin. Nor is the consequence of disrupting this motor likely to exert its effect at the level of P-Mad translocation to the nucleus, since nuclear accumulation of P-Mad in epithelial and mesodermal cells is not effected by retrograde transport disruption. Only in the nervous system is P-Mad accumulation specifically affected, consistent with a role for a retrograde transport mechanism in moving some component of this signaling pathway from the synapse to the nucleus (Marqués, 2003).
The continuous and steady supply of transient cell types such as skin, blood and gut depends crucially on the controlled proliferation of stem cells and their transit amplifying progeny. Although it is thought that signaling to and from support cells might play a key role in these processes, few signals that might mediate this interaction have been identified. During spermatogenesis in Drosophila, the asymmetric division of each germ line stem cell results in its self-renewal and the production of a committed progenitor that undergoes four mitotic divisions before differentiating while remaining in intimate contact with somatic support cells. TGF-ß signaling pathway components punt and schnurri have been shown to be required in the somatic support cells to restrict germ cell proliferation. This study showns, by contrast, that the maintenance and proliferation of germ line stem cells and their progeny depends upon their ability to transduce the activity of a somatically expressed TGF-ß ligand, the BMP5/8 ortholog Glass Bottom Boat. TGF-ß signaling represses the expression of the Bam protein, which is both necessary and sufficient for germ cell differentiation, thereby maintaining germ line stem cells and spermatogonia in their proliferative state (Shivdasani, 2003).
Spermatogenesis in adult Drosophila commences in the germinal proliferation center at the apical tip of the testis. To identify factors that can influence the regulation of cell proliferation in spermatogenesis, a number of signal transduction pathway components were screened using the GAL4/UAS targeted overexpression system. Various lines carrying transgenes under the transcriptional control of the UAS enhancer were crossed to lines carrying nanos-GAL4:VP16 (nos-GAL4), in which the GAL4 transcriptional activator is expressed only in the germ line. The testes of the progeny of such crosses were screened for morphological abnormalities (Shivdasani, 2003).
Overexpression of decapentaplegic results in testes containing large, opaque, spherical structures and large numbers of small cells resembling germ line stem cells (GSCs) and spermatogonia, but no spermatocytes or mature spermatids. Wild-type GSCs and gonialblasts contain a spectrin-rich organelle known as the spectrosome, which is spherical in shape, while spermatogonia and spermatocytes contain spectrin-rich structures known as fusomes, which are linear and branched in appearance. UAS-dpp/+; nos-GAL4/+ (UAS-dpp) testes contain similar numbers of spectrosome-containing cells to wild-type testes but many more fusome-containing cells, as shown by immunostaining using antibodies to α-spectrin, suggesting that the ectopic cells resemble spermatogonia rather than GSCs or gonialblasts (Shivdasani, 2003).
To investigate the behavior of germ cells in UAS-dpp testes, cell proliferation and cell death were examined. Immunostaining with anti-phosphorylated histone 3 (PH3) antibodies revealed cysts of germ cells undergoing synchronous mitotic division, another characteristic of spermatogonia, but exceeding the usual four rounds of mitosis. Staining with acridine orange revealed significantly more cell death in all the UAS-dpp testes examined. Taken together, these data suggest that in UAS-dpp testes, spermatogonia fail to cease mitotic division after four rounds but continue to divide synchronously and ultimately die (Shivdasani, 2003).
Similar phenotypes were observed in testes in which an activated form of the type I TGF-β receptor Thickveins was overexpressed in the germ line (UAS-tkv*), suggesting that the observed germ cell overproliferation phenotype in UAS-dpp testes seems to be due to a direct effect of dpp on germ cells rather than an indirect effect via the soma. Since there is no increase in the number of GSCs in either UAS-dpp or UAS-tkv* testes, it follows that high-level TGF-β signaling in the germ line is sufficient to induce spermatogonial overproliferation but is not sufficient to specify GSC identity (Shivdasani, 2003).
To investigate whether TGF-β signaling is required for germ cell proliferation, the inhibitory SMAD daughters against dpp (dad) (which has been shown to antagonize TGF-β signaling) was overexpressed in the germ line using nos-GAL4. Testes of such animals raised at 25°C exhibit a range of phenotypes, perhaps reflecting the strength of the UAS-dad transgenic line. In 27% of cases (43/161), testes resembled those of wild-type animals. In 21% of cases (34/161), testes appeared smaller and thinner than those of wild-type animals, with a visible reduction in the number of germ cells. In the remaining 52% of cases (84/161), testes had degenerated and completely lacked GSCs, spermatogonia, and spermatocytes, as indicated by the absence of Vasa protein, which is normally expressed in all germ cells. By contrast, overexpression of brinker (brk), a transcriptional repressor of many Dpp target genes, had no effect on testes (Shivdasani, 2003).
In order to test the requirement for TGF-β signaling in the germ line, the behavior of marked germ line clones lacking the activity of various TGF-β signaling pathway components was investigated. Germ line stem cells mutant for tkv or put (a type II TGF-β receptor) and spermatocytes lacking the activity of tkv, put, or mad (a transcription factor required for the regulation of TGF-β target genes) were generated but did not persist to the same extent as wild-type clones, as evidenced by assessing the ratio of the number of testes containing at least one germ line clone to the number of testes containing wild-type control clones. Sporadically (approximately 4% of cases), cysts containing eight, rather than 16, spermatocytes were observed, implying that the fourth spermatogonial division had not been complete. Such a scenario might have arisen due to the transient persistence of Tkv, Mad, or Put protein after the respective wild-type allele was lost. Together, these clonal analysis data suggest that TGF-β signaling is required for both germ line stem cell maintenance and spermatogonial proliferation. No requirement was found for schnurri (shn), the product of which is frequently required in Dpp signaling, in the germ line for these processes (Shivdasani, 2003).
To establish whether Dpp function is required for male germ cell proliferation, the testes was analyzed of animals transheterozygous for a temperature-sensitive combination of dpp alleles -- dpphr27/hr56 that had been raised at 18°C and shifted to the restrictive temperature of 29°C upon eclosion. After 7 days, the testes of such animals did not exhibit any overt morphological abnormalities and contained germ cells in all stages and in quantities indistinguishable from controls. Similar experiments were undertaken with a transheterozygous combination of temperature-sensitive alleles of punt. Adult males of the genotype put135/10460 were moved to the restrictive temperature of 29°C after eclosion. After 7 days, their testes were smaller and thinner than controls and exhibited an apparent reduction in the number of early germ cells, particularly spermatogonia and GSCs. These data indicate that while TGF-β signaling appears essential for germ cell proliferation, dpp is unlikely to play a major role in this process. Consistent with this notion, no dpp mRNA expression was detected in the testis by in situ hybridization. In situ hybridization was conducted to investigate the expression of two closely related homologs of dpp: screw (scw) and glass bottom boat (gbb). Whereas no expression of scw mRNA was detected in testes, gbb transcript was detected in the area corresponding to the germinal proliferation center, specifically in the somatic cyst cells (Shivdasani, 2003).
Given that gbb is expressed in the region where GSC and spermatogonial proliferation take place, whether loss of function of gbb has any effect on germ cell proliferation was tested. Examination of the testes of gbb1/4 adult males raised at 18°C revealed them to be significantly smaller than wild-type, with a dramatic reduction in the number of germ cells of all stages, particularly GSCs, spermatogonia, and spermatocytes. Immunostaining with antibodies to Vasa protein revealed that in the most extreme cases, testes from gbb mutant animals lacked GSCs, spermatogonia, and spermatocytes altogether. Similar phenotypes were observed in gbb4/4 males. These phenotypes could not be rescued by ectopically expressing gbb in a gbb4/4 mutant background using nos GAL4, thus confirming that these phenotypes are indeed due to a reduction in wild-type gbb function (Shivdasani, 2003).
Cyst cells outside the germinal proliferation center do not express gbb, implying that the cessation of proliferation of spermatogonia may be directly linked to the loss of gbb activity. The effects of overexpressing gbb were investigated using nos-GAL4 or the hub and early cyst cell-specific driver patched-GAL4. Surprisingly, none of these drivers yielded a phenotype resembling that produced when dpp or tkv* is overexpressed (Shivdasani, 2003).
This could be because Gbb is a less potent ligand than Dpp or that Gbb is posttranscriptionally regulated. Consistent with these notions are previous observations regarding the relative potency of the two ligands in orchestrating growth and patterning in imaginal discs and the RNA and protein expression patterns of Gbb in wing discs. Alternatively, it is possible that Gbb acts in tandem with another ligand as a heterodimer. In this case, loss of function of Gbb would be sufficient to produce a loss-of-function phenotype, whereas overexpression of Gbb alone may not be sufficient to achieve a gain of function effect (Shivdasani, 2003).
In an interesting parallel, a mouse ortholog of Gbb, BMP8b, has been shown to be required for the survival and proliferation of primordial germ cells in males. However, these studies reported that BMP8b is expressed in the germ line rather than the soma, and it was not established whether BMP8b acts on the germ line in an autocrine manner or indirectly via the soma (Shivdasani, 2003).
The mechanisms by which Gbb might regulate germ cell proliferation were explored next. One candidate that might interact with the pathway is the bags of marbles (bam) gene since, as with the activation of high-level TGF-β signaling in the male germ line, the loss of bam function is sufficient to induce the overproliferation of spermatogonia-like cells, but not GSCs (Shivdasani, 2003).
It has been reported that cytoplasmic Bam (Bam-C) is expressed in 2- to 16-cell spermatogonia, but not in GSCs, gonialblasts, or spermatocytes. Bam-C levels appear to be highest in late-stage spermatogonia, those farthest away from the apical hub, which are about to cease mitosis and differentiate into spermatocytes. Overexpression of bam using a heat-shock-bam transgene is sufficient to eliminate germ line stem cells in the ovary, but not in the testis. However, since it is not possible to achieve sustained, high-level, targeted overexpression with a heat-shock transgene, this analysis does not exclude a similar activity for Bam in the germ line of both sexes. By driving sustained, high-level overexpression of bam in GSCs and spermatogonia using nos-GAL4, it was found that testes of such animals resemble UAS-dad testes, being dramatically reduced in size, lacking early germ cells, and containing only mature spermatids. These expression and phenotypic data suggest that bam might be required for the differentiation of spermatogonia into spermatocytes. Loss of bam function might forbid differentiation, thereby maintaining spermatogonia in a proliferative state (Shivdasani, 2003).
The similarity between the TGF-β gain of function and bam loss of function phenotypes suggests that TGF-β signaling might act to repress bam activity. Testes were examined in which clones of cells expressing tkv* had been generated; such clones did not express Bam-C even though they overproliferated. It is therefore possible that TGF-β signaling might promote germ cell proliferation by repressing the activity of Bam, thus preventing premature differentiation of GSCs and amplifying spermatogonia, thereby maintaining them in a proliferative state. This possibility was tested by generating germ line clones that lacked both Bam activity and the ability to transduce the TGF-β signal. Such germ cells, doubly mutant for bam and put, behave as bam mutant clones and overproliferate as small cells resembling spermatogonia (Shivdasani, 2003).
It is proposed that Gbb acts as a short-range signal, emanating from cyst cells, signaling only to the GSCs and spermatogonia they enclose, thereby repressing Bam activity and maintaining germ cells in a proliferative state. Such short-range signaling by Gbb is consistent with the independent proliferation and differentiation of individual cysts. As each cyst ages, diminishing Gbb levels result in less TGF-β signal transduction in the spermatogonia, which in turn results in increasing Bam levels. Bam levels might constitute a counting mechanism such that once Bam levels reach a certain threshold, spermatogonia exit the cell cycle and commence differentiation into spermatocytes. This would be consistent with spermatogonia undergoing exactly four mitotic divisions. Bam activity thus forges an intimate link between proliferation and differentiation such that the former can only proceed if the latter is suppressed (Shivdasani, 2003).
By contrast with the ovary, in which TGF-β signaling appears to be both necessary and sufficient for GSC maintenance, the pathway appears necessary in the testis for GSC maintenance but is not sufficient to specify GSC fate. This is presumably because male GSCs are required to transduce the JAK/STAT signaling pathway in order to self-renew. Since only GSCs adjacent to the hub are thought to transduce this pathway, it is only these cells that are capable of retaining stem cell identity (Shivdasani, 2003).
It has been reported that loss of function of put and shn in somatic cyst cells results in spermatogonial overproliferation. Taken together with the data presented in this study, these observations suggest the intriguing possibility of two opposing roles for TGF-β signaling in the regulation of germ cell proliferation: a requirement in the cyst cells to restrict spermatogonial proliferation and a requirement in the germ line to maintain GSCs and promote the proliferation of spermatogonia. It is noted, however, that the previous study did not find a requirement for either the type I TGF-β receptors Tkv or Sax or the transcription factor Mad in the cyst cells, nor was the requisite TGF-β ligand for this process identified (Shivdasani, 2003 and references therein).
The results of this and other studies highlight the significance of bilateral communication between the germ line and soma, and the importance of somatic support and guidance of the germ line during gametogenesis. The emergence of specific roles for well-known developmental signaling pathways in gametogenesis is enabling the attainment of a comprehensive understanding of the inductive interactions required to guide germ cells through the stereotypical sequence of events from germ line stem cell to gamete and is affording insights into how fundamental biological processes such as asymmetric cell division and controlled mitotic division are regulated (Shivdasani, 2003).
Thus spermatogenesis in Drosophila might constitute a relatively simple model system in which to investigate such processes and may unveil general paradigms that may be applicable to more complex systems in which the relationship between stem cells, proliferating progeny, and their neighboring support cells is less well understood (Shivdasani, 2003).
The BMP ortholog Gbb can signal by a retrograde mechanism to regulate synapse growth of the Drosophila neuromuscular junction (NMJ). gbb mutants have a reduced NMJ synapse size, decreased neurotransmitter release, and aberrant presynaptic ultrastructure. These defects are similar to those observed in mutants of BMP receptors and Smad transcription factors. However, whereas these BMP receptors and signaling components are required in the presynaptic motoneuron, Gbb expression is required in large part in postsynaptic muscles; gbb expression in muscle rescues key aspects of the gbb mutant phenotype. Consistent with this notion, blocking retrograde axonal transport by overexpression of dominant-negative p150/Glued in neurons inhibits BMP signaling in motoneurons. These experiments reveal that a muscle-derived BMP retrograde signal participates in coordinating neuromuscular synapse development and growth (McCabe, 2003).
During Drosophila larval growth, muscle surface area increases dramatically, on the order of 100-fold. To maintain constant synaptic output, nerve terminals adjust both bouton number and active zones per bouton to compensate for the increase in muscle size during development. Evidence is provided that Gbb, a BMP-type ligand, is produced in muscles and signals in part by a retrograde mechanism through BMP receptors located in presynaptic nerve terminals to regulate synaptic growth and function at the Drosophila neuromuscular junction (McCabe, 2003).
The partial rescue of P-Mad accumulation, bouton number, and neurotransmission when Gbb is expressed in muscles is consistent with the notion that Gbb can provide a retrograde signal from the synapse to the neuron cell body. Although the data indicate that a component of the BMP signal is provided by a retrograde mechanism, an additional signal also seems to be required in either the motoneuron cell body or the CNS. Gbb is expressed in the CNS in addition to muscle. Resupplying Gbb in the muscles of gbb mutants does significantly restore P-Mad accumulation in motoneurons; however, rescue either ubiquitously or in both the CNS and muscle is significantly better than muscle rescue alone. Furthermore, complete rescue of the defects of neurotransmitter release in gbb mutants can be achieved by restoration of Gbb in all neurons, but only partially by restoration in muscles or in motoneurons alone. This contrasts with the requirement of Gbb for neuromuscular junction growth, which appears to primarily require muscle expression. It is possible that this is a quantitative issue; however, staining with a Gbb antibody suggests that both the muscle and elav drivers provide much higher levels of Gbb protein than is present under endogenous conditions. Thus, full rescue may require BMP signaling in both the CNS and at the synapse (McCabe, 2003).
The retrograde requirement for Gbb in synapse structural growth is further supported by experiments inhibiting dynein motor function by overexpression of dominant-negative Glued protein (ΔGl). RNAi-mediated depletion of Arp-1/centractin as well as overexpression of dominant P150/Glued reveal a requirement for dynactin to stabilize NMJ synapses (Eaton, 2002). The degree of net synapse growth appears to be determined by a balance of synapse expansion and retraction (Eaton, 2002). Expression of a dominant-negative Glued protein in the presynaptic cell reduces synaptic bouton number and produces synaptic ultrastructure defects, which are remarkably similar to those described for mutations in the BMP signaling pathway. These ultrastructure defects include membrane detachments along active zones and increased numbers of large vesicles in the presynaptic nerve (Eaton, 2002). Two possible models have been put forth to explain the requirement for dynactin at nerve termini: either it affects local properties, perhaps by altering microtubule stability and dynamics, or it interferes with a retrograde signal. These models are not mutually exclusive and, as described in this study, presynaptic expression of ΔGlu interferes with accumulation of P-Mad in motoneurons. This led to the conclusion that at least some portion of the ΔGl overexpression phenotype is attributable to interference with the retrograde BMP signal. It is suggested that perhaps ΔGl-induced retraction defects result from local disruptions in microtubule stability as suggested by (Eaton, 2002, while other phenotypes, such as reduced bouton number and active zone defects, are the result of disruption in BMP signaling. When synaptic function was examined in animals overexpressing dominant P150/Glued, quantal content was found to be reduced by 40%; however, mEJP amplitude and frequency was unaffected (Eaton, 2002). This contrasts with the findings for mutants of gbb where an 85% reduction in neurotransmitter release is found but also a 3-fold decrease in mEJP frequency. This is consistent with a disconnect between the retrograde requirement for Gbb in synapse structural growth and the requirement for Gbb in neurotransmitter release (McCabe, 2003).
It is interesting to note that bilateral NMJ signaling is not without precedent. Recently, Wingless (Wg) has been shown to be essential for both pre- and postsynaptic differentiation. In this case, Wg is made in the presynaptic cell, but its dual pre- and post-synaptic requirement indicates that either it signals in both an autocrine and juxtacrine manner or that the postsynaptic cell sends back a second signal that is responsible for presynaptic differentiation. Likewise, Gbb may have both a pre- and postsynaptic role. It is unlikely that Wg is regulating the Gbb signal, since accumulation of P-Mad is still seen in motoneurons of wg mutants. It remains to be determined if Gbb might influence the Wg signal (McCabe, 2003).
Gbb may also have a general role as a retrograde signaling ligand in the CNS, since Gbb is also required for specifying the FMRFa peptidergic phenotype of Tv neurons. Tv neurons innervate a specialized secretory structure known as the neurohemal organ (NHO) that is responsible for systemic release of FMRFa peptides. In this case, the Gbb signal originates in the NHO and controls the FMRFa peptidergic phenotype of Tv neurons. As is found in this study, expression of dominant-negative Glued also blocks the Gbb signal, providing evidence that this signal may also be retrograde. Also, an unknown retrograde signal that controls the homeostasis of neurotransmitter release at the NMJ is modulated by postsynaptic CaMKII (Haghighi, 2003). This homeostatic retrograde signal requires presynaptic Wit, implicating BMP signaling in this form of plasticity, though it remains to be determined if Gbb is involved (McCabe, 2003).
In the case of the BMP signal described in this study, the finding that a high accumulation of P-Mad is detectable in motoneuron nuclei when Gbb is resupplied to nerve terminals from the postsynaptic muscle cell implies that a retrograde signal likely contributes to P-Mad nuclear localization. Consistent with this view is the observation that blocks in the dynein/dynactin motor complex also disrupt P-Mad accumulation similar to what has been reported for transport of activated Trks. Since Mad and Medea mutants also display NMJ defects that are very similar to those exhibited by receptor and ligand mutants, it seems likely that the majority of these defects result from the lack of the retrograde signal itself as opposed to some being caused by the lack of a hypothetical local signal. As is the case for Trks, a signaling endosome consisting of activated heteromeric receptor complexes containing Gbb, Wit, Tkv, and Sax might be transported back to the cell body where these complexes would phosphorylate cytoplasmic Mad, resulting in its translocation to the nucleus. Alternatively, nonphosphorylated Mad may first be transported anterogradely to the nerve. Subsequent to phosphorylation at the NMJ, it may then be selectively transported in a retrograde fashion back to the cell body (McCabe, 2003).
In support of a possible endosome model, recent studies of TGF-β signaling in Mv1Lu and Cos-7 cells indicate that Smad phosphorylation and subsequent release from receptors does not occur efficiently until dynamin has excised a budded vesicle, presumably containing the activated receptor complex, from the plasma membrane. Efficient signaling also requires Smad Anchor for Receptor Activation (SARA), an endosomally localized protein. In Drosophila, there is conflicting data concerning the requirement for receptor internalization for signal propagation. Clones of wing disc cells mutant for the Drosophila α adaptin gene are still able to express the Dpp target gene spalt, suggesting that endocytosis prior to vesicle formation is not required for signal propagation. However, expression of a dominant-negative version of Rab5 to block formation of endocytic vesicles in wing discs has recently been shown to at least partially interfere with Dpp signaling. Since clonal analysis requires that preexisting protein be depleted before phenotypic consequences are manifested, while the dominant-negative methodology does not, it may be that perdurance of α adaptin protein in clones obscures the involvement of endocytosis for Dpp signaling. Thus, it is possible that like TGF-β, BMP-type signals may also emanate from a signaling endosome. Consistent with this view is the observation that overexpression of the SARA FYVE endosomal localization domain has been shown to disrupt BMP-induced transcriptional responses in HeLa cells (McCabe, 2003 and references therein).
Of particular relevance to the involvement of endosomes in mediating BMP signaling at synapses is the recent observation that mutations in the spinster (spin) gene greatly enhance synaptic growth. Spin is a putative multipass transmembrane protein localized to the late endosomes/lysosomes. Mutations in spin disrupt the morphology of late endosomes and lead to a 2-fold overgrowth in bouton number at the NMJ. This overgrowth can be suppressed by mutations in wit, suggesting that elimination of Spin leads to enhanced BMP signaling. Although the molecular mechanism responsible for the increased signal is unclear, the combined data support the idea that BMP signaling is likely modulated by intracellular trafficking of various signaling components at the level of the endosome. If these endosomes are capable of binding to dynein motors, then, like the Trk containing endosomes, they may also be transported along microtubules back to the cell body. Other models, such as wave activation of receptors, may also be possible, although if this is the case, then it is not clear why overexpression of ΔGl should interfere with BMP signaling as described above (McCabe, 2003).
Although loss-of-function and rescue experiments clearly demonstrate that Gbb is required for proper synaptic development at the NMJ, it is not certain that it is the only TGF-β-type ligand or indeed the primary ligand that regulates this process. The electrophysiological and ultrastructure defects observed in gbb mutant synapses are not as severe as those found in wit null mutants. This could simply reflect an inability to produce true null animals that survive to the third instar stage, or it may indicate that another ligand also provides a signal. In support of this view is the observation that P-Mad accumulation is not totally eliminated in gbb1/gbb2 null mutant embryos as it is in wit mutants. In addition, it is noted that while overexpression of Gbb in the CNS only weakly rescued P-Mad accumulation in the CNS, the pattern of accumulation does not appear to change. That is, P-Mad still seems to be found primarily in motoneurons. Thus, other neurons do not appear to be competent to respond to BMP-type ligands, perhaps because a specific cosignal is absent or because they do not express the right combination of receptors. It is interesting to note that in several other developmental contexts in Drosophila, it appears that at least two BMP ligands provide regulatory inputs into a common process (McCabe, 2003).
A final issue to consider is what regulates Gbb delivery at the synapse. Two alternatives seem most probable. Either it constitutively bathes the synapse, or it is released in response to a presynaptic stimulus. A third possibility, assuming that more than one BMP ligand is activating the pathway, is that one of the ligands would be constitutively released, acting as a background synapse growth stimulus, and the second ligand would be released in response to developmental or physiological stimuli, such as muscle growth or increased synaptic activity (McCabe, 2003).
Retrograde signaling plays an important role in synaptic homeostasis, growth, and plasticity. A retrograde signal at the neuromuscular junction (NMJ) of Drosophila controls the homeostasis of neurotransmitter release. This retrograde signal is regulated by the postsynaptic activity of Ca2+/calmodulin-dependent protein kinase II (CaMKII). Reducing CaMKII activity in muscles enhances the signal and increases neurotransmitter release, while constitutive activation of CaMKII in muscles inhibits the signal and decreases neurotransmitter release. Postsynaptic inhibition of CaMKII increases the number of presynaptic, vesicle-associated T bars at the active zones. Consistently, it is shown that glutamate receptor mutants also have a higher number of T bars; this increase is suppressed by postsynaptic activation of CaMKII. Furthermore, presynaptic BMP receptor Wishful thinking is required for the retrograde signal to function. These results indicate that CaMKII plays a key role in the retrograde control of homeostasis of synaptic transmission at the NMJ of Drosophila (Haghighi, 2003).
It has been demonstrated that a BMP type II receptor, wishful thinking (wit), is required for both growth and function of the NMJ in Drosophila. To further explore the mechanism by which motor neurons respond to the retrograde signal, whether the retrograde enhancement of quantal content can occur in wit mutants was examined. The results indicate that the retrograde signal cannot increase neurotransmitter release in the absence of Wit. Activation of the retrograde signal by either postsynaptic expression of GluRIIAM/R or postsynaptic inhibition of CaMKII did not lead to any increase in quantal content. These results indicate a requirement for wit presynaptically for the functioning of the retrograde mechanism that controls the homeostasis of neurotransmitter release at the NMJ of Drosophila and that postsynaptic inhibition of CaMKII requires the function of presynaptic BMP signaling to enhance quantal release (Haghighi, 2003).
Glass bottom boat (Gbb), a BMP ortholog, functions as a retrograde ligand for Wit at the Drosophila NMJ. Mutations in gbb lead to NMJ defects similar to those observed in wit mutants, and postsynaptic transgenic expression of Gbb can rescue many of these defects. In light of these findings, it is possible that there is a link between postsynaptic activity of CaMKII and the level and function of Gbb at the NMJ of Drosophila (Haghighi, 2003).
At the Drosophila neuromuscular junction (NMJ), the loss of retrograde, trans-synaptic BMP signaling causes motoneuron terminals to have fewer synaptic boutons, whereas increased neuronal activity results in a larger synapse with more boutons. This study shows that an early and transient BMP signal is necessary and sufficient for NMJ growth as well as for activity-dependent synaptic plasticity. This early critical period was revealed by the temporally controlled suppression of Mad, the SMAD1 transcriptional regulator. Similar results were found by genetic rescue tests involving the BMP4/5/6 ligand Glass bottom boat (Gbb) in muscle, and alternatively the type II BMP receptor Wishful Thinking (Wit) in the motoneuron. These observations support a model where the muscle signals back to the innervating motoneuron's nucleus to activate presynaptic programs necessary for synaptic growth and activity-dependent plasticity. Molecular genetic gain- and loss-of-function studies show that genes involved in NMJ growth and plasticity, including the adenylyl cyclase Rutabaga, the Ig-CAM Fasciclin II, the transcription factor AP-1 (Fos/Jun), and the adhesion protein Neurexin, all depend critically on the canonical BMP pathway for their effects. By contrast, elevated expression of Lar, a receptor protein tyrosine phosphatase found to be necessary for activity-dependent plasticity, rescued the phenotypes associated with the loss of Mad signaling. Synaptic structure and function develop using genetically separable, BMP-dependent mechanisms. Although synaptic growth depended on Lar and the early, transient BMP signal, the maturation of neurotransmitter release was independent of Lar and required later, ongoing BMP signaling (Burke, 2013).
This study investigated how retrograde BMP signaling by Gbb, Wit, and Mad influences the development of the Drosophila NMJ. The experiments examined the timing of retrograde signaling and the relationship between BMP signaling and the activity-dependent modulation of NMJ development. The results indicate that an early and transient period of BMP signaling, acting through Mad, activates key developmental programs necessary for synapse maturation. Transcriptional regulation by Mad in the first larval instar (L1, 24 h) is necessary and sufficient for robust NMJ growth during the second (L2) and third (L3) instars (72 h). Mad signaling during L1 also allows activity to enhance the growth process. By contrast, Mad signaling in L1 through L3 is required for normal active zone morphology and the developmental increase in quantal content. The results therefore indicate that retrograde BMP signaling 'gates' NMJ development and plasticity by initiating two genetically separable programs for growth and physiology (Burke, 2013).
In the absence of retrograde BMP signaling, the NMJ shows only residual growth, forming weak connections that are insensitive to activity-dependent modulation. BMP signaling mutations do not disrupt axonal guidance, target selection, or the initiation of synaptogenesis. They instead have profound effects on later aspects of synaptic development, affecting NMJ expansion and bouton stabilization. Expression of Mad1, the protein encoded by the strong dominant-negative mad1 allele, phenocopies BMP signaling mutants, affecting both NMJ growth and physiology. By driving Mad1 expression at various times during development, it was found that Mad-dependent signaling during L1 is both necessary and sufficient for subsequent NMJ growth. The results are consistent with an L1 critical period for BMP signaling. Inducing Mad1 expression at all times except L1 produced a WT-sized NMJ, whereas induction only during L1 reduced NMJ size to that seen in mad mutants. The genetic rescue of gbb and wit mutants also revealed the importance of the retrograde BMP pathway signaling during embryogenesis and L1. The timing of retrograde BMP signaling, after synaptogenesis yet before growth commences, suggests a model where the muscle uses BMP signaling to inform the motoneuron nucleus of a successfully formed synapse, activating subsequent growth and plasticity programs. The exact timing of this critical period, however, requires knowing when the Mad1 transgene inhibits transcription of Mad's major effectors of NMJ growth, which are unknown. The data indicate that a 24 h exposure to RU-486 during L1 expresses enough Mad1 to suppress NMJ growth. It also suggests that the perdurance of the dominant negative plus the time needed for its activation must be less than 24 h, as expression during embryogenesis, L2, and L3 led to NMJs that were nearly WT in size. Therefore, although the critical period may be shifted later in development than the data indicate, it is likely to begin as early as 5 h after the onset of L1 (Burke, 2013).
The data provide an entrance into the mechanisms regulating the critical period. Based on its timing between the embryonic and L2 stages, it is possible that molting hormones influence Mad activity. Recent work also indicates that anterograde activin signaling induces Gbb expression in body wall muscles, whereas postsynaptic dCIP4 signaling (Drosophila Cdc42 Interacting Protein 4) and the activity of dRich, a conserved Cdc 42-selective guanosine triphosphatase-activating protein, inhibits Gbb secretion from these muscles (Nahm, 2010a; Nahm, 2010b). Furthermore, the secretion of a TGF-β ligand (Maverick) from peripheral glia strongly regulates Gbb signaling from the postsynaptic muscle, affecting both pMad levels within motoneurons and NMJ growth. It would therefore be interesting to perform phenocritical analyses on activin, dCIP4, dRich, and Maverick and to address whether postsynaptic depolarization influences the activity of dCIP4 or dRich. Genetic interaction experiments found no evidence to suggest that moderate increases in BMP signaling modulate the final size of the NMJ or synergize with presynaptic activity. The findings of an early critical period for NMJ growth differ slightly from a previous study, which overexpressed an inhibitory SMAD. In an effort to reconcile the current results with these earlier data, Dad was transiently expressed during L1 but no alteration was found in NMJ size, perhaps resulting from different mechanisms of BMP pathway inhibition (Burke, 2013).
An unexpected result from this study is that the early BMP signal is necessary and sufficient for subsequent growth and structural plasticity, but not for synaptic function. In the absence of later BMP signaling, the NMJ grows to its structurally normal size but has reduced neurotransmission. The later requirement for BMP signaling is consistent with the observation that pMad levels remain high in motoneuron nuclei throughout larval development. In the absence of continual Mad activity, the number of active zones is reduced and their size is aberrantly enlarged. The separable roles of BMP signaling for NMJ growth and function are also consistent with the distinct actions of the two known targets of retrograde BMP signaling in motoneurons, Trio and Target of wit (Twit) (Burke, 2013).
It is not known whether the active zone phenotype arising from the loss of BMP signaling late in development results from defects in the formation or the maintenance of these structures. The active zone protein Sunday driver (dSyd) and the Teneurin-a adhesion molecule are potentially involved in Mad's physiological program, as their loss causes physiological and ultrastructural phenotypes that overlap with those of BMP mutants. Future studies of how Mad simultaneously and separately regulates NMJ growth and physiology could lead to a deeper understanding of how dSyd and Teneurin-a might act dowstream of Mad. The separable downstream effects of Mad on growth versus physiology may depend on post-translational modifications that can occur at the linker between the MH1 and MH2 domains, changes that can affect the affinity of Mad's binding partners. Unfortunately, Mad's noncanonical binding partners in motoneurons are entirely uncharacterized (Burke, 2013).
Elevated action potential firing in motoneurons resulting from the loss of repolarizing K+ channels or by high-temperature rearing substantially enhances NMJ growth and synaptic transmission. Mutations affecting the BMP signaling pathway block this plasticity without suppressing presynaptic hyperactivity. The results indicate that retrograde BMP signaling allows motoneuron growth to be responsive to increased levels of activity. Indeed, the level of excitability during Mad's critical period for growth strongly affected synaptic size in mature larvae. Understanding how this early activity engages BMP-dependent programs could be very insightful given that cAMP, AP-1, and Fas-2 signaling failed to rescue the effects of Mad1 expression (Burke, 2013).
Instead, the receptor protein tyrosine phosphatase Lar rescued both normal and activity-dependent NMJ growth, and Lar was required for activity-dependent developmental plasticity. Lar family members are essential, well-conserved regulators of synaptogenesis from worms and flies to mammals. Despite the prior identification of extracellular ligands for Lar family RPTPs, there has been no significant insight into the temporal regulation of Lar signaling during synaptogenesis in any system. Current evidence suggests that the Lar pathway regulates cytoskeletal assembly and active zone formation while antagonizing the activity of the highly conserved Abelson (Abl) tyrosine kinase. At the larval stage, Abl negatively regulates NMJ size and abl mutations have phenotypes reciprocal to those of Lar. Lar may relieve the growth-inhibitory action of Abl, promoting synaptic expansion in response to elevated activity or postsynaptic growth. Lar acts via the actin-modulating protein Ena for NMJ growth, whereas Trio and Lar regulate growth and the presynaptic cytoskeleton by interacting with Diaphanous, a member of the formin family of proteins. As Trio levels are reduced in BMP mutants and the expression of Trio only partially rescues NMJ growth, it is possible that Ena or Diaphanous act independently of Mad signaling (Burke, 2013).
In the absence of BMP signaling, the small NMJs can be genetically rescued by increased expression of Lar. This suggests that reduced BMP signaling in some fashion reduces Lar activity or function at the NMJ. qPCR analyses show that Lar transcript levels remain normal despite reduced pMad activity, leaving open the possibility that post-transcriptional mechanisms reduce Lar expression, NMJ localization, or activity, either by changes to the receptor itself, to Lar's binding partners (for e.g., Liprins), or to the heparin sulfate proteoglycan ligands. The observations support a model where retrograde BMP signaling allows synaptic growth to be modulated by neural activity, with Lar acting as the downstream 'gain controller' to establish the specific level of synaptic efficacy. In this model, postsynaptic BMP release initiates competence of the presynaptic terminal to respond to the matrix via Lar. Lar's heparin sulfate proteoglycan ligands and its anchoring proteins (Liprins) might then provide spatial information or couple Lar function to synaptic activity. Heparin sulfate proteoglycans play important roles during critical periods, and they modulate the signaling of BMPs, Wnts, and fibroblast growth factors. It is therefore possible that the extracellular matrix provides a key integrator that coordinates multiple trans-synaptic signals in a developmental and activity-dependent manner (Burke, 2013).
Effective communication between pre- and post-synaptic compartments is required for proper synapse development and function. At the Drosophila neuromuscular junction (NMJ), a retrograde BMP signal functions to promote synapse growth, stability and homeostasis and coordinates the growth of synaptic structures. Retrograde BMP signaling triggers accumulation of the pathway effector pMad in motoneuron nuclei and at synaptic termini. Nuclear pMad, in conjunction with transcription factors, modulates the expression of target genes and instructs synaptic growth; a role for synaptic pMad remains to be determined. This study reports that pMad signals are selectively lost at NMJ synapses with reduced postsynaptic sensitivities. Despite this loss of synaptic pMad, nuclear pMad persisted in motoneuron nuclei, and expression of BMP target genes was unaffected, indicating a specific impairment in pMad production/maintenance at synaptic termini. During development, synaptic pMad accumulation followed the arrival and clustering of ionotropic glutamate receptors (iGluRs) at NMJ synapses. Synaptic pMad was lost at NMJ synapses developing at suboptimal levels of iGluRs and Neto, an auxiliary subunit required for functional iGluRs. Genetic manipulations of non-essential iGluR subunits revealed that synaptic pMad signals specifically correlate with the postsynaptic type-A glutamate receptors. Altering type-A receptor activities via protein kinase A (PKA) revealed that synaptic pMad depends on the activity and not the net levels of postsynaptic type-A receptors. Thus, synaptic pMad functions as a local sensor for NMJ synapse activity and has the potential to coordinate synaptic activity with a BMP retrograde signal required for synapse growth and homeostasis (Sulkowski, 2013).
Previous work has described Neto as the first nonchannel subunit required for the clustering of iGluRs and formation of functional synapses at the Drosophila NMJ. Neto and iGluR complexes associate in the striated muscle and depend on each other for targeting and clustering at postsynaptic specializations. This study shows that Neto/iGluR synaptic complexes induce accumulation of pMad at synaptic termini in an activity-dependent manner. The effect of Neto/iGluR clusters on BMP signaling is selective, and limited to synaptic pMad; nuclear accumulation of pMad appears largely independent of postsynaptic glutamate receptors. This study demonstrates that synaptic pMad mirrors the activity of postsynaptic type-A receptors. As such, synaptic pMad may function as an acute sensor for postsynaptic sensitivity. Local fluctuations in synaptic pMad may provide a versatile means to relay changes in synapse activity to presynaptic neurons and coordinate synapse activity status with synapse growth and homeostasis (Sulkowski, 2013).
Drosophila NMJs maintain their evoked potentials remarkably constant during development, from late embryo to the third instar larval stages. This coordination between motoneuron and muscle properties requires active trans-synaptic signaling, including a retrograde BMP signal, which promotes synaptic growth and confers synaptic homeostasis. Nuclear pMad accumulates in motoneurons during late embryogenesis. However, embryos mutant for BMP pathway components hatch into the larval stages, indicating that BMP signaling is not required for the initial assembly of NMJ synapses and instead modulates NMJ growth and development. This study demonstrates that synaptic accumulation of pMad follows GluRIIA arrival at nascent NMJs and depends on optimal levels of synaptic Neto and iGluRs. As type-A receptors have been associated with nascent synapses, and type-B receptors mark mature NMJs, accumulation of synaptic pMad appears to correlate with a growing phase at NMJ synapses. Furthermore, synaptic pMad correlates with the activity and not the net levels of postsynaptic type-A receptors. In fact, expression of a GluRIIA variant with a mutation in the putative ion conduction pore triggered reduction of synaptic pMad levels. Thus, synaptic pMad functions as a molecular sensor for synapse activity and may constitute an important element in synapse plasticity (Sulkowski, 2013).
The synaptic pMad pool has been localized primarily to the presynaptic compartment. However, a contribution for postsynaptic pMad to the pool of synaptic pMad is also possible. Postsynaptic pMad accumulates in response to glia-secreted Mav, which regulates gbb expression and indirectly modulates the Gbb-mediated retrograde signaling (Fuentes-Medel, 2012). RNAi experiments revealed that knockdown of mad in muscle induces a decrease in synaptic pMad, albeit much reduced in amplitude compared with knockdown of mad in motoneurons (Fuentes-Medel, 2012). Also, knockdown of wit in motoneurons, but not in muscle, and knockdown of put in muscle, but not in motoneurons, triggers reduction of synaptic pMad (Fuentes-Medel, 2012). Intriguingly, the synaptic pMad is practically abolished in GluRIIA and neto109 mutants and cannot be further reduced by additional decrease in Mad levels. Whereas loss of postsynaptic pMad could be due to a Mav-dependent feedback mechanism that controls Gbb secretion from the muscle, the absence of presynaptic pMad demonstrates a role for GluRIIA and Neto in modulation of BMP retrograde signaling (Sulkowski, 2013).
As BMP signals are generally short lived, synaptic pMad probably reflects accumulation of active BMP/receptor complexes at synaptic termini. Recent evidence suggests that BMP receptors traffic along the motoneuron axons, with Gbb/receptors complexes moving preferentially in a retrograde direction. By contrast, Mad does not appear to traffic. Thus, Mad is likely to be phosphorylated and maintained locally by a pool of active Gbb/BMP receptor complexes that remain at synaptic termini for the time postsynaptic type-A receptors are active (Sulkowski, 2013).
The activity of type-A glutamate receptors may control synaptic pMad accumulation (1) indirectly via activity-dependent changes that are relayed to both pre- and postsynaptic cells, or (2) directly by influencing the production and signaling of varied Gbb ligand forms or by localizing Gbb activities. For example, inhibition of postsynaptic receptor activity induces trans-synaptic modulation of presynaptic Ca2+ influx. Such Ca2+ influx changes may trigger events that induce a local change in synaptic pMad accumulation. One possibility is that changes in Ca2+ influx may recruit Importin-β11 at presynaptic termini, which in turn mediate synaptic pMad accumulation (Sulkowski, 2013).
At the Drosophila NMJ, Gbb is secreted in the synaptic cleft from both pre- and postsynaptic compartments. The secretion of Gbb is regulated at multiple levels, transcriptionally and post-translationally. Furthermore, the Gbb prodomain could be processed at several cleavage sites to generate Gbb ligands with varying activities. The longer, more active Gbb ligand retains a portion of the prodomain that could influence the formation of Gbb/BMP receptor complexes. Synaptic pMad may result from signaling by selective forms of Gbb. Or type-A receptors could modulate secretion and processing of Gbb in an activity-dependent manner. Understanding the function of different pools and active forms of Gbb within the synaptic cleft will help explain the multiple roles for Gbb at Drosophila NMJs (Sulkowski, 2013).
Alternatively, active postsynaptic type-A receptor complexes may directly engage and stabilize presynaptic Gbb/BMP receptor signaling complexes via trans-synaptic interactions. CUB domains can directly bind BMPs; thus Neto may utilize its extracellular CUB domains to engage Gbb and/or presynaptic BMP receptors. As synaptic pMad mirrors active type-A receptors, such trans-synaptic complexes will depend on Neto in complexes with active type-A receptors. No capture has yet been shown of a direct interaction between Gbb and Neto CUB domains in co-immunoprecipitation experiments. Nonetheless, a trans-synaptic complex that depends on the activity of type-A receptors could offer a versatile means for relaying synapse activity status to the presynaptic neuron via fast assembly and disassembly (Sulkowski, 2013).
Irrespective of the strategy that correlates synaptic pMad pool with the active type-A receptor/Neto complexes, further mechanisms must act to maintain the Gbb/BMP receptor complexes at synapses and protect them from endocytosis and retrograde transport. Such mechanisms must be specific, as general modulators of BMP receptors endocytosis impact both synaptic and nuclear pMad. A candidate for differential control of BMP/receptor complexes is Importin-β11. Loss of synaptic pMad in importin-β11 is rescued by neuronal expression of activated BMP receptors, by blocking retrograde transport, but not by neuronal expression of Mad. As Mad does not appear to traffic, presynaptic Importin-β11 must act upstream of the BMP receptors, perhaps to stabilize active Gbb/BMP receptor complexes at the neuron membrane. By contrast, local pMad cannot be restored at Neto-deprived NMJs by overactivation of presynaptic BMP receptors or by blocking retrograde transport. As neto and gbb interact genetically, it is tempting to speculate that postsynaptic Neto/type-A complexes localize Gbb activities and stabilize Gbb/BMP receptor complexes from the extracellular side. Additional extracellular factors, for example heparan proteoglycans, or intracellular modulators, such as Nemo kinase, may control the distribution of sticky Gbb molecules within the synaptic cleft and their binding to BMP receptors, or may stabilize Gbb/BMP receptor complexes at synaptic termini (Sulkowski, 2013).
Synaptic pMad may act locally and/or in coordination with the transcriptional control of BMP target genes to ensure proper growth and development of the synaptic structures. A presynaptic pool of pMad maintained by Importin-β11 neuronal activities ensures normal NMJ structure and function. Like importin-β11, GluRIIA and Neto-deprived synapses show a significantly reduced number of boutons. Intriguingly, the absence of GluRIIA induces up to 20% reduction in bouton numbers, whereas knockdown of GluRIIB does not appear to affect NMJ growth. Although the amplitude of the growth phenotypes observed in normal culturing conditions (25°C) was modest, this phenomenon may explain the requirement for GluRIIA reported for activity-dependent NMJ development (at 29°C). Furthermore, knockdown of Neto or any iGluR essential subunit affect synaptic pMad and NMJ growth in a dose-dependent manner. Not significant changes were found in nuclear pMad or expression of BMP target genes in GluRIIA or Neto-deprived animals, but the restoration of synaptic pMad by presynaptic constitutively active BMP receptors rescues the morphology and physiology of importin-β11 mutant NMJs. The smaller NMJs observed in the absence of local pMad may reflect a direct contribution of synaptic pMad to retrograde BMP signaling, a pathway that provides an instructive signal for NMJ growth. Thus, BMP signaling may integrate synapse activity status with the control of synapse growth (Sulkowski, 2013).
Synaptic pMad may also contribute to synapse stability. Mutants in BMP signaling pathway have an increased number of 'synaptic footprints': regions of the NMJ where the terminal nerve once resided and has retracted. It has been proposed that Gbb binding to its receptors activates the Williams Syndrome-associated Kinase LIMK1 to stabilize the NMJ. Synaptic pMad may further contribute to the stabilization of synapse contacts by engaging in interactions that anchor the Gbb/BMP receptor complexes at synaptic termini. During neural tube closure, local pSmad1/5/8 mediates stabilization of BMP signaling complexes at tight junction via binding to apical polarity complexes. Flies may utilize a similar anchor mechanism that relies on pMad-mediated interactions for stabilizing BMP signaling complexes and other components at synaptic junctions. Local active BMP signaling complexes are thought to function in this manner in the maintenance of stemness and in epithelial-to-mesenchymal transition (Sulkowski, 2013).
Separate from its role in synapse growth and stability, BMP signaling is required presynaptically to maintain the competence of motoneurons to express homeostatic plasticity. The requirements for BMP signaling components for the rapid induction of presynaptic response may include a role for synaptic pMad in relaying acute perturbations of postsynaptic receptor function to the presynaptic compartment. At the very least, attenuation of local pMad signals, when postsynaptic type-A receptors are lost or inactive, may release local Gbb/BMP receptor complexes and allow them to traffic to neuron soma and increase the BMP transcriptional response, promoting expression of presynaptic components and neurotransmitter release. In addition, synaptic pMad-dependent complexes may influence the composition and/or activity of postsynaptic glutamate receptors. Although future experiments will be needed to address the nature and function of local pMad-containing complexes, the current findings clearly demonstrate that synaptic pMad constitutes an exquisite monitor of synapse activity status, which has the potential to relay information about synapse activity to both pre- and postsynaptic compartments and contribute to synaptic plasticity. As BMP signaling plays a crucial role in synaptic growth and homeostasis at the Drosophila NMJ, the use of synaptic pMad as a sensor for synapse activity may enable the BMP signaling pathway to monitor synapse activity then function to adjust synaptic growth and stability during development and homeostasis (Sulkowski, 2013).
The Drosophila neuromuscular junction (NMJ) is capable of rapidly budding new presynaptic varicosities over the course of minutes in response to elevated neuronal activity. Using live imaging of synaptic growth, this dynamic process was characterized, and it was demonstrated that rapid bouton budding requires retrograde bone morphogenic protein (BMP) signaling and local alteration in the presynaptic actin cytoskeleton. BMP acts during development to provide competence for rapid synaptic growth by regulating the levels of the Rho-type guanine nucleotide exchange factor Trio, a transcriptional output of BMP-Smad signaling. In a parallel pathway, it was found that the BMP type II receptor Wit signals through the effector protein LIM domain kinase 1 (Limk) to regulate bouton budding. Limk interfaces with structural plasticity by controlling the activity of the actin depolymerizing protein Cofilin. Expression of constitutively active or inactive Cofilin (Twinstar) in motor neurons demonstrates that increased Cofilin activity promotes rapid bouton formation in response to elevated synaptic activity. Correspondingly, the overexpression of Limk, which inhibits Cofilin, inhibits bouton budding. Live imaging of the presynaptic F-actin cytoskeleton reveals that activity-dependent bouton addition is accompanied by the formation of new F-actin puncta at sites of synaptic growth. Pharmacological disruption of actin turnover inhibits bouton budding, indicating that local changes in the actin cytoskeleton at pre-existing boutons precede new budding events. It is proposed that developmental BMP signaling potentiates NMJs for rapid activity-dependent structural plasticity that is achieved by muscle release of retrograde signals that regulate local presynaptic actin cytoskeletal dynamics (Piccioli, 2014).
Activity-dependent changes in synaptic structure play an important role in developmental wiring of the nervous system. The Drosophila larval neuromuscular junction (NMJ) has emerged as a model glutamatergic synapse that is well suited to study activity-dependent structural plasticity. The NMJ can be imaged in vivo during developmental periods of rapid synaptic growth when the axonal terminal expands ~5- to 10-fold in size over 5 d. Forward genetic screens to identify mutations that alter synaptic growth have revealed essential roles for retrograde bone morphogenic protein (BMP) signaling mediated by the secreted ligand Glass bottom boat (Gbb). Mutations that disrupt BMP signaling lead to synaptic undergrowth and neurotransmitter release defects. Multiple pathways downstream of retrograde BMP signaling through the type II receptor Wishful thinking (Wit) have been linked to synaptic growth, synapse stability, and homeostatic plasticity in Drosophila. BMP signaling via the Smad transcription factor Mothers against Dpp (Mad) regulates the expression of the Rho-type guanine nucleotide exchange factor (GEF) trio to control normal synaptic growth. Wit also interacts with LIM domain kinase 1 (Limk) to enhance synaptic stabilization in a pathway parallel to canonical Smad-dependent signaling. BMP signaling through Wit also potentiates synapses for homeostatic plasticity in a pathway that is independent of limk and synaptic growth regulation (Piccioli, 2014).
The NMJ displays acute structural plasticity in the form of rapid presynaptic bouton budding in response to elevated levels of neuronal activity. These rapidly generated presynaptic varicosities, referred to as ghost boutons, lack presynaptic and postsynaptic transmission machinery when initially formed. The budding of ghost boutons requires retrograde signaling mediated by the postsynaptic Ca2+-sensitive vesicle trafficking regulator synaptotagmin (Syt) 4 (Korkut, 2013). Syt4 also participates in developmental synaptic growth and controls retrograde signaling that mediates enhanced spontaneous release at the NMJ (Yoshihara, 2005; Barber, 2009). Beyond the role of Syt4 in ghost bouton budding, little is known about the signaling pathways that underlie this rapid form of structural synaptic plasticity. In particular, it is unclear whether pathways that regulate synaptic growth over the longer time scales of larval development also trigger acute structural plasticity. To address these issues, this study identified synaptic pathways that are required for rapid structural plasticity at Drosophila NMJs. Ghost bouton budding was found to be locally regulated at the synapse level, occurring in axons that have been severed from the neuronal cell body. In addition, activity-induced ghost bouton formation requires Syt1-mediated neurotransmitter release and postsynaptic glutamate receptor function. Like developmental growth, retrograde BMP signaling is required for ghost bouton budding. BMP signaling functions through a permissive role mediated by developmental Smad and Trio signaling, as well as through a local Wit-dependent modulation of Limk and Cofilin (Twinstar) activity that alters presynaptic actin dynamics (Piccioli, 2014).
Experimental analysis of ghost bouton budding at the Drosophila NMJ indicates that rapid activity-dependent synaptic growth requires retrograde BMP signaling at this synapse. The current data support a model in which BMP signaling through the type II receptor Wit is required developmentally to potentiate synapses for budding in response to elevated synaptic activity. This pathway requires Smad-dependent expression of the Rho-type GEF trio, and parallels a requirement for BMP signaling and Trio in developmental synaptic growth that occurs during the larval stages. In a parallel pathway, Wit interaction with Limk inhibits bouton budding through regulation of Cofilin activity. Both pathways regulate the synaptic actin cytoskeleton and may converge on similar actin regulatory molecules such as Limk and Cofilin via Rac1 or RhoA. Manipulating Cofilin activity levels by the overexpression of Limk or the expression of constitutively active/inactive Cofilin demonstrates that high Cofilin activity favors bouton budding, while low Cofilin activity inhibits budding. Local changes in the actin cytoskeleton that accompany activity-dependent bouton budding were also observed at sites of new synaptic growth. In addition, pharmacological disruption of normal actin turnover inhibits budding, suggesting that increased actin turnover mediated by Cofilin potentiates rapid activity-dependent synaptic plasticity (Piccioli, 2014).
Multiple genetic perturbations of BMP signaling were identified that altered the frequency of activity-dependent bouton budding at the NMJ. Although several of these mechanisms are shared with those previously characterized to control BMP-mediated developmental synaptic growth, several manipulations separated rapid activity-dependent BMP-mediated bouton budding from the slower forms of developmental growth. In the case of wit mutants or motor neuron overexpression of dad, a reduction in baseline bouton number was observed that showed varying degrees of severity. Wit mutants displayed strongly undergrown synapses, while dad overexpression animals had only modest synaptic undergrowth. In contrast, both these manipulations strongly suppressed ghost bouton budding. Additionally, synaptic undergrowth with partial knockdown of Gbb using postsynaptic RNAi was not observed, while this manipulation caused a strong reduction in ghost bouton budding. These observations indicate that rapid ghost bouton budding is more sensitive to modest perturbations in BMP signaling compared with developmental synaptic growth. One explanation for this differential sensitivity is that BMP signaling potentiates NMJs for activity-dependent bouton budding via transcriptional regulation of molecular components that are not required for normal synaptic growth. Alternatively, similar molecular pathways are required, but at different levels of output. In particular, trio mutants display a less severe synaptic undergrowth phenotype than wit mutants, but show similarly severe defects in ghost bouton budding. Because trio expression is strongly dependent on BMP signaling (Ball, 2010), a modest reduction in BMP output could reduce Trio levels such that ghost bouton budding is significantly reduced, while normal synaptic growth is less affected. It will be interesting to determine in future studies whether the developmental role for BMP signaling for acute structural plasticity shares a critical period as has recently been found for BMP function during developmental synaptic growth (Piccioli, 2014).
Given the requirement of the postsynaptic Ca2+ sensor Syt4 for normal levels of ghost bouton budding, an attractive model is that BMP is released acutely in response to elevated activity through the fusion of Syt4-positive postsynaptic vesicles. However, the current analysis indicates that retrograde BMP signaling through trio transcriptional upregulation is unlikely to be an instructive cue for bouton budding, as the severing of axons and the inhibition of retrograde trafficking of P-Mad before stimulation does not reduce budding in response to elevated activity. It is possible that synaptic P-Mad may play an instructional role in ghost bouton budding, as a local decrease in budding frequency was observed when Gbb expression was specifically reduced in muscle 6. Neuronal overexpression of dad also reduced synaptic P-Mad. Therefore, dad overexpression could inhibit ghost bouton budding by decreasing synaptic P-Mad signaling, in addition to decreasing nuclear Smad signaling. However, no dosage-dependent genetic interactions were observed between syt4 and wit, suggesting that Syt4 may participate in a separate pathway to regulate ghost bouton budding. Activity-dependent fusion of Syt4 postsynaptic vesicles (Yoshihara, 2005) could release a separate unidentified retrograde signal that provides an instructive cue for budding that would function in parallel to a developmental requirement for retrograde BMP signaling (Piccioli, 2014).
In addition to instructive cues from the postsynaptic compartment that trigger ghost bouton budding, the presynaptic nerve terminal must have molecular machines in place to read out these signals and execute the budding event. The regulation of Rho GTPases via Rho GEFs and GAPs downstream of extracellular cues is an attractive mechanism, as these proteins play critical roles in the regulation of neuronal morphology and axonal guidance. Several studies have shown that retrograde synaptic signaling regulates Rho GTPase activity to alter synaptic function and growth in Drosophila (Tolias, 2011). Ghost bouton budding mediated by developmental BMP signaling also shares some similarities with mechanisms underlying homeostatic plasticity at Drosophila NMJs. The Eph receptor is required for synaptic homeostasis at the NMJ, and it interfaces with developmental BMP signaling via Wit. While Eph receptor-mediated homeostatic plasticity predominantly requires the downstream RhoA-type GEF Ephexin, the Eph receptor may also signal through Rac1. Drosophila VAP-33A may also act as a ligand for synaptic Eph receptors, as it has been shown to regulate NMJ morphology and growth, while preferentially localizing to sites of bouton budding. The current analysis indicates that the levels of Trio, which functions as a Rho-type GEF, are bidirectionally correlated with ghost bouton budding activity and that overexpressed Trio is localized to ghost boutons after budding. As such, acute Trio regulation represents another attractive pathway for rapidly modifying bouton budding activity (Piccioli, 2014).
Rho GTPase signaling can produce distinct effects in differing systems and cell types depending on the presence or absence of downstream effectors, although most of these pathways ultimately impinge on regulation of the actin cytoskeletal. Indeed, this study has found a key role for Limk regulation of Cofilin activity in the control of ghost bouton budding. The current findings indicate that Limk activity normally functions to inhibit the formation of ghost boutons, as neuronal overexpression of Limk strongly suppressed activity-dependent bouton budding. Consistent with an inhibitory role for Limk, Cofilin activity promotes budding, while the overexpression of an inactive Cofilin inhibited budding. The expression of mutant Cofilin transgenes resulted in visible changes to the presynaptic actin cytoskeleton at NMJs, indicating that these manipulations likely alter rapid budding events by changing local actin dynamics at sites of potential growth. Using live imaging of F-actin dynamics before and after bouton budding, the formation of new F-actin puncta was observed at sites of bouton budding. Elevated Cofilin activity is sufficient to increase ghost bouton budding frequency, and is predicted to increase actin turnover and the formation of F-actin structures. Pharmacological disruption of actin polymerization dynamics also disrupts rapid bouton addition in response to elevated activity (Piccioli, 2014).
These findings support a model whereby Wit has opposing signaling roles with respect to bouton budding. Providing a permissive role via Smad signaling and an inhibitory role via Limk activation may provide for a system in which increased potential for rapid synaptic expansion is directly coupled to enhanced synaptic stability. This coupling could set a threshold for ghost bouton budding downstream of synaptic activity. In the background of moderate or low synaptic activity, Limk prevents ghost bouton budding. When synaptic activity is elevated, additional signaling events promote new synaptic growth by either reducing or outcompeting Limk activity, with a concurrent activation of Cofilin. Decreased Limk activity downstream of extracellular cues has been shown to regulate cell morphology in other systems as well, providing an attractive mechanism for rapid activity-dependent regulation of synaptic structure at Drosophila NMJs (Piccioli, 2014).
Stem cells reside in specialised microenvironments, or niches, which often contain support cells that control stem cell maintenance and proliferation. Hedgehog (Hh) proteins mediate homeostasis in several adult niches, but a detailed understanding of Hh signalling in stem cell regulation is lacking. Studying the Drosophila female germline stem cell (GSC) niche, this study shows that Hh acts as a critical juxtacrine signal to maintain the normal GSC population of the ovary. Hh production in cap cells, a type of niche support cells, is regulated by the Engrailed transcription factor. Hh is then secreted to a second, adjacent population of niche cells, the escort cells, where it activates transcription of the GSC essential factors Decapentaplegic (Dpp) and Glass bottom boat (Gbb). In wild-type niches, Hh protein decorates short filopodia that originate in the support cap cells and that are functionally relevant, as they are required to transduce the Hh pathway in the escort cells and to maintain a normal population of GSCs. These filopodia, reminiscent of wing disc cytonemes, grow several fold in length if Hh signalling is impaired within the niche. Because these long cytonemes project directionally towards the signalling-deficient region, cap cells sense and react to the strength of Hh pathway transduction in the niche. Thus, the GSC niche responds to insufficient Hh signalling by increasing the range of Hh spreading. Although the signal(s) perceived by the cap cells and the receptor(s) involved are still unknown, these results emphasize the integration of signals necessary to maintain a functional niche and the plasticity of cellular niches to respond to challenging physiological conditions (Rojas-Ríos, 2012). The study of the mechanisms behind Hh signalling in the Drosophila ovary has allowed the identification of Hh-coated cytonemes in a cellular stem cell niche, emphasizing the idea that cytonemes mediate spreading of the activating signal from the producing cells. Recently, it has been reported that the Hh protein localises to long, basal cellular extensions in the wing disk (Callejo, 2011). In addition, filopodial extensions in the wing, eye, and tracheal system of Drosophila have been shown to segregate signalling receptors on their surface, thus restricting the activation of signalling pathways in receiving cells (Roy, 2011). Hence, cytonemes, as conduits for signalling proteins, may be extended by receiving cells (and so are involved in uptake) or may be extended by producing cells (and so are involved in delivery and release) (Rojas-Rííos, 2012). Interfering with actin polymerisation in adult niches leads to a significant reduction in the number of cap cells (CpCs) growing Hh cytonemes, concomitant with precocious stem cell differentiation, demonstrating that these actin-rich structures are required to prevent stem cell loss and thus are functionally relevant. Importantly, because this study disturbed actin dynamics in post-mitotic CpCs that still produce wild-type levels of Hh protein and express CpC markers (but fail to activate the Hh pathway in ECs), the observed effects on stem cell maintenance are most likely specific to Hh delivery from CpCs to their target ECs via short cytonemes. This interpretation is further reinforced by the observation that CpCs can sense decreased Hh levels and/or a dysfunction in the transduction of the Hh pathway in the niche and respond to it by growing Hh-rich membrane bridges up to 6-fold longer than in controls. In this regard, it is interesting to note that the two lipid modifications found in mature Hh protein act as membrane anchors and give secreted Hh a high affinity for membranes and signalling capacities. In fact, it has been recently described that a lipid-unmodified form of Hh unable to signal does not decorate filopodia-like structures in the wing imaginal disc epithelium, confirming the link between Hh transport along cytonemes and Hh signalling (Callejo, 2011). Thus, cytonemes may ensure specific targeting of the Hh ligand to the receiving germline cells in a context of intense signalling between niche cells and the GSCs. Interestingly, in both en- and smo- mosaic niches, the long processes projected towards the signalling-deficient area of the niche, which showed that competent CpCs sense the strength of Hh signalling activity in the microenvironment. While the nature of the signal perceived by the CpCs or the receptor(s) involved in the process are unknown, it is postulated that Hh-decorated filopodial extensions represent the cellular synapsis required for signal transmission that is established between the Hh-producing cells (the CpCs) and the Hh-receiving cells (the ECs). In this scenario (and because Ptc, the Hh receptor, is a target of the pathway) the membranes of mutant ECs, in which the transduction of the pathway is compromised, contain lower Ptc levels. Thus, longer and perhaps more stable projections ought to be produced to allow proper signalling. In addition, the larger the number of en mutant cells (and hence the stronger the deficit in Hh ligand concentration or target gene regulation), the longer the cellular projections decorated with Hh, which indicates that the niche response is graded depending on the degree of signalling shortage (Rojas-Ríos, 2012). Do the longer cytonemes found in mosaic germaria represent structures created de novo, or do they simply reflect a pre-existing meshwork of thin intercellular bridges that can regulate the amount of Hh protein in transit across them? Because an anti-Hh antibody was utilised to detect the cytonemes and all attempts to identify other markers for these structures have failed, it is not possible to discriminate between these two possibilities. In any case, since no increased was detected in Hh levels in wild-type CpCs that contained cytonemes relative to those that did not, it is clear that long filopodia do not arise solely by augmenting Hh production in the CpCs. Rather, if long cytonemes are not synthesised in response to a Hh signalling shortage and if they already existed in the niche, they ought to restrict Hh spreading independently of significant Hh production. Furthermore, because the strength of Hh signalling in the niche determines the distance of Hh spreading, either cytoneme growth or Hh transport (or both) are regulated by the ability of the CpCs to sense the Hh signalling output (Rojas-Ríos, 2012). The demonstration that a challenged GSC niche can respond to insufficient signalling by the cytoneme-mediated delivery of the stem cell survival factor Hh over long distances has wider implications. Niche cells have been shown to send cellular processes to their supporting stem cells in several other scenarios: the Drosophila ECs of the ovary and the lymph gland, the ovarian niche of earwigs, and the germline mitotic region in the hermaphrodite Caenorhabditis elegans. Similarly, wing and eye disc cells project cytonemes to the signalling centre of the disc. However, definitive proof that the thin filopodia described in the lymph gland, the earwig ovary, or imaginal discs deliver signals from the producing to the effector cells is lacking. The current findings strongly suggest that cytonemes have a role in transmitting niche signals over distance, a feature that may underlie the characteristic response of more complex stem cell niches to challenging physiological conditions. Careful analysis of the architecture of sophisticated niches, such as the bone marrow trabecular zone for mouse haematopoietic stem cells, will be needed to further test this hypothesis and to determine whether it represents a conserved mechanism for stem cell niche signalling (Rojas-Ríos, 2012).
Meiotic mapping and complementation tests have established seven complementation groups for the enhancers. New alleles of tkv, Mad, Medea and punt have been recovered. Of the five Mad alleles, three have point mutations in the coding region. Missense mutations were found in both new punt alleles. The tkv D17 and Med D5 allelism is based on genetic non-complementation. A tkv transgene rescues the lethality of tkv D17 homozygotes, supporting the view that D17 is a tkv allele. Genetic and molecular characterizations of the D4 complementation group reveal that it corresponds to the Tgfbeta-60A gene. Tgfbeta-60A encodes a BMP-7 homolog, isolated on the basis of its sequence homology. Its function has been unknown due to the lack of mutations in Tgfbeta-60A. Three alleles of Tgfbeta-60A were confirmed by sequencing the mutant alleles. 60A D8 and 60A D20 are nonsense mutations in
the prodomain due to single nucleotide substitutions. 60A D4
has one nucleotide deletion, causing a frame-shift premature stop in the prodomain (Chen, 1998).
Previous studies have established Dpps role as a morphogen in
patterning the embryonic ectoderm. dpp signaling is also required
for dorsal closure of the embryonic ectoderm. How, if at all, does
the level of Tgfbeta-60A affect the phenotype of the embryonic
ectoderm? The cuticle phenotypes of single and double
mutants were compared. Since tkv 6 homozygotes are viable and Tgfbeta-60A mutants show no obvious defects until late in development, the cuticular
patterns of these mutants are essentially normal.
However, tkv 6 Tgfbeta-60A homozygote embryos die and exhibit
head defects and an excessive ventral curvature.
Although the double mutant cuticles bear some resemblance
to hypomorphic dpp mutants, they do not exhibit an obvious
expansion of the ventral denticle belts. However, the double mutant phenotype suggests that when
dpp signaling is compromised in the embryonic ectoderm,
removing Tgfbeta-60A activity further attenuates dpp signaling. The relatively mild phenotype of the double mutant embryo might reflect partial rescue by the maternal
contribution of wild-type Tkv receptors. Indeed, a quarter of the
embryos produced by mothers homozygous for tkv 6 and
heterozygous for Tgfbeta-60A exhibit a dorsal open phenotype
similar to that of zygotic tkv null embryos. Therefore, in the absence of maternally provided
wild-type Tkv, tkv 6 Tgfbeta-60A double mutant embryos exhibit a
phenotype indicative of defective dpp signaling during the
process of dorsal closure (Chen, 1998).
These results provide the first in vivo evidence for the involvement of Tgfbeta-60A in the dpp pathway. It is proposed that Tgfbeta-60A activity is required to maintain the optimal signaling capacity of the dpp pathway,
possibly by forming biologically active heterodimers with Dpp proteins (Chen, 1998).
Reported assays of the bone morphogenetic proteins (BMPs) have not, in general, revealed specific functions for the
different proteins, belying the specificity implied by the evolutionary conservation and distinct expression patterns of
the genes encoding BMPs. Assays of developmental function have been used to show that the two Drosophila
homologs of the BMPs, Decapentaplegic (Dpp) and Tgfbeta-60A, which both induce ectopic bone formation in mammalian
assay systems, have distinct effects in Drosophila development. A binary expression system using the yeast
transcriptional activator GAL4 directed identical patterns of tissue and temporally specific dpp and Tgfbeta-60A expression.
When dpp enhancer elements drive GAL4 expression, GAL4-responsive dpp transgenes rescue dpp mutant
phenotypes, but GAL4-responsive Tgfbeta-60A transgenes do not. Ectopic ectodermal expression of dpp during gastrulation
respecifies the dorsal/ventral pattern of the embryo. In contrast, ectopic Tgfbeta-60A expression had no detectable effect on
embryonic development but leads to defects in adult structures or lethality during metamorphosis. Expression of Tgfbeta-60A in
cells expressing dpp does not interfere with dpp functions, indicating that dysfunctional heterodimers do not form at
sufficient levels to inhibit Dpp. These specific developmental responses in Drosophila indicate that in vivo functions of
BMP-like factors can be more specific than indicated by the ectopic bone formation assays and that the Drosophila
embryo provides an assay system sensitive to the structural differences that contribute to BMP specificity in vivo (Staehling-Hampton, 1994).
Multiple BMPs are required for growth and patterning of the Drosophila wing. The Drosophila BMP gene, Tgfbeta-60A, exhibits a requirement in wing morphogenesis distinct from that shown previously for dpp. Tgfbeta-60A mutants exhibit a loss of pattern elements in the wing, particularly those derived from cells in the posterior compartment, consistent with the Tgfbeta-60A mRNA and protein expression pattern. Individuals homozygous for null alleles of the Tgfbeta-60A gene, exhibit embryonic defects in gut morphogenesis and result in early larval lethality. Allelic combinations between a hypomorphic 60A allele and a null allele or a deficiency deleting the 60A locus (hypomorph/deletion) result in later larval lethality with only rare adult escapers (<1%). Third instar larvae of such a genotype appear transparent and smaller than wild-type larvae. These larvae develop more slowly than wild type and never attain wild-type size. The transparency appears to be due to a defect in both the quantity and quality of the fat body, as well as a dramatic reduction in imaginal tissues. In addition to a reduction in imaginal disc tissue, other tissues that normally proliferate during larval development, such as areas of the brain, are also reduced. The 60A locus has been named glass bottom boat (gbb) in light of the remarkable transparency of the mutant larvae, but here it will be referred to as Tgfbeta-60A. The rare adult escapers of the hypomorph/deletion exhibit small misshapen wings, which lack the posterior cross vein (PCV), much of longitudinal vein L5, distal portions of L4 and the posterior half of the anterior cross vein (ACV). The mutant wings are small, narrow and pointed, with a loss of intervein material, especially between veins L2/L3, L4/L5 and posterior to L5. In addition to the change in wing shape and the loss of veins, a thinning of vein L2 and some ectopic vein material in the intervein region flanking L2 is common. No abnormalities were found along the margin in the position or type of wing margin bristles, however, ectopic margin bristles were often seen along a vein or in intervein tissue in the distal regions of the wing. Defects in these mutant flies are not limited to the wings: a reduction in the size of the eye, with the presence of supernumerary vibrissae, an increase in the number of thoracic bristles, the presence of misshapen leg segments and female sterility have all been observed. The mutant wing phenotype of homozygous hypomorph adult is similar to, but less severe than, that observed for the rarer hypomorph/deletion adults. In homozygote hypomorphs, the overall shape of the wing is broader and less pointed, more like wild type. The ACV is often complete and longitudinal veins L4 and L5 are longer (Khalsa, 1998).
Given that homozygote hypomorphs retain some Tgfbeta-60A function, the affect of complete loss of Tgfbeta-60A function on wing patterning and morphogenesis was studied through the production of null clones. Tgfbeta-60A null clones are never recovered in the adult wing if induced during the early period of cell proliferation (before 36 hours AEL); however, clones in all parts of the wing were recovered from later inductions. Clones located in both the anterior and posterior compartments, as well as clones limited to the posterior compartment, exhibit defects in the same pattern elements affected in hypomorphic wings: loss of the PCV, and portions of L5 and L4. Clones strictly limited to the anterior compartment or along the A/P boundary exhibited no wing defects with the exception of very small clones that were located near the ACV. These clones resulted in ectopic vein material anterior to L3. In several wings vein loss was observed in wild-type tissue at a distance from the Tgfbeta-60A-patch. In each case that this non-autonomous effect was found, multiple clones were present in the wing, one in the posterior compartment and another along the A/P boundary, sites that otherwise did not produce abnormalities. This type of vein loss was never observed in the generation of control clones (Khalsa, 1998).
The expression of Tgfbeta-60A in imaginal discs was examined by both whole-mount RNA in situ hybridizations and antibody staining using a Tgfbeta-60A antibody. Tgfbeta-60A mRNA is expressed in the wing disc mainly in the posterior compartment in the pteropleural and medial regions extending into the progenitors of the scutellum. High levels are found within the wing pouch in cells belonging to both the posterior and anterior compartments, with higher levels in the posterior. A small amount of expression is found within the hinge region. In the eye/antennal disc, Tgfbeta-60A mRNA is highest anterior to the morphogenetic furrow and in the medial regions, with lower levels of expression posterior to the morphogenetic furrow. Tgfbeta-60A is expressed throughout the posterior compartment of the leg imaginal discs and within the ventral anterior compartment. Tgfbeta-60A protein is generally detected at locations coincident with Tgfbeta-60A mRNA with one major exception: the presence of a stripe of markedly lower Tgfbeta-60A protein running through the middle of the wing pouch. This stripe of reduced expression is coincident with the prominent stripe of dpp RNA expression in the cells anterior to the anterior/posterior (A/P) boundary of the wing imaginal disc. A weak but consistent reduction in Tgfbeta-60A expression is observed along the dorsal/ventral boundary from which the cells of the wing margin are derived. High levels of Tgfbeta-60A expression exists in a pattern complementary to the localized expression of dpp in the other imaginal discs as well. For example, Tgfbeta-60A expression is absent or at very low levels in the morphogenetic furrow of the eye disc, the site of dpp expression. In addition, the regions of low or absent Tgfbeta-60A expression in the antennal and leg imaginal discs are the sites of dpp expression (Khalsa, 1998).
The structures in the wing that are affected most dramatically by mutations in Tgfbeta-60A, the PCV and L5, are those that are least sensitive to the reduction or absence of dpp. The ACV and longitudinal veins L2 and L4, lying on either side of the A/P boundary, have been shown to be most sensitive to the loss of Dpp signaling, consistent with the proposal that Dpp organizes wing pattern via a morphogen gradient emanating from the A/P boundary. (It has been proposed that longitudinal vein L3 is fated by a different mechanism and as a result is not sensitive to the level of Dpp signaling). Since mutations in the Tgfbeta-60A locus indicate that Tgfbeta-60A is essential for establishing cell identity in the wing, especially within the posterior compartment, the possibility was investigated that Tgfbeta-60A and Dpp signal together to provide positional information for the entire wing. No dominant genetic interactions are observed between alleles of Tgfbeta-60A and dpp, therefore, recombinant chromosomes were constructed using alleles of dpp that result in an overall lowering of dpp expression in the imaginal discs. Individuals heterozygous for such hypomorphic dpp alleles are phenotypically wild type. As homozygotes or in various heteroallelic combinations, these dpp alleles can be lethal or can generate adults with appendage defects ranging from minor loss of vein material to truncations of the entire appendage. An individual heterozygous for a hypomorphic dpp allele and homozygous or transheterozygous for Tgfbeta-60A alleles exhibits wing phenotypes qualitatively different from those observed in the Tgfbeta-60A mutant alone. Tgfbeta-60A mutants heterozygous for a dpp hypomorphic allele exhibit a significant loss of L4 (>60% lack more than half of L4) and a more frequent loss of the ACV. Tgfbeta-60A mutants heterozygous for a more severe dpp allele, not only show a greater loss of L4, ACV and L2 vein material (>90% lack more than half of L4 and 100% lack the entire ACV including a thinning of L2), but also a loss of intervein tissue, especially between L2/L3 and L4/L5, as exhibited by a reduction in the overall size of the wing. In addition to defects in wing patterning, abnormalities were noted in the proximal/distal organization of the legs, a process in which dpp is known to play a central role. The common defects exhibited by the Tgfbeta-60A mutants combined with dpp hypomorphic alleles are truncations and/or apparent fusions of the distal most tarsal segments of the male prothoracic leg. These data indicate that heteroallelic combinations of Tgfbeta-60A and dpp result in phenotypes more pronounced and distinct from phenotypes observed as a result of mutations in either gene alone. These new phenotypes are not simply additive. Individual pattern elements are affected differently as a result of these heteroallelic combinations, for example, a greater loss of L4 is seen while the loss of L5 is reduced. These results suggest that the requirement for both dpp and Tgfbeta-60A in earlier stages of larval development, presumably at times of high cell proliferation, is not met in such complex genotypes. Yet the suppression of the ACV defect indicates that Tgfbeta-60A does not solely act to modulate levels of Dpp signaling; rather, as the ratio of Tgfbeta-60A to dpp changes across the wing imaginal disc, the specification of a pattern element is affected. Different relative levels of Tgfbeta-60A to Dpp signaling would result in different positional information. The readout may be either synergistic or antagonistic, depending on the particular positional point within the developing wing (Khalsa, 1998).
Tgfbeta-60A alleles have been shown to genetically interact with mutations in BMP type I receptor genes, tkv and sax. The Dpp signal is mediated by two different BMP type I receptors, Tkv and Sax, during wing morphogenesis as well as during other stages of development The possibility of a genetic interaction between alleles of Tgfbeta-60A and alleles of tkv or sax was investigated to address the relative importance of these receptors in mediating the signals resulting from the actions of Tgfbeta-60A and Dpp. Recombinants were constructed between gbb-60A 4 or gbb-60A 1 and several alleles of tkv and sax. The addition into a Tgfbeta-60A mutant background of a chromosomal deficiency that removes the tkv locus, results in a severe mutant wing phenotype with a dramatic loss of both the PCV and ACV and most of L4 and L5. In addition, distal gaps are present in L2 and L3. A less extreme phenotype is seen with tkv6, a hypomorphic allele that retains significant receptor function. The observed interaction between tkv and Tgfbeta-60A cannot be explained solely as a secondary consequence of lowering Dpp signaling readout by the mutation of a receptor that mediates Dpp signaling. These data suggest that Tkv is able to mediate Tgfbeta-60A signaling and that it may do so in different ways at different times during development. The effect of reducing the Tgfbeta-60A copy number was investigated in flies compromised for functional Tkv receptor. Reducing Tgfbeta-60A in a tkv mutant background produces a further thickening of wing veins. This result suggests that Tgfbeta-60A may play a role in vein differentiation itself and/or in the tkv/dpp feedback loop important in defining the boundaries of the vein. Genetic combinations used to investigate the potential interaction between Tgfbeta-60A and sax alleles indicate a reduction in viability for Tgfbeta-60A mutant genotypes containing a single copy of a sax null allele. This reduction in viability suggests that lowering both Tgfbeta-60A and sax compromises development. The wing phenotype of the few viable adults recovered is similar to a very severe Tgfbeta-60A mutant wing phenotype, with a substantial loss of L5, complete loss of the PCV and ACV and loss of half of L4. Clearly the levels of Tgfbeta-60A signaling and Sax function are dependent on one another (Khalsa, 1998).
Based on genetic analysis and expression studies, it has been concluded that Tgfbeta-60A must signal primarily as a homodimer to provide patterning information in the wing imaginal disc. Tgfbeta-60A and dpp genetically interact and specific aspects of this interaction are synergistic while others are antagonistic. It is proposed that the positional information received by a cell at a particular location within the wing imaginal disc depends on the balance of Dpp to Tgfbeta-60A signaling. Furthermore, the critical ratio of Tgfbeta-60A to Dpp signaling appears to be mediated by both Tkv and Sax type I receptors (Khalsa, 1998).
In Drosophila wing discs, a morphogen gradient of Dpp has been proposed to be a determinant of the transcriptional response thresholds of the downstream genes sal and omb. Evidence is presented that the concentration of the type I receptor Tkv must be low to allow long-range Dpp diffusion. However, low Tkv receptor concentrations result in low signaling activity. To enhance signaling at low Dpp concentrations, a second ligand, Tgf-beta-60A, has been found to augment Dpp/Tkv activity. Tgf-beta-60A signals primarily through the type I receptor Sax, which synergistically enhances Tkv signaling and is required for proper Omb expression. Omb expression in wing discs is found to require synergistic signaling by multiple ligands and receptors to overcome the limitations imposed on Dpp morphogen function by receptor concentration levels (Haerry, 1998).
While the reduction of Tkv and Put activity affects the whole disc (Sal, Omb and growth), the expression of dominant negative Sax only affects the peripheral region of the disc (Omb and peripheral growth). If the dominant negative receptors function primarily by titrating Dpp, then it is curious why the overexpression phenotypes of dominant negative Sax are different. One possibility is that these receptors do not simply signal in response to Dpp but also in response to the binding of other ligands as well. Of the other two BMP-type ligands that have been described in Drosophila, scw shows no detectable expression at this stage. However, Tgf-beta-60A is expressed broadly in wing discs, and mutant analyses indicate that Tgf-beta-60A is required for normal wing development. Given its role in wing patterning, the effects of heteroallelic Tgf-beta-60A mutations were examined on Sal and Omb expression. Similar to discs expressing dominant negative Sax, Sal expression in Tgf-beta-60A mutant discs is normal while the Omb domain is reduced, particularly in the dorsal compartment. These observations are consistent with the notion that a second BMP-type ligand, Tgf-beta-60A, is required in addition to Dpp for proper Omb expression. Furthermore, the similarity of the Tgf-beta-60A loss-of-function and the dominant negative Sax phenotypes is consistent with recently described genetic interactions between Tgf-beta-60A and sax mutations and suggests that Tgf-beta-60A could signal in part through Sax (Haerry, 1998).
Ubiquitous overexpression of moderate levels of Tgf-beta-60A does not result in excessive disc overgrowth and does not alter the distribution of Sal and Omb. The resulting wings are slightly larger and exhibit minor venation defects along L2 and L5. However, similar to Dpp or TkvA, higher levels of Tgf-beta-60A overexpression expands both Sal and Omb and results in blistered and pigmented adult wings. Since only activated Tkv but not Sax is able to expand Sal and Omb expression, these findings are consistent with the notion that expression of moderate levels of Tgf-beta-60A leads to signaling preferentially through Sax, producing relative mild phenotypes, while higher concentrations of Tgf-beta-60A may also result in signaling through Tkv, producing phenotypes similar to activated Tkv (Haerry, 1998).
An investigation was carried out to determine if Tgf-beta-60A contributes to wing development primarily in the form of homodimers or Tgf-beta-60A/Dpp heterodimers. Results: (1) the level of Tgf-beta-60A mRNA appears to be significantly less than that of DPP, based on RNA in situ hybridization, indicating that heterodimers are not likely to be very abundant assuming similar translational efficiencies. (2) Localized overexpression of Tgf-beta-60A in the dpp-expressing cells does not result in any mutant phenotypes. (3) Expression of Tgf-beta-60A in the posterior compartment results in overgrowth, an expansion of the Sal and Omb domains, and restriction all adult wing defects exclusively to the posterior compartment. Since Tgf-beta-60A expression in this experiment does not overlap with Dpp-secreting cells, no Dpp/Tgf-beta-60A heterodimers should form, since heterodimer formation requires expression of both proteins in the same cell. Therefore, Tgf-beta-60A functions most likely as a homodimer. This finding is consistent with recent genetic analysis showing that clones of Tgf-beta-60A mutant cells that do not include dpp-expressing cells nevertheless produce patterning defects. It has been shown that dominant negative Tkv is more potent than Sax for inhibiting Dpp signaling, while dominant negative Sax is a stronger suppressor than Tkv of Tgf-beta-60A signaling. High levels of Tkv receptor limit Dpp diffusion and restrict Omb expression (Haerry, 1998).
The BMP receptor Wishful thinking (Wit) is required for synapse stabilization. In the absence of BMP signaling, synapse disassembly and retraction ensue. Remarkably, downstream Smad-mediated signaling cannot fully account for the stabilizing activity of the BMP receptor. LIM Kinase1 (DLIMK1)-dependent signaling has been identified as a second, parallel pathway that confers the added synapse-stabilizing activity of the BMP receptor. DLIMK1 binds a region of the Wit receptor that is necessary for synaptic stability but is dispensable for Smad-mediated synaptic growth. A genetic analysis demonstrates that DLIMK1 is necessary, presynaptically, for synapse stabilization, but is not necessary for normal synaptic growth or function. Furthermore, presynaptic expression of DLIMK1 in a wit or mad mutant significantly rescues synaptic stability, growth, and function. DLIMK1 localizes near synaptic microtubules and functions independently of ADF/cofilin (Twinstar), highlighting a novel requirement for DLIMK1 during synapse stabilization rather than actin-dependent axon outgrowth (Eaton, 2005).
The canonical bone morphogenic protein (BMP) signaling system has been implicated in diverse cellular and developmental processes ranging from cell growth to tissue patterning. At the Drosophila NMJ, a BMP signaling system has been identified that controls synaptic growth via canonical Smad-mediated signaling to the cell body. It has been demonstrated that mutations in the BMP ligand glass bottom boat (gbb), the type I and type II BMP receptors thick veins (tkv) and wishful thinking (wit), and the Smad homologs mad and medea all significantly impair synaptic growth and function. These data define a retrograde trophic signaling system that functions through transcriptional mechanisms in the cell soma to control motoneuron synaptic growth. This study demonstrates that BMP signaling at the Drosophila NMJ is not only required for normal synaptic growth, but also for synaptic stabilization. In the absence of BMP signaling, significant increases in synapse retraction and disassembly are observed. Signaling downstream of the BMP receptors can be genetically separated into two pathways: Smad-dependent synaptic growth and LIM Kinase1-dependent synaptic stability (Eaton, 2005).
LIM Kinase1 (LIMK1) is a cytoplasmic serine/threonine kinase that was originally isolated in screens for novel kinases expressed in the nervous system. Findings in LIMK1 knockout mice reveal defects in dendritic spine morphology and activity-dependent plasticity, although neither synaptic growth nor synaptic stability has been specifically analyzed. In the Drosophila central nervous system, DLIMK1 has been implicated in the mechanisms of axonal outgrowth during metamorphosis, acting through ADF/cofilin to modulate the actin cytoskeleton, a mechanism also documented in other tissues (Eaton, 2005 and references therein).
Genetic analyses have defined a new function for DLIMK1 during synaptic stability in comparison with its function in axonal outgrowth. Synaptic DLIMK1 is closely associated with the synaptic microtubule cytoskeleton. In addition, genetic manipulation of ADF/cofilin activity does not affect synaptic stability at the NMJ. These data highlight differences in LIMK1 function during the rapid, dynamic process of axon outgrowth compared to the slower, more prolonged mechanisms that govern synapse stabilization at the NMJ. Together, these data define genetically separable signaling pathways downstream of the BMP receptor that could allow a single trophic signaling event to coordinately control synaptic growth and synaptic stabilization (Eaton, 2005).
An assay to quantify synaptic retraction at the Drosophila NMJ was developed and used to identify molecules involved in synaptic stability. This assay is based on the demonstration that the formation of organized postsynaptic muscle membrane folds, termed the subsynaptic reticulum (SSR), requires the presence of the presynaptic nerve terminal. Therefore, the SSR and proteins that localize to this structure will be present only at sites where the nerve terminal resides, or where it has recently resided. Thus, observed sites of organized postsynaptic SSR that lack opposing presynaptic neuronal markers identify regions of the neuromuscular junction (NMJ) where the nerve terminal once resided and has since retracted. This interpretation has been confirmed in previous studies using light-level, ultrastructural, and electrophysiological analyses. Sites of synapse retraction are referred to as 'retraction events' or 'synaptic footprints' and represent a quantitative assay for synaptic stability. A wide array of pre- and post-synaptic markers have been used to clearly define synaptic retraction events. Synaptic retractions can be identified with equal efficiency using antibodies that recognize diverse presynaptic antigens, including cytoplasmic, membrane-associated, cytoskeleton, or vesicle-associated proteins. Several postsynaptic markers have also been used to quantify synapse retractions, including Discs-large, Shaker-GFP, and the clustered postsynaptic glutamate receptors (Eaton, 2005 and references therein).
The retraction assay was used to test whether BMP signaling in Drosophila motoneurons is required for synapse stabilization. First it was confirmed that mutations in the BMP type II receptor Wit and the BMP ligand Gbb cause a significant decrease in bouton number. These mutations also cause a significant increase in synaptic footprints, demonstrating that synaptic stability is significantly compromised in the absence of BMP signaling. Synaptic footprints were identified in equal numbers using multiple presynaptic markers, including anti-Synapsin and anti-nc82, which recognizes an antigen at the presynaptic active zone. Synaptic footprints can be rescued in the wit mutant background by neuronal expression of the full-length wit transgene, demonstrating that synapse destabilization is caused by the absence of the presynaptic Wit receptor. The number of synapse retractions is slightly, but statistically significantly, less in gbb compared with that in wit. This could be due to the fact that wit is a null mutation, whereas the gbb genotype that was used is not. Null mutations in gbb do not survive through larval development and, therefore, the genetic combination previously used in studies of its effects on synaptic growth was used (Eaton, 2005).
This analysis was extended to mutations that disrupt additional downstream components of the canonical BMP signaling cascade. Mutations in the BMP type I receptor thick-veins (tkv), the Smad homolog mad, and the co-Smad medea, were used. All three mutations decrease bouton numbers to levels that are statistically identical to those observed in the wit and gbb mutations. All three mutations also cause a statistically significant increase in synaptic footprints compared to wild-type, demonstrating that canonical BMP signaling is necessary for synaptic stability as well as for growth (Eaton, 2005).
Mutations have been isolated in the Drosophila melanogaster gene glass bottom boat (gbb), which encodes a TGF-ß signaling molecule (formerly referred to as 60A) with the highest sequence similarity to members of the bone morphogenetic protein (BMP) subgroup including vertebrate BMPs 58. Genetic analysis of both null and hypomorphic gbb alleles indicates that the gene is required in many developmental processes, including embryonic midgut morphogenesis, patterning of the larval cuticle, fat body morphology, and development and patterning of the imaginal discs. In the embryonic midgut, gbb is required for the formation of the anterior constriction and for maintenance of the homeotic gene Antennapedia in the visceral mesoderm. In addition, a requirement has been shown for gbb in the anterior and posterior cells of the underlying endoderm and in the formation and extension of the gastric caecae. gbb is required in all the imaginal discs for proper disc growth and for specification of veins in the wing and of macrochaete in the notum. Significantly, some of these tissues have been shown to also require the Drosophila BMP2/4 homolog decapentaplegic (dpp), while others do not. These results indicate that signaling by both gbb and dpp may contribute to the development of some tissues, while in others, gbb may signal independent of dpp (Wharton, 1999).
Defects in the embryonic midgut are observed in both dpp and gbb mutants, but each BMP appears to play a different role in midgut morphogenesis. gbb is required for the formation of the anterior midgut constriction, while dpp is required for the central constriction. Previous work has indicated that in the developing midgut, the localized visceral mesoderm expression of homeotic genes Antp, Ubx, and abd-A is required for the correct positioning of the anterior, central, and posterior constrictions, respectively. The homeotic genes have been shown to provide regional specification through their regulation of genes encoding secreted factors, such as dpp and wg, which subsequently act on the underlying midgut endoderm. dpp is activated directly by Ubx in a discrete band of cells in PS 7 of the visceral mesoderm from which Dpp is secreted, resulting in the induction of labial expression in underlying endodermal cells. It has been shown that Ubx expression is, in turn, maintained in the visceral mesoderm via a regulatory feedback loop through the action of dpp. In a manner similar to this regulation of Ubx by dpp, the expression of the homeotic gene Antp is regulated by gbb in the visceral mesoderm cells of PS 5 and 6. However, as is true of the regulation of dpp by Ubx, a reciprocal regulation of gbb by Antp is unlikely. The broad expression of gbb throughout the midgut indicates that gbb cannot be regulated exclusively by Antp (Wharton, 1999 and references).
gbb is expressed in both the visceral mesoderm and endoderm, and, as indicated by the regulation of Antp, gbb signaling is required in the visceral mesoderm. gbb signaling is also required in specific regions of the endoderm. The absence of gbb function eliminates the expression of the endodermal marker P-1 from cells in both the anterior and posterior midgut, as well as from cells in the ventriculus, the site from which the gastric caecae bud. The absence of P-1 staining in the primordia of the gastric caecae in gbb mutant embryos is consistent with gastric caecae defects observed in gbb mutant first instar larvae. It appears that although no gastric caecae are evident in stage 17 gbb mutant embryos, gastric caecae do form, albeit abnormally, by the end of the first larval instar. In summary, this analysis indicates, as is true for dpp, that gbb signaling is required in both the visceral mesoderm and endoderm of the Drosophila midgut. At this time, it is unknown which germ layer or layers serve as the source of the gbb signal (Wharton, 1999).
The specification of positional identity often arises from the localized expression of genes or factors controlling that particular process. It is of interest that although gbb does not exhibit a localized expression pattern, it is involved in regional specification of the midgut. The role of gbb in this process can be explained by two different models. In one model, gbb acts throughout the midgut, but with a partner that provides specific positional information. This partner or cofactor could be another BMP-type ligand or some other signaling component that is specifically localized. Given that the loss of gbb signaling has profound effects, for example, on the formation of the anterior midgut constriction, it would be predicted that a gbb partner would be localized to the anterior region of the midgut if this model were true. In the second model, gbb signaling does not specifically require a novel partner to provide positional information, but instead, cells within the midgut respond differently to varying levels of gbb and dpp signaling. This model is consistent with the paradigm that has been proposed for gbb and dpp signaling in the wing. Specification of different regions of the gut could result from the interpretation of different relative levels of gbb to dpp signaling. The total level of BMP signaling may be important, and the localized expression of dpp could provide a source of asymmetry necessary for the establishment of different positional information throughout the midgut. Low levels of signaling provided by gbb alone would specify anterior and posterior midgut vs. the high levels of signaling provided by both gbb and dpp that would specify the central domain of the midgut. Alternatively, differences in the responses elicited by a putative Gbb/Dpp heterodimer and Gbb and Dpp homodimers could be responsible for the assignment of different positional values. Other factors could certainly be involved in refining or elaborating the coarse pattern laid out by gbb and dpp. wg is an example of such a factor, as it has been shown that both wg and dpp are required to activate the expression of certain target genes in several tissues, At this time, it is not possible to distinguish between these two simple models, but these models provide a framework within which to investigate further the contribution of multiple BMP signaling to a specific developmental process: midgut morphogenesis (Wharton, 1999 and references).
In addition to the gbb mutant phenotypes that resemble dpp mutant phenotypes or those that affect tissues also affected by dpp mutations, several phenotypes have been identified that have not been observed in dpp mutants. Defects in the development of the telson and fat body of the larva have not been reported as aspects of dpp mutants, suggesting that in some developmental processes, gbb may function independently of dpp. It is interesting to note that mutations in the Drosophila BMP signaling components Mad, Medea, and sax can produce a clear larva phenotype. Mad and Medea encode Smad proteins shown to mediate dpp signaling in the midgut and the wing imaginal disc. It is possible that in the formation of the telson and the fat body, gbb may be the only BMP signal mediated by Mad, Medea, and sax: gbb is known to signal independent of dpp in these tissues. Alternatively, the earlier requirement for dpp in dorsal/ventral patterning of the embryo may have precluded the identification of dpp involvement in fat body or telson differentiation, and in fact, both gbb and dpp signaling are required for proper development of these structures. Without the ability to bypass the early requirement for dpp, it is not possible at this time to distinguish between these two possibilities (Wharton, 1999 and references).
The analysis of gbb alleles has also identified a requirement for gbb in the proper specification or positioning of bristles on the notum of the adult fly. A reduction in gbb activity results in the formation of ectopic macrochaete, most frequently on the scutellum. Such a phenotype has not previously been reported for dpp mutants. However, a recent report describing the ubiquitous activation of Tkv, a proposed Dpp receptor, results in ectopic macrochaete formation within the dorsolateral region of the notum. In this case, ectopic macrochaete formation results from the proposed activation of Dpp signaling via the Tkv receptor. In contrast, ectopic macrochaete has been observed with a reduction of gbb function. These opposite phenotypes could reflect a fundamental difference in the role of gbb signaling vs. dpp signaling in the formation or patterning of sensory mother cells, the precursor cells of the macrochaete. Furthermore, the appearance of ectopic macrochaete in the dorsocentral vs. scutellar regions of the notum may reflect a different positional or spatial requirement for dpp vs. gbb. Further analysis will reveal whether the requirement for gbb in scutellar macrochaete formation is independent of the potential role for dpp in the dorsocentral region (Wharton, 1999 and references).
The phenotypic analysis indicates that gbb and dpp participate in many of the same developmental processes; in some tissues the functions of gbb and dpp appear to be the same or very similar, while in others, their functions appear to be distinct. It is clear that while both gbb and dpp signaling contribute to the proper formation of the embryonic midgut and to patterning of the wing veins in the adult, the relative contribution of each BMP must be different. It is possible that overall, gbb and dpp participate in the development of certain tissues, and this could be accomplished by both cooperative or synergistic interactions and/or antagonistic interactions. As the different mutant phenotypes indicate, the mechanism by which gbb and dpp signaling each contribute to a developmental process must differ depending on the tissue. Understanding the different mechanisms by which these signals are sent and how these differences are regulated in Drosophila will provide significant insight into signaling by multiple TGF-ß/BMP ligands in both invertebrates and vertebrates (Wharton, 1999).
Formation of the longitudinal veins (LVs) of the Drosophila wing involves the interplay among Dpp, Egf and Notch pathways. Formation of crossveins (CVs: see Derivatives of the wing disc) present a paradoxical problem. As shown both morphologically and using molecular markers,
the definitive CVs are not formed until long after the initial
specification of the LVs. The CVs therefore must form within
territory that has already been specified as intervein. The CVs
must also interconnect with existing LVs at a time when the
Delta expressed by the LVs is thought to inhibit vein formation
in adjacent cells.
Mechanisms must exist that override both intervein
specification and the lateral inhibition of veins, allowing the
formation of continuous, interconnected vein tissue.
BMP-like signaling plays a special role
in the formation of the CVs from within intervein territory.
BMP-like signals also help maintain the connections between
the LVs and the margin of the wing. crossveinless 2 (cv-2) is a critical factor in
these processes, as it is expressed more highly in the CVs and
the ends of the LVs and is required for the high levels of BMP-like
signaling observed in these regions (Conley, 2000). The cv-2 mutation was first identified by Benedetto Nicoletti in 1962 (FlyBase: Cv-2 site). The structure of the
Cv-2 protein strongly suggests that these effects are direct, and
that Cv-2 is a novel player in the BMP-like signaling pathway (Conley, 2000).
Both Dpp and Gbb vein signals are mediated largely
by the type I receptor Thickveins, rather than the
alternate type I receptor Saxophone. Cells lacking Tkv
do not form veins, but removal of Sax does not reliably remove veins.
However, not all veins are equally sensitive to reductions in
Dpp and Gbb signaling. The hypomorphic gbb4 mutation
shows complete loss of the cross veins (CVs), but only slight
loss of the ends of the LVs. Sog encodes
a Chordin-like molecule that inhibits BMP-like signaling; both
Sog and Chordin are thought to bind to and sequester ligands,
preventing the activation of receptors. Overexpressing Sog
in the wing specifically blocks formation of the CVs and the
ends of the LVs. The secreted Tolloid
proteases, similar to vertebrate BMP1s, can increase BMP
signaling by cleaving and inactivating Chordin or Sog. Loss of tolkin (also known as tolloid-related) blocks
formation of the CVs and the tips of the LVs. Overexpressing a dominant negative
form of Sax again induces a similar phenotype (Conley, 2000 and references therein).
Such phenotypes are very reminiscent of the crossveinless
class of mutations in Drosophila (reviewed in Garcia-Bellido, 1992). Strong reductions
in crossveinless 2 (cv-2) function have been shown to remove the posterior CV
(PCV), the anterior CV (ACV), and the ends of the LVs. However, despite the possibility that the crossveinless
genes encode novel players in BMP-like signaling, none have
been characterized and the sensitivity of CVs to BMP-like
signaling has not been explained. Evidence is presented that cv-2 encodes a novel member
of the BMP-like signaling pathway, expressed in and required
for high levels of BMP-like signaling in the developing cross
veins. The Cv-2 protein contains five cysteine-rich domains
similar to those known to bind BMP-like ligands, strongly
suggesting that Cv-2 directly modulates Dpp or Gbb activity (Conley, 2000 and references therein).
dpp and gbb mutations both disrupt CV
formation. Weak cv-2 alleles are strengthened
by dpp and gbb loss-of-function mutations. cv-2225-3/cv-23511
flies never lack the entire PCV, but 50% of gbb 4 cv-2225-3/cv-2
3511 flies lack the entire PCV. Similarly, cv-23511/Df(2R)Pu-D17
only rarely disrupt the ACV, but dppd6 cv-23511/Df(2R)Pu-D17 commonly does. However, cv-2
cannot dominantly enhance earlier dpp-dependent patterning in
the wings: dppd5 Df(2R)Pu-D17 /dpphr4 wings look no worse
than dppd5/dpphr4 wings.
To provide a more direct link between cv-2 and Dpp and Gbb
signaling, Mad activation was examined in mutant pupal wings.
In cv-21 adults, the PCV is more reliably disrupted than the
ACV; the anti-p-Mad staining normally found near the PCV in
19, 22, 26 and 36 hours after pupariation wings is lost or disrupted in cv-21 homozygotes, as is the reduction of anti-DSRF
in the PCV. In adults of the stronger allelic combination cv-21/Df(2R)Pu-D17, the ACV is also often lost along with the
ends of some of the LVs. Interestingly, no
disruption of the ACV or LV anti-p-Mad staining cv-21/Df(2R)Pu-D17 pupal wings is detected at 21 or 25 hours after pupariation;
only at 36 hours after pupariation is staining lost from the ACV.
This indicates that cv-2 is required not only to initiate Mad
activity in the PCV, but also to maintain that activity in the ACV (Conley, 2000).
The Drosophila BMP5/6/7/8 homolog, glass bottom boat (gbb), has been shown to be involved in proliferation and vein patterning in the wing disc. To better understand the roles for gbb in wing development, as well as its relationship with decapentaplegic, clonal analysis was used to define the functional foci of gbb during wing development. gbb has both local and long-range functions in the disc that coincide both spatially and functionally with the established functions of dpp, suggesting that both BMPs contribute to the same processes during wing development. Indeed, comparison of the mutant phenotypes of dpp and gbb hypomorphs and null clones shows that both BMPs act locally along the longitudinal and cross veins to affect the process of vein promotion during pupal development, and long-range from a single focus along the A/P compartment boundary to affect the processes of disc proliferation and vein specification during larval development. Moreover, duplications of dpp are able to rescue many of the phenotypes associated with gbb mutants and clones, indicating that the functions of gbb are at least partially redundant with those of dpp. While this relationship is similar to that described for dpp and the BMP screw (scw) in the embryo, the mechanisms underlying both local and long-range functions of gbb and dpp in the wing are different. For the local foci, gbb function is confined to the regions of the veins that require the highest levels of dpp signaling, suggesting that gbb acts to augment dpp signaling in the same way as scw is proposed to do in the embryo. However, unlike scw-dependent signals in the embryo, these gbb signals are not transduced by the Type I receptor saxophone (sax), thus, the cooperativity between gbb and dpp is not achieved by signaling through distinct receptor complexes. For the long-range focus along the A/P compartment boundary, gbb function does not appear to affect the high point of the dpp gradient, but, rather, appears to be required for low points, which is the reciprocal of the relationship between dpp and scw in the embryo. Moreover, these functions of gbb also do not require the Type I receptor sax. Given these results, it is concluded that the relationships between gbb and dpp in the wing disc represent novel paradigms for how multiple BMP ligands signal during development, and that signaling by multiple BMPs involves a variety of different inter-ligand relationships that depend on the developmental context in which they act (Ray, 2001).
gbb has two distinct types of functions: local and long range. The local foci are confined to the posterior compartment, and affect the promotion of the posterior cross-vein (PCV) and the distal tips of the longitudinal veins L4 and L5. The long-range focus lies in the anterior compartment comprising a broad band of cells along the A/P compartment boundary and affects disc proliferation and the specification of L5. These gbb foci are coincident with the foci for dpp in the disc, and many of the phenotypes associated with the gbb clones are rescued by additional copies of the dpp locus. Thus, gbb and dpp contribute to the same functions in the disc and gbb functions are to some extent redundant with those of dpp. Comparison of the foci and phenotypes of gbb and dpp mutants and clones indicates that the relationship between gbb and dpp is different for different functions. For promotion of distal tips of L4 and L5, gbb function is restricted to those areas that require the highest levels of dpp signaling, and since these phenotypes can be rescued with additional copies of dpp, it is concluded that gbb is required to augment the levels of dpp signaling. For promotion of the PCV, the case is not so clear. Both gbb and dpp are required for PCV promotion. However, since dpp duplications do not rescue this phenotype, it is possible that gbb and dpp act independently or that the contribution of gbb to this process is sufficiently great that it cannot be compensated for by the additional doses of dpp. The requirement for gbb in the specification of L5 is not consistent with an augmentation of dpp signaling, since gbb mutants and clones do not affect structures specified by the high point of the dpp gradient. Rather, gbb clones affect structures far from the source along the A/P compartment boundary, suggesting that gbb signaling contributes to the low levels of BMP signaling at the extremes of the gradient (Ray, 2001).
Mutant phenotypes are observed only in gbb clones when the mutant tissue encompasses the entirety of the focus on both the dorsal and ventral surfaces of the wing. For example, clones that occupy the dorsal-anterior quadrant of the wing exhibit no defects in the patterning or size of the wing, while clones that occupy both the dorsal-anterior and ventral-anterior quadrants affect both these aspects of wing development. One explanation for this phenomenon is that Gbb exhibits long-range non-autonomy in the disc, and, in fact, there is some evidence for this, since it has been found that small patches of wild-type cells along the A/P compartment boundary in the context of a large mutant clone are able to rescue loss of L5 completely in the posterior compartment. However, gbb clearly does not act in a broadly non-autonomous fashion in all of its functions: gbb clones that cover the PCV or distal L5 exhibit vein defects that respect the clone boundaries, indicating that the presumptive vein cells within the clone cannot be rescued by the wild-type Gbb present in the adjacent cells. For these functions, the 'rescue' observed in single-sided clones implies pattern regulation occurring between the two wing surfaces. Indeed, it has long been asserted that there are signaling events between the dorsal and ventral surfaces of the wing (as have been shown for several genes) whereby loss of veins on one surface can be compensated for by the wild-type pattern in the opposing surface. The requirement for dorsal-ventral overlap observed with gbb mutant clones is indicative of such a signaling mechanism, and given these results, as well as those from previous studies that have shown a requirement for dorsal-ventral overlap in clones of dpp and sog, it is plausible that the BMPs themselves might be responsible for mediating these signaling processes (Ray, 2001).
Perhaps the most striking result from clonal analysis is that the requirements for gbb in the wing disc are localized even though the gene is widely expressed. This result implies that Gbb activity is in some way restricted post-transcriptionally. Two models seem the most likely to account for this effect. First, since it has been shown that all gbb foci are coincident with sites of dpp expression in the disc, it is possible that Gbb and Dpp form heterodimers, and that Gbb is only active in this form. Heterodimer formation has been documented for a number of different TGFß superfamily members, and in some cases heterodimers and homodimers have been shown to have distinct properties. For example, heterodimers of BMP2 or BMP4 and BMP7 are much more potent in the induction of ventral mesoderm and bone induction than their respective homodimers. Activins and Inhibins illustrate a different relationship: the homodimeric Activins having the opposite biological effects of the heteromeric Inhibins (Ray, 2001).
An alternative model is that the restriction of gbb function in the disc is achieved through local activation of Gbb homodimers, which may be achieved by specific agonists expressed within the foci or antagonists expressed everywhere else. Possible agonists include the Drosophila BMP-1 homologs tolloid and tolkin, or Drosophila homologs of the subtilisin-like proprotein convertases or furins, that are thought to be involved in the cleavage of BMP pro-proteins into the active ligand. In addition, the recently characterized secreted protein crossveinless 2 (cv-2) may act as an agonist of BMP signaling specifically in the presumptive crossveins. The antagonist sog is a likely candidate for restricting BMP activity during pupal development (i.e. for vein promotion functions) as it has been shown to be expressed in all intervein cells at this time. Moreover, there is some evidence that sog function in the wing may specifically antagonize gbb, and thus may very well account for the restriction of gbb function to the presumptive veins (Ray, 2001).
Clonal analysis has identified four processes that require gbb during wing development, disc proliferation, specification of the L5 vein territory, promotion of the PCV and promotion of the longitudinal veins L4 and L5. Based on the criteria of comparisons of gbb clone phenotypes with dpp and sax phenotypes, the ability for the gbb mutant phenotypes to be rescued by additional copies of dpp, and the spatial requirements for gbb during wing development, it is clear that each of these functions employs a different relationship between dpp and gbb, and each of these relationships is distinct from that which has been established for dpp and scw in the embryo (Ray, 2001).
BMP signaling is essential for promoting self-renewal of mouse embryonic stem cells and Drosophila germline stem cells and for repressing stem cell proliferation in the mouse intestine and skin. However, it remains unknown whether BMP signaling can promote self-renewal of adult somatic stem cells. In this study, BMP signaling is shown to be necessary and sufficient for promoting self-renewal and proliferation of somatic stem cells (SSCs) in the Drosophila ovary. BMP signaling, via the ligand Glass bottom boat, is required in SSCs to directly control their maintenance and division, but is dispensable for proliferation of their differentiated progeny. Furthermore, BMP signaling is required to control SSC self-renewal, but not survival. Moreover, constitutive BMP signaling prolongs the SSC lifespan. Therefore, this study clearly demonstrates that BMP signaling directly promotes SSC self-renewal and proliferation in the Drosophila ovary. This work further suggests that BMP signaling could promote self-renewal of adult stem cells in other systems (Kirilly, 2005)
FLP-mediated FRT recombination has revolutionized studies on diverse developmental processes in Drosophila. The mosaic clones marked by loss of armadillo (arm)-lacZ or ubiquitin (ubi)-GFP are routinely used to study Drosophila oogenesis. Two positive labeling methods, the tubulin-lacZ positive labeling system and the gal80-based mosaic analysis with a repressible cell marker (MARCM), have been developed to facilitate visualization of marked cells. The lacZ-positive labeling system is effective for identification of marked cells, but it is not ideal for manipulating gene function, while stable GAL80 protein may not allow rapid visualization of marked cells after one or two divisions due to its persistence. A new positively marked mosaic lineage (PMML) method has been developed to positively mark cells and allow for rapid expression of the UAS-GFP marker and any other UAS construct in the marked cells by using a combination of the GAL4-UAS and FLP-FRT systems. This PMML system uses the heat shock-inducible FLP to reconstitute a functional actin5C-gal4 gene from two complementary inactive alleles, actin5C FRT52B and FRT52B gal4. The actin5C-gal4 gene drives GFP expression to mark cells and can also activate or knock down gene function by using UAS constructs in the marked cells (Kirilly, 2005)
To test whether PMML is also suitable for marking SSCs and assisting in SSC identification in the Drosophila ovary, ovaries were immunostained with anti-GFP and anti-Fasciclin III (Fas3) antibodies 1 week after clone induction (ACI). Fas3 is expressed in SSCs at low levels and in differentiated follicle cell progenitor cells at higher levels. It takes about 4-5 days for transiently labeled GFP-positive follicle cells to completely exit the germarium. One week ACI, a typical GFP-positive SSC clone was easily observed with the GFP-marked follicle cells present in regions 2b and 3 of the germarium and in egg chambers. The marked SSC could be identified by its location (the GFP-positive somatic cell at the 2a/2b junction), low Fas3 expression, and the presence of GFP-marked follicle cells in the germarium and/or in the egg chambers. The GFP-marked inner germarial sheath (IGS) cells could also be readily identified by their location (the germarial regions 1 and 2a), the absence of marked differentiated follicle cells in the same ovarioles, and also the absence of Fas3 expression, since the IGS descendants do not pass beyond the 2a/2b junction. Therefore, this system can be applied effectively for labeling SSCs and their progeny and for further studying the function of any gene in the marked SSCs and their progeny by overexpression (Kirilly, 2005).
This study shows that SSCs in the adult ovary are capable of responding to BMP signaling. Genetic mosaic analyses demonstrate that known BMP downstream components are also required for SSC self-renewal, but not survival. Hyperactive BMP signaling enhances SSC self-renewal capacity. Glass bottom boat (Gbb) is essential for controlling SSC maintenance, at least in the GSC niche. Furthermore, BMP signaling appears to be specific to stem cells, since follicle cells mutant for BMP-specific downstream components proliferate and differentiate normally. In addition to participation in BMP signaling, Medea (Med) is likely involved in other TGF-β-like pathway(s) to control proliferation and size of differentiated follicle cells. The results from this study led to the proposal of a working model that Gbb perhaps as well as Dpp from neighboring somatic cells function as stem cell growth factors in vivo for promoting self-renewal of ovarian SSCs (Kirilly, 2005).
gbb and dpp are expressed in cap cells, inner germarial sheath (IGS) cells, and follicle cells. SSCs are located in the middle of the germarium and are likely exposed to both BMPs, since both Dpp and Gbb are diffusible molecules. gbb mutants exhibit severe SSC/follicle cell proliferation defects and SSC loss. Furthermore, SSCs mutant for BMP downstream components such as tkv, punt, and mad are lost faster and divide slower than wild-type ones. Although dpp mutants show much weaker mutant defects, it is still possible that it plays as important a role as does gbb, since only weak dpp mutations could be used for studying the regulation of adult SSCs due to its stringent requirements during early development. Therefore, these findings support the idea that Gbb, perhaps together with Dpp, controls SSC self-renewal and division. Studies on GSCs in the Drosophila ovary have shown that BMPs control GSC self-renewal by directly repressing transcription of differentiation-promoting genes such as bam. Possibly, BMP signaling also represses differentiation-promoting genes and thereby maintains SSC self-renewal. Meanwhile, BMP signaling could also positively regulate other genes that are important for maintaining the undifferentiated state of SSCs. This study also shows that BMP signaling also promotes SSC division. It has been shown that BMP signaling promotes GSC division. In order to better understand how BMP signaling controls SSC self-renewal and division, it is critical to identify the BMP target genes in SSCs, that are either repressed or activated by BMP signaling (Kirilly, 2005)
This study also shows that tkv is a major type I BMP receptor for controlling SSC self-renewal in the Drosophila ovary. The SSCs mutant for sax4, a null allele of sax, behave close to normal wild-type ones, while the SSCs mutant for a strong tkv allele, tkv8, are lost rapidly, indicating that Tkv is a major functional receptor to control SSC self-renewal. Given the evidence that gbb signaling is essential for maintaining SSCs, this study strongly supports the idea that Gbb signals mainly through Tkv to control SSC self-renewal in the Drosophila ovary. A recent study on Drosophila spermatogenesis also suggests that Gbb signaling primarily functions through Tkv, but not Sax. In the Drosophila testis, gbb and tkv are both essential for maintaining GSCs, but sax is not. Although one study on dominant-negative tkv and sax receptors suggests that dpp and gbb signal preferentially through tkv and sax, respectively, another more recent study has shown that both dpp and gbb use tkv, but not sax, control the process of vein promotion during pupal development and disc proliferation and vein specification during larval development. Taken together, the results from this study and the previous studies indicate that Gbb can use Tkv as a major receptor for its signal transduction in Drosophila (Kirilly, 2005).
Although Gbb/BMP signaling plays a critical role in controlling SSC self-renewal and division, it appears that it is dispensable for SSC survival, follicle cell proliferation, and cell size control. For example, expression of the baculovirus antiapoptotic gene p35 could not rescue the mutant punt SSC loss; the follicle cell clones mutant for strong tkv and mad alleles, tkv8 and mad12, proliferate normally, and the sizes of the mutant follicle cells are quite normal. In contrast, p35 expression can rescue the Med26 SSC loss to the levels of the mutant punt, tkv, and mad mutant SSC loss. The partial rescue indicates that Med is required for SSC survival in a BMP-independent pathway. The Med mutant follicle cell clones proliferate slower than wild-type, and the size of follicle cells is also smaller than that of wild-type, suggesting that Med is required for follicle cell proliferation and growth. Since BMP signaling is not involved in the control of SSC survival, follicle cell proliferation, and growth, these findings further suggest that Med must participate in other TGF-β-like pathways controlling these processes. In mammalian systems, SMAD4 has been shown to be a common SMAD for all TGF-β-like signaling pathways, including TGF-β, Activin, and BMP. A likely candidate TGF-β-like signaling pathway includes Activin and TGF-β. Activin and TGF-β molecules exist in Drosophila. Activin-like signaling has been shown to be involved in regulating growth control and neuronal remodeling. However, the role of TGF-β signaling in Drosophila remains a mystery. It could not be completely ruled out, however, that Med is involved in other signaling pathways unrelated to TGF-β-like pathways to control SSC survival, follicle cell proliferation, and growth. In the future, it is very important to figure out which pathway Med takes part in for controlling SSC survival, follicle cell proliferation, and growth control (Kirilly, 2005).
In a variety of systems, stem cells have been proposed to be regulated by signals from niches. SSCs are anchored to the posterior group of IGS cells through DE-cadherin-mediated cell adhesion. Elimination of the anchorage leads to rapid SSC loss, suggesting that the posterior IGS cells function as a SSC niche. This study shows that gbb is expressed in the somatic cells, including IGS cells and follicle cells, and plays an important role in maintaining SSCs. Hh and Wg are expressed in the cap cells and play essential roles in controlling SSC self-renewal, suggesting that the SSC niche is composed of IGS cells and cap cells. In Drosophila imaginal development, these three pathways often regulate one another to control patterning, cell proliferation, and differentiation. In the Drosophila ovary, disruption of Hh, Wg, and BMP signaling cascades causes rapid SSC loss, while hyperactive signaling results in abnormal proliferation and differentiation of SSC progeny. Interestingly, their downstream transcriptional factors are also required for controlling SSC maintenance, suggesting that integration of these pathways likely takes place at or after transcription of their target genes. This study has shown that hyperactive BMP signaling can substitute for Wg signaling, but not Hh signaling, in controlling SSC self-renewal. However, it still remains unclear how hyperactive BMP signaling bypasses Wg signaling in SSCs. An important task in the future is to define their target genes in SSCs and to further figure out how these three signal transduction pathways interact with each other to control expression of these target genes (Kirilly, 2005).
In mammals, Shh, Wnt, and BMP pathways have been shown to regulate stem cell behavior directly or indirectly. BMP signaling directly represses activities of stem cells in the intestine and the hair follicle and promotes self-renewal of ES cells and spermatogonial stem cells. BMP signaling can also indirectly regulate haematopoeitic stem cells (HSCs) by controlling niche size. Wnt signaling has been shown to control self-renewal of HSCs, ES cells, intestinal stem cells, and possibly hair follicle stem cells. Shh signaling is required for proliferation of stem cells/progenitor cells in the lung airway. Studies from Drosophila and mice have shown that different stem cell types may utilize a combination of different growth factors to control their self-renewal, proliferation, and differentiation. Interestingly, Wnt and BMP signaling pathways promote ES self-renewal in mice and ovarian SSC self-renewal in Drosophila. Future studies of how different signaling pathways are integrated in Drosophila ovarian SSCs may also shed light on how these same pathways control stem cell self-renewal in mammals (Kirilly, 2005).
The complete protein-coding region of the Drosophila virilis 60 A gene, a member of the transforming growth factor-beta superfamily, has been isolated and sequenced. The mature domain of the protein-coding region is 99% identical to the Drosophila melanogaster Tgfbeta-60A gene and 73% identical to human bone morphogenetic protein 5. In the pro-domain, a number of large blocks of amino acids are also highly conserved, indicating an important functional role for this portion of the protein as well. In the putative 5' and 3' untranslated regions, several short sequence motifs are conserved between D. virilis and D. melanogaster (Du, 1996).
To improve the understanding of the evolutionary diversification of decapentaplegic the gene was identified in the grasshopper Schistocerca americana. S. americana diverged from D. melanogaster approximately 350 million years ago, utilizes a distinct developmental program, and has a 60-fold-larger genome than D. melanogaster. A single dpp locus is present in D. melanogaster and S. americana, suggesting that thedpp copy number does not correlate with increasing genome size. Another TGF-beta superfamily member, the D. melanogaster gene Tgfbeta-60A, is also present in only one copy in each species. Comparison of homologous sequences from D. melanogaster, S. americana, and H. sapiens, representing roughly 900 million years of evolutionary distance, reveals significant constraint on sequence divergence for both dpp and Tgfbeta-60A. In the signaling portion of the dpp protein, the amino acid identity between these species exceeds 74%. These results for the TGF-beta superfamily are consistent with current hypotheses describing gene duplication and diversification as a frequent response to high levels of selective pressure on individual family members (Newfeld, 1995).
The ascidian tadpole larva (phylum Urochordata) is thought to be the prototype for the ancestral chordate. Although ascidians show a highly determinate mode of development, recent studies suggest significant roles of cell-cell interaction during embryogenesis. To elucidate the signaling molecules responsible for the cellular interaction, an ascidian homolog of the transforming growth factor beta (TGF-beta) superfamily has been investigated. HrBMPa is an ascidian member
of the 60A subclass of the BMP subfamily. Molecular phylogenetic analysis suggests that HrBMPa branched off prior to further divergence of vertebrate BMPs-5-8. The zygotic expression of HrBMPa is initiated around gastrulation. HrBMPa transcripts are first evident in precursor cells of the spinal cord, notochord, epidermis and nervous system, although signals in the first two regions quickly disappear. In neurulae and early tailbud embryos, transcripts are evident in the adhesive organ, midline of the anterior dorsal neuroectoderm and midline of both ventral and dorsal ectoderm, suggesting that HrBMPa plays a major role in neuroectodermal cell differentiation during embryogenesis. This HrBMPa expression profile resembles that of Xenopus BMP-7, implying a primordial function of BMP-7 among vertebrate BMPs-5-8 (Miya, 1996).
Both Decapentaplegic (Dpp) protein and Tgfbeta-60A protein have been implicated in pattern formation during Drosophila melanogaster embryogenesis. Within the C-terminal domain, Dpp and Tgfbeta-60A are similar to human bone morphogenetic protein 2 (75% identity) and human osteogenic protein 1 (70% identity), respectively. Both recombinant human bone morphogenetic protein 2 and recombinant human osteogenic protein 1 have been shown to induce bone formation in vivo and to restore large diaphyseal segmental defects in various animal models. An examination of the Drosophila proteins Dpp and 60A focussed on whether they have the capacity to induce bone formation in mammals, using the rat subcutaneous bone induction model. Highly purified recombinant Dpp and Tgfbeta-60A induce the formation of cartilage, bone, and bone marrow in mammals, as determined by histological observations and by measurements of the specific activity of alkaline phosphatase and calcium content of the implants, thereby demonstrating that related proteins from phylogenetically distant species are capable of inducing bone formation in mammals when placed in sites where progenitor cells are available (Sampath, 1993).
The expression pattern of bone morphogenetic protein-7 (BMP-7) in the hindbrain region of the headfold and early somite stage of the developing mouse embryo suggests a role for BMP-7 in the patterning of this part of the cranial CNS. It is thought that in chick embryos BMP-7 is one of the secreted molecules that mediates the dorsalizing influence of surface ectoderm on the neural tube, and mouse surface ectoderm has been shown to have a similar dorsalizing effect. While it is confirmed that BMP-7 is expressed in the surface ectoderm of mouse embryos at the appropriate time to dorsalize the neural tube, it is also shown that at early stages of hindbrain development BMP-7 transcripts are present in paraxial and ventral tissues, within and surrounding the hindbrain neurectoderm; only later does expression become restricted to a dorsal domain. To determine more directly the effect that BMP-7 may have on the developing hindbrain, COS cells expressing BMP-7 were grafted into the ventrolateral mesoderm abutting the neurectoderm in order to prolong BMP-7 expression in the vicinity of ventral hindbrain. Three distinct actvities of BMP-7 are apparent: (1) as expected from previous work in chick, BMP-7 can promote dorsal characteristics in the neural tube; (2) it can also attenuate the expression of Sonic hedgehog (Shh) in the floorplate without affecting Shh expression in the notochord, and (3) ectopic BMP-7 appears to promote growth of the neurectoderm (Arkell, 1997).
The 60A subclass of BMPs contains at least four vertebrate members, BMPs 5-8. Of these four genes, BMP 7 is expressed earliest, in gastrulating embryos. BMP 7 transcripts are present at diverse sites throughout development, in a pattern consistent with a role in a variety of inductive interactions. Recent studies have shown that BMP 2/7 heterodimers have unique activities compared to the corresponding homodimers. For this reason, the patterns of expression of BMP 2 (Drosophila homolog: Decapentaplegic) and BMP 7 were compared using in situ hybridization. These BMPs are coexpressed in a number of tissues that are known to be the source of inductive signals, including the zone of polarizing activity and apical ectodermal ridge of the developing limb and the notochord, raising the possibility that BMP 2/7 heterodimers may mediate aspects of these tissue interactions. BMP 2 transcripts are restricted within the developing gut to dorsal endoderm, whereas Sonic hedgehog has been localized to ventral and medial regions of the developing gut endoderm. These markers provide the first molecular evidence for dorsal/ventral polarity in the developing gut (Lyons, 1995).
A large number of TGF superfamily members, including BMP-2, -4 and -7, are expressed during early embryogenesis in the vertebrate embryo. BMP-7 is shown to have ventralizing activity both in ectodermal explants as well as in whole embryos. As was the case for BMP-2 and BMP-4, BMP-7 is a very poor inducer when provided as a homodimer protein. Because of this weak mesoderm inducing activity, it has been suggested that mesoderm induction by BMPs might represent an artifact of overexpression. Evidence is provided demonstrating that unlike the homodimers of BMP-4 or BMP-7, the purified recombinant heterodimer of Xenopus BMP-4 and BMP-7 (BMP-4/7) has a potent mesoderm inducing activity at physiological concentrations. These results provide the first evidence for an embryonic function of BMP-4/7 heterodimers in the vertebrate embryo (Suzuki, 1997).
The three-dimensional structure of osteogenic protein 1 (OP-1, also known as bone morphogenetic protein 7) to 2.8-A resolution is described. Although there is limited sequence identity between OP-1 and TGF-beta 2, they share a common polypeptide fold. These results establish a basis for proposing the OP-1/TGF-beta 2 fold as the primary structural motif for the TGF-beta superfamily as a whole. Detailed comparison of the OP-1 and TGF-beta 2 structures has revealed striking differences that provide insights into how these growth factors interact with their receptors (Griffith, 1996).
The bone morphogenetic proteins (BMPs), a subgroup of the TGF-beta gene super-family, are dimeric molecules involved in the growth, differentiation and repair of a wide variety of tissues. Based on the observation that several of the BMPs co-purify when isolated from bovine bone and that a pattern of co-localization exists during mouse embryogenesis, various combinations of BMPs were co-expressed in Chinese hamster ovary cells to test for possible heterodimer formation and activity. Transient co-expression of BMP-2 with either BMP-5, BMP-6 or BMP-7, or BMP-4 transiently co-expressed with BMP-7, results in more BMP activity than expression of any single BMP. Stable cell lines were then made in order to purify and characterize co-expressed BMPs in more detail. Co-expression of BMP-2 with BMP-7 yields heterodimeric BMP-2/7 with a specific activity about 20-fold higher than BMP homodimers in an in vitro alkaline phosphatase induction assay. These heterodimers are also 5- to 10-fold more potent than BMP-2 in inducing cartilage and bone in an in vivo assay. Similar results have been obtained with BMP-2/6 heterodimer. These experiments demonstrate the increased potency of several BMP heterodimers relative to BMP homodimers and support the hypothesis that such heterodimeric forms are likely to have natural biological functions (Israel, 1996).
The expression and processing of osteogenic protein-1 (hOP-1), a bone morphogenic protein of the TGF-beta family, has been characterized in Chinese hamster ovary cells. The hOP-1 is initially synthesized as a monomeric 50 kDa pro-protein that is dimerized, glycosylated, and then proteolytically cleaved at the Arg-Xaa-Xaa-Arg maturation site in an acidic cellular compartment before secretion into the medium. Of the four potential N-linked glycosylation sites, two are used, one in the mature domain and one in the pro-domain. Gel permeation chromatography of secreted hOP-1 in physiological buffers yields an apparent molecular weight of 110-120 k, indicating that after proteolytic processing the two pro-domains remain non-covalently associated with the disulfide linked mature dimer in a complex termed soluble hOP-1. Purified soluble hOP-1 is significantly more soluble in physiological buffers than the purified mature OP-1 (Jones, 1994).
Proteins in the TGF-beta superfamily transduce their effects through binding to type I and type II serine/threonine kinase receptors. Osteogenic protein-1 binds activin receptor type I (ActR-I), and BMP receptors type IA (BMPR-IA) and type IB (BMPR-IB) in the presence of activin receptors type II (ActR-II) and type IIB (ActR-IIB). The binding affinity of OP-1 to ActR-II is two- to threefold lower than that of activin A. A transcriptional activation signal is transduced after binding of OP-1 to the complex of ActR-I and ActR-II, or that of BMPR-IB and ActR-II. These results indicate that ActR-II can act as a functional type II receptor for OP-1, as well as for activins. Some of the known biological effects of activin are observed for OP-1, including growth inhibition and erythroid differentiation induction. Compared to activin, OP-1 is a poor inducer of mesoderm in Xenopus embryos. Moreover, follistatin, an inhibitor of activins, inhibits the effects of OP-1, if added at a 10-fold excess. However, certain effects of activin, like induction of follicle stimulating hormone secretion in rat pituitary cells, are not observed for OP-1. OP-1 has overlapping binding specificities with activins, and shares certain but not all of the functional effects of activins. Thus, OP-1 may have broader effects in vivo than hitherto recognized (Yamashita 1995).
Growth/differentiation factor-5 (GDF-5) is a member of the bone morphogenetic protein (BMP) family, which plays an important role in bone development in vivo. Mutations in the GDF-5 gene result in brachypodism in mice and Hunter-Thompson type chondrodysplasia in human. BMPs transduce their effects through binding to two different types of serine/threonine kinase receptors, type I and type II. However, binding abilities appear to be different among the members of the BMP family. BMP-4 binds to two different type I receptors [BMP receptors type IA (BMPR-IA) and type IB (BMPR-IB)], and a type II receptor [BMP receptor type II (BMPR-II)]. In addition to these receptors, osteogenic protein-1 (OP-1, also known as BMP-7) binds to activin type I receptor (ActR-I) as well as activin type II receptors (ActR-II and ActR-IIB). The binding and signaling properties of GDF-5 through type I and type II receptors has been investigated. GDF-5 induces alkaline phosphatase activity in a rat osteoprogenitor-like cell line, ROB-C26. GDF-5 binds to BMPR-IB and BMPR-II but not to BMPR-IA in ROB-C26 cells and other nontransfected cell lines. GDF-5 binds to BMPR-IB but not to the other type I receptors when expressed alone. When COS-1 cells are transfected with type II receptor cDNAs, GDF-5 binds to ActR-II, ActR-IIB, and BMPR-II but not to transforming growth factor-beta type II receptor. In the presence of type II receptors, GDF-5 binds to different sets of type I receptors, but the binding is most efficient to BMPR-IB, when compared with the other type I receptors. A transcriptional activation signal is efficiently transduced by BMPR-IB in the presence of BMPR-II or ActR-II after stimulation by GDF-5. These results suggest that BMPR-IB mediates certain signals for GDF-5 after forming the heteromeric complex with BMPR-II or ActR-II (Nishitoh, 1996).
BMP-7/OP-1, a member of the transforming growth factor-beta (TGF-beta) family of secreted growth factors, is expressed during mouse embryogenesis in a pattern suggesting potential roles in a variety of inductive tissue interactions. The present study demonstrates that mice lacking BMP-7 display severe defects confined to the developing kidney and eye. Surprisingly, the early inductive tissue interactions responsible for establishing both organs appear largely unaffected. However, the absence of BMP-7 disrupts the subsequent cellular interactions required for their continued growth and development. Consequently, homozygous mutant animals exhibit renal dysplasia and anophthalmia at birth. Overall, these findings identify BMP-7 as an essential signaling molecule during mammalian kidney and eye development (Dudley, 1995).
BMP-7-deficient mice die shortly after birth because of poor kidney development. Histological analysis of mutant embryos at several stages of development reveal that metanephric mesenchymal cells fail to differentiate, resulting in a virtual absence of glomerulus in newborn kidneys. The absence of BMP-7 affects the expression of molecular markers of nephrogenesis, such as Pax-2 and Wnt-4 between 12.5 and 14.5 days postcoitum. This identifies BMP-7 as an inducer of nephrogenesis. In addition, BMP-7-deficient mice have eye defects that appear to originate during lens induction. BMP-7-deficient mice also have skeletal patterning defects restricted to the rib cage, the skull, and the hindlimbs (Luo, 1995).
While generating bcl2 alpha transgenic mice, some F2 offspring from one of the transgenic lines were found which were very small and had closed eyes at the time of weaning. These pups die within 1 month after birth. In order to determine the molecular basis of this phenotype, a genomic library of the above transgenic line was screened with a transgene-specific probe. It was found that the Bmp7 gene, a member of the TGF beta superfamily, had been inactivated by insertional mutagenesis due to transgene integration. The Bmp7 homozygous null condition in mice is a postnatal lethal mutation and is associated with various developmental defects: holes in the basisphenoid bone and the xyphoid cartilage, retarded ossification of bones, fused ribs and vertebrae, underdeveloped neural arches of the lumbar and sacral vertebrae, polydactyly of the hind limbs, a kinked tail, a reduced number of nephrons, polycystic kidney, lack of retinal pigmentation, and retarded lens development. These findings indicate that BMP7 is an important signaling molecule for normal development of the mammalian skeleton, kidney, and eye (Jena, 1997).
Bmp6, a member of the 60A subgroup of bone morphogenetic proteins (BMPs), is expressed in diverse sites in the developing mouse embryo from preimplantation stages onward. To evaluate roles for Bmp6 signaling in vivo, gene targeting was used to generate a null mutation at the Bmp6 locus. The resulting Bmp6 mutant mice are viable and fertile, and show no overt defects in tissues known to express Bmp6 mRNA. The skeletal elements of newborn and adult mutants are indistinguishable from wild-type. However, careful examination of skeletogenesis in late gestation embryos reveals a consistent delay in ossification, strictly confined to the developing sternum. In situ hybridization studies in the developing long bones and sternum show that other BMP family members are expressed in overlapping domains. In particular Bmp2 and Bmp6 are coexpressed in hypertrophic cartilage, suggesting that Bmp2 may functionally compensate in Bmp6 null mice. The defects in sternum development in Bmp6 null mice are likely to be associated with a transient early expression of Bmp6 in the sternal bands, prior to ossification. These sternal defects are slightly exacerbated in Bmp5/6 double mutant animals (Solloway, 1998).
Despite the importance of BMP signaling in normal development, very little is known about the mechanisms that control the synthesis and distribution of BMP signals in vertebrates. A large array of cis-acting control sequences have been identified that lay out expression of the mouse Bmp5 gene in specific skeletal structures and soft tissues. Some of these elements show striking specificity for particular anatomical features within the skeleton, rather than for cartilage and bone in general. These data suggest that the vertebrate skeleton is built from the sum of many independent domains of BMP expression, each of which may be controlled by separate regulatory elements driving expression at specific anatomical locations. Surprisingly, some of the regulatory sequences in the Bmp5 gene map over 270 kb from the Bmp5 promoter; this distance between regulatory elements and the promoter is one of the longest yet identified in studies of eukaryotic gene expression (DiLeone, 1998).
Ventral midline cells at different rostrocaudal levels of the central nervous system exhibit distinct properties but share the ability to pattern the dorsoventral axis of the neural tube. Ventral midline cells acquire distinct identities in response to the different signaling activities of underlying mesoderm. Signals from prechordal mesoderm control the differentiation of rostral diencephalic ventral midline cells, whereas notochord induces floor plate cells caudally. Sonic hedgehog (SHH) is expressed throughout axial mesoderm and is required for the induction of both rostral diencephalic ventral midline cells and floor plate. However, prechordal mesoderm also expresses BMP7, whose function is required coordinately with Shh to induce rostral diencephalic ventral midline cells. BMP7 acts directly on neural cells, modifying their response to Shh so that they differentiate into rostral diencephalic ventral midline cells rather than floor plate cells. A model is suggested whereby axial mesoderm both induces the differentiation of overlying neural cells and controls the rostrocaudal character of the ventral midline of the neural tube (Dale, 1997).
To investigate the role of BMPs in neural development, the expression of five Bmp genes belonging to the Drosophila Decapentaplegic (Bmp2 and Bmp4) and 60A subgroups (Bmp5, Bmp6 and Bmp7) have been compared. A striking co-expression of these Bmps is observed within the dorsomedial telencephalon, coincident with a future site of choroid plexus development. Bmp co-expression overlaps that of Msx1 and Hfh4, and is complementary to that of Bf1. The domain of Bmp co-expression is also associated with limited growth of the neuroectoderm, as revealed by morphological observation, reduced cell proliferation, and increased local programmed cell death. In vitro experiments using explants from the embryonic lateral telencephalic neuroectoderm reveal that exogenous BMP proteins (BMP4 and BMP2) induce expression of Msx1 and inhibit Bf1 expression, a finding consistent with their specific expression patterns in vivo. Moreover, BMP proteins locally inhibit cell proliferation and increase apoptosis in the explants. These results provide evidence that BMPs function during regional morphogenesis of the dorsal telencephalon by regulating specific gene expression, cell proliferation and local cell death (Furuta, 1997).
Proper dorsal-ventral patterning in the developing central nervous system requires signals from both the
dorsal and ventral portions of the neural tube. Data from multiple studies have demonstrated that bone
morphogenetic proteins (BMPs) and Sonic hedgehog protein are secreted factors that regulate dorsal and
ventral specification, respectively, within the caudal neural tube. In the developing rostral central nervous
system Sonic hedgehog protein also participates in ventral regionalization; however, the roles of BMPs in
the developing brain are less clear. It was hypothesized that BMPs also play a role in dorsal specification of
the vertebrate forebrain. To test this hypothesis, beads soaked in recombinant BMP5 or
BMP4 were implanted into the neural tube of the chicken forebrain. Experimental embryos show a loss of the basal
telencephalon that results in holoprosencephaly (a single cerebral hemisphere), cyclopia (a single midline
eye), and loss of ventral midline structures. In situ hybridization using a panel of probes to genes
expressed in the dorsal and ventral forebrain reveals the loss of ventral markers, although dorsal markers are maintained. Furthermore, the loss of the basal telencephalon is the result of excessive
cell death and not a change in cell fates. These data provide evidence that BMP signaling participates in the
dorsal-ventral patterning of the developing brain in vivo, and that disturbances in dorsal-ventral signaling result
in specific malformations of the forebrain (Golden, 1999).
Sympathetic neurons from perinatal rat pups extend only a single axon when maintained in culture in the absence of glia and serum. Exposure to recombinant osteogenic protein-1 (OP-1) selectively induces the formation of dendrites that correctly segregate and modify cytoskeletal and membrane proteins and form synaptic contacts of appropriate polarity. OP-1 requires nerve growth factor (NGF) as a cofactor, and, in the presence of optimal concentrations of NGF, OP-1-induced dendritic growth from cultured perinatal neurons is comparable to that observed in situ. Sympathetic neuroblasts that have not formed dendrites in situ also respond to OP-1 in culture, indicating that OP-1 can cause de novo formation as well as regeneration of dendrites. These data imply that specific signals can regulate the development of neuronal shape and polarity (Lein, 1995).
The growth patterns of axons and dendrites differ with respect to their number, length, branching, and spatial orientation; therefore, it is likely that these processes differ in their growth requirements. To examine this hypothesis, an analysis has been carried out of the responses of cultured rat sympathetic neurons to three types of stimuli: large structural proteins of the extracellular matrix, matrix-associated growth factors, and neurotrophins. Purified structural proteins such as laminin and collagen IV have been found to promote only axonal growth; whereas the matrix associated growth factor, osteogenic protein-1, selectively stimulates dendritic growth. In contrast, nerve growth factor modulates the growth of both types of processes. These data suggest that process-specific interactions with the extracellular environment may be critical determinants of cell shape in neurons. Perinatal rat sympathetic neurons grown in culture in the absence of serum or glial cells extend a single process, which is axonal in nature. Exposure to osteogenic protein-1 causes the formation of additional processes that express the morphological, cytoskeletal, and ultrastructural characteristics of dendrites. Consistent with observations on the regulation of dendritic growth in sympathetic neurons in situ, the dendrite-promoting activity of osteogenic protein-1 is independent of synaptic or electrical activity, but is modulated by nerve growth factor. In the presence of optimal concentrations of osteogenic protein-1 and nerve growth factor, the size of the dendritic arbor extended by cultured sympathetic neurons approximates that seen in situ at comparable developmental stages. Osteogenic protein-1 does not promote dendritic growth in cultured neurons obtained from embryonic ciliary, dorsal root, trigeminal or nodose ganglia, suggesting that its morphogenetic effects are cell selective. Since mRNA for osteogenic protein-1 is expressed in mature as well as embryonic target tissues of the sympathetic nervous system, the effects of osteogenic protein-1 on cultures of sympathetic neurons derived from adult rats were also examined. Consistent with results obtained with perinatal neurons, osteogenic protein-1 selectively promotes dendritic growth in adult neurons. These data suggest that this matrix-associated growth factor could play a role not only in the morphogenesis of the developing nervous system, but also in the maintenance and remodeling of dendritic structures in the mature animal (Lein, 1996).
BMP activity is essential for many steps of neural development, including the initial role in neural induction and the control of progenitor identities along the dorsal-ventral axis of the neural tube. Taking advantage of chick in ovo electroporation, a novel role was shown for BMP7 at the time of neurogenesis initiation in the spinal cord. Using in vivo loss-of-function experiments, BMP7 activity was shown to be required for the generation of three discrete subpopulations of dorsal interneurons: dI1-dI3-dI5. Analysis of the BMP7 mouse mutant shows the conservation of this activity in mammals. Furthermore, this BMP7 activity appears to be mediated by the canonical Smad pathway; Smad1 and Smad5 activities are similarly required for the generation of dI1-dI3-dI5. Moreover, this role is independent of the patterned expression of progenitor proteins in the dorsal spinal cord, but depends on the BMP/Smad regulation of specific proneural proteins, thus narrowing this BMP7 activity to the time of neurogenesis. Together, these data establish a novel role for BMP7 in primary neurogenesis, the process by which a neural progenitor exits the cell cycle and enters the terminal differentiation pathway (Le Dréau, 2011).
Bone morphogenetic protein 2 (BMP-2) and osteogenic protein 1 (OP-1, also termed BMP-7) are potent apoptotic signals for the undifferentiated limb mesoderm but not for the ectoderm or the differentiating chondrogenic cells. They promote intense radial growth of the differentiating cartilages and disturb the formation of joints accompanied by alterations in the pattern of Indian hedgehog expression. Interestingly, the effects of these two BMPs on joint formation are found to be different. While the predominant effect of BMP-2 is alteration in joint shape, OP-1 is a potent inhibitory factor for joint formation. In situ hybridizations to check whether this finding was indicative of specific roles for these BMPs in the formation of joints reveals a distinct and complementary pattern of expression for these genes during the formation of the skeleton of the digits. While OP-1 exhibits an intense expression in the perichondrium of the developing cartilages with characteristic interruptions in the zones of joint formation, BMP-2 expression is a positive marker for the articular interspaces. These data suggest that, in addition to the proposed role for BMP-2 and OP-1 in the establishment of the anteroposterior axis of the limb, they may also play direct roles in limb morphogenesis: (1) in regulating the amount and spatial distribution of the undifferentiated prechondrogenic mesenchyme and (2) in controlling the location of the joints and the diaphyses of the cartilaginous primordia of the long bones, once the chondrogenic aggregates are established (Macias, 1997).
BMP-7-deficient mice show among other mesodermal and skeletal patterning defects, polydactyly in the hindlimbs. A more detailed analysis of the limb phenotype in BMP-7-deficient mice is reported here using in situ hybridization to monitor expression of molecules implicated in patterning processes of the developing vertebrate limb. Sonic hedgehog (Shh) is expressed normally, but Hoxd-13 expression in limb mesenchyme is lower in BMP-7 mutant limbs. Hoxd-11 expression domains are also contracted and decreased in intensity in mutant limbs, suggesting that 5' genes of the Hoxd cluster are coordinately downregulated, while another BMP, BMP-2, which can be activated by Shh, is unaffected. The mutant limb buds are broader than normal buds, and fibroblast growth factor Fgf-8 is expressed throughout the extended ridge. However, expression of the homeobox gene Msx-1, which has been shown to be involved in epithelial-mesenchymal interactions during limb development, is decreased in the mesenchyme of BMP-7 mutant limbs. Taken together, these data suggest that BMP-7 is involved in regulating proliferation and/or epithelial-mesenchymal interactions in the developing limb (Hofmann, 1997).
Osteogenic protein-1 (OP-1, BMP-7), a bone morphogenetic protein in the transforming growth factor-beta superfamily, induces endochondral bone formation in vivo, but the mechanism of action of OP-1 in osteogenesis is not yet established. Three murine clonal cell lines in different stages of differentiation exhibit graded responses to recombinant human OP-1: the mouse embryonal carcinoma ATDC5 cell, with potential for chondroblastic differentiation; the osteoblast-like MC3T3-E1 cell derived from mouse calvaria, and the multipotent fibroblastic C3H10T1/2 cell derived from mouse embryo connective tissue. OP-1 acts on early stage mesenchymal progenitor cells (ATDC5, C3H10T1/2) to induce chondroblastic differentiation. OP-1 also strongly enhances the osteoblastic phenotype of committed osteoblasts (MC3T3-E1), possibly explaining its induction of the endochondral ossification cascade in vivo. Markers of osteoblastic, chondroblastic, and adipocytic differentiation are compared. OP-1 is strongly mitogenic for ATDC5, showing dose-dependent induction of Alcian blue staining, alkaline phosphatase activity, and mRNA expression for collagen types II and IX, and matrix Gla protein. MC3T3-E1 cells do not proliferate or stain with Alcian blue in response to OP-1, but express elevated levels of alkaline phosphatase and osteocalcin. While low-dose OP-1 treatment of C3H10T1/2 induces only adipocyte-like cells filled with lipid droplets, a high dose (500 ng/ml) causes the same cells to also exhibit chondrocytic properties. Thus, OP-1 can induce differentiation along elements of the endochondral ossification pathway according to the stage and potential of the target cell (Asahina, 1996).
Glucocorticoids (GCs) at physiological concentrations promote osteoblast differentiation from fetal calvarial cells, calvarial organ cultures, and bone marrow stromal cells; however, the cellular pathways involved are not known. Bone morphogenetic proteins (BMPs) are recognized as important mediators of osteoblast differentiation. Specific roles for individual BMPs during postembryonic membranous bone formation have yet to be determined. GCs potentiate the osteoblast differentiation effects of BMP-2 and BMP-4, but not of BMP-6, which, by itself, is the most potent of the three. Fetal rat secondary calvarial cultures were used to study the role of BMP-6 during early osteoblast differentiation. Treatment with the GC triamcinolone results in a 5- to 8-fold increase in BMP-6 steady-state messenger RNA levels, peaking at 12 h. In contrast, BMPs-2, -4, -5, -7, and transforming growth factor (TGF)-beta1 messenger RNA levels increase by less than 2-fold, after GC treatment. BMP-6 protein secretion increases 6- to 7-fold by 12 h and 12-fold by 24 h. Treatment of cells with oligodeoxynucleotides antisense to BMP-6 diminishes secretion of BMP-6 protein and significantly inhibits the GC-induced differentiation, as determined by a 10-fold decrease in the number of mineralized bone nodules, compared with controls that were treated with sense oligonucleotides or no oligonucleotides. The antisense oligonucleotide inhibition of differentiation is rescued by treatment with exogenous recombinant human BMP-6. It is concluded that GC-induced differentiation of osteoblasts from the pluripotent precursors is mediated, in part, by BMP-6. These results suggest that BMP-6 has an important and unique role during early osteoblast differentiation (Boden, 1997).
Bone morphogenetic proteins (BMPs) have the unique ability to convert mesenchymal cells into matrix-producing osteoblasts. To understand the mechanism(s) by which a BMP produces a multitude of effects on bone cells, the effects of recombinant human osteogenic protein (OP)-1 (referred to as BMP-7) were examined on the insulin-like growth factor (IGF) regulatory system, an important growth factor system in bone. After 48 h of treatment, OP-1 increases the level of IGF-II (3- and 2-fold, respectively) in the conditioned medium (CM) of SaOS-2 and TE85 human osteosarcoma cells with osteoblastic characteristics, whereas IGF-I levels are low to undetectable in the CM of either cell type. OP-1 treatment has no significant effect on the messenger RNA (mRNA) level for type 1 and type 2 IGF receptors. In TE85 and SaOS-2 cells, 100 ng/ml OP-1 increases the level of IGF binding protein (BP)-3 more than 10-fold, decreases the IGFBP-4 level by 50%, and increases the level of the 29-32.5 kDa IGFBP-5 3-fold in the CM. The effect of OP-1 on IGFBP production is time and dose dependent. The OP-1 induced changes in the levels of IGFBPs are associated with decreased IGFBP-3 and -5 protease activity (29% and 71%, respectively) and proportional changes in IGFBP mRNA levels. OP-1 increases the level of IGFBP-3 mRNA (2- and 10-fold, respectively, after 4 and 24 h of treatment) and of IGFBP-5 mRNA (more than 5-fold after 24 h of treatment) but decreases the level of IGFBP-4 mRNA. OP-1 treatment has no effect on IGFBP-4 protease activity. These results collectively demonstrate that OP-1 can act locally by modulating the IGF regulatory system, suggesting that the mitogenic/differentiative effect of OP-1 on human bone cells may in part be mediated via IGF-II by increasing its secretion, and by regulating the balance between the stimulatory (e.g. IGFBP-5) and inhibitory (e.g. IGFBP-4) classes of IGFBPs both at the level of production (mRNA) and at the level of degradation but not by up-regulating the IGF receptor (Knutsen, 1995).
The effect of recombinant human osteogenic protein-1 (OP-1, or bone morphogenetic protein-7) on growth and maturation was studied in day 11, 15 and 17 chick sternal chondrocytes in high density monolayers, suspension and agarose cultures for up to 5 weeks. OP-1 dose-dependently promotes chondrocyte maturation associated with enhanced alkaline phosphatase activity, and increases mRNA levels and protein synthesis of type X collagen in both the presence and absence of serum. In serum-free conditions, OP-1 promotes cell proliferation and chondrocyte maturation, without requiring either thyroid hormone or insulin, agents known to support chick chondrocyte differentiation in vitro. When grown in agarose under the same conditions, TGF-beta 1 and retinoic acid neither initiated nor promoted chondrocyte differentiation. The results demonstrate that OP-1, as the sole medium supplement, supports the maturation of embryonic chick sternal chondrocytes in vitro (Chen, 1995).
The definitive mammalian kidney forms as the result of reciprocal interactions between the ureteric bud epithelium and metanephric mesenchyme. Since osteogenic protein 1 (OP-1/bone morphogenetic protein 7) is expressed predominantly in the kidney, its involvement during metanephric induction and kidney differentiation was examined. OP-1 mRNA is expressed in the ureteric bud epithelium before mesenchymal condensation and is subsequently seen in the condensing mesenchyme and during glomerulogenesis. Mouse kidney metanephric rudiments cultured without ureteric bud epithelium fail to undergo mesenchymal condensation and further epithelialization, while exogenously added recombinant OP-1 is able to substitute for ureteric bud epithelium in restoring the induction of metanephric mesenchyme. This OP-1-induced nephrogenic mesenchyme differentiation follows a developmental pattern similar to that observed in the presence of the spinal cord, a metanephric inducer. Blocking OP-1 activity using either neutralizing antibodies or antisense oligonucleotides in mouse embryonic day 11.5 mesenchyme, cultured in the presence of metanephric inducers or in intact embryonic day 11.5 kidney rudiment, greatly reduces metanephric differentiation. These results demonstrate that OP-1 is required for metanephric mesenchyme differentiation and plays a functional role during kidney development (Vukicevic, 1996).
In order to identify the primary role(s) for OP-1 in development, whole rat embryo cultures were carried out over a 72-h period from primitive streak stages to early limb bud stages, in rat sera containing either OP-1 blocking antibodies or nonreactive IgG. Rat embryos cultured with control antibodies develop normally, while those cultured with anti-OP-1 antibodies consistently exhibit over-all reduced size and absence of eyes. Histological sections revealed a greater reduction in neural retina development in the embryos treated with anti-OP-1 blocking antibodies. In situ hybridization and immunolocalization analyses indicate that OP-1 is expressed in the neuroepithelium of the optic vesicle at E11.5, is limited to the presumptive neural retina and developing lens placode, and is subsequently expressed in the neural retina, lens and developing cornea at E12.5-E13.5. These results indicate that OP-1 mediates the inductive signals involved in mammalian eye development (Solursh, 1996).
The murine Bmp8a and Bmp8b genes are tightly linked on mouse chromosome 4 and have similar expression during reproduction. Previous studies have shown that targeted mutagenesis of Bmp8b causes male infertility due to germ cell degeneration. Heterozygous and homozygous Bmp8a mutants reveal normal embryonic and postnatal development. Despite high levels of Bmp8a expression in the deciduum, homozygous mutant females have normal fertility, suggesting that the gene is not essential for female reproduction. Bmp8a and Bmp8b are expressed in similar patterns in male germ cells. Unlike homozygous Bmp8b mutants, homozygous mutant Bmp8a males do not show obvious germ cell defects during the initiation of spermatogenesis. However, germ cell degeneration is observed in 47% of adult homozygous mutant Bmp8a males, establishing a role for Bmp8a in the maintenance of spermatogenesis. A small proportion of the mating homozygous mutant Bmp8a males also show degeneration of the epididymal epithelium, indicating a novel role for BMPs in the control of epididymal function (Zhao, 1998).
Bone morphogenetic protein-6 (BMP-6) is a member of the TGF-beta superfamily, which controls growth and differentiation during embryogenesis and acts as an osteoinductive factor in the adult organism. The expression pattern of BMP-6 was examined in adult rat tissues with special emphasis on the liver, since TGF-beta 1, another member of the TGF-beta superfamily, has been shown to play a fundamental role in liver physiology. Rat BMP-6 displays 89.6 and 83.4% homology to mouse and human BMP-6, respectively. BMP-6-specific transcripts are detected in major amounts in lung and in minor quantities in spleen, kidney, heart, brain, and liver. Among the different hepatic cell populations tested BMP-6 expression is confined to nonparenchymal liver cells, namely rat hepatic stellate cells (HSC) and Kupffer cells (KC). During primary culture, BMP-6 expression increases in HSC but declines in KC. Interestingly, TGF-beta 1 stimulates BMP-6 expression of HSC especially at an early time point of culture, while interferon-gamma
downregulates BMP-6 expression. The detection of BMP-6 transcripts in the liver, the cell-type-restricted expression pattern, and its regulation suggest that, in addition to its osteoinductive properties, BMP-6 might play a role in liver
growth and differentiation, in particular after tissue damage (Knittel, 1997).
Extraembryonic ectoderm-derived factors instruct the pluripotent epiblast cells to develop toward a restricted primordial germ cell
(PGC) fate during murine gastrulation. Genes encoding Bmp4 of the Dpp class and Bmp8b of the 60A class are expressed in the
extraembryonic ectoderm: targeted mutation of either results in severe defects in PGC formation. Heterodimers of DPP and 60A classes of bone morphogenetic proteins (BMPs) are more potent than each homodimer in bone and
mesoderm induction in vitro, suggesting that BMP4 and BMP8B may form heterodimers to induce PGCs. To investigate how BMP4 and BMP8B interact and signal for PGC induction, epiblasts of embryonic day 6.0-6.25 embryos were cocultured with BMP4 and BMP8B proteins produced by COS cells. BMP4 or BMP8B homodimers alone cannot induce PGCs whereas they can in combination, providing evidence that two BMP
pathways are simultaneously required for the generation of a given cell type in mammals and also providing a prototype method for PGC induction in vitro.
Furthermore, the PGC defects of Bmp8b mutants can be rescued by BMP8B homodimers whereas BMP4 homodimers cannot mitigate the PGC defects of Bmp4 null mutants, suggesting that BMP4 proteins are also required for epiblast cells to gain germ-line competency before the synergistic action of BMP4 and BMP8B (Ying, 2001).
Mutation of Glass bottom boat, the Drosophila homologue of the bone morphogenetic protein or growth/differentiation factor (BMP/GDF) family of genes in vertebrates, has been shown to disrupt development of neuromuscular junctions (NMJ). This study tested whether this conclusion can be broadened to vertebrate BMP/GDF genes. This analysis was also extended to consider whether such genes are required for NMJ maintenance in post-larval stages, as this would argue that BMP genes are viable candidates for analysis in progressive neuromuscular disease. Zebrafish mutants harboring homozygous null mutations in the BMP-family gene gdf6a were raised to adulthood and assessed for neuromuscular deficits. Fish lacking gdf6a exhibited decreased endurance compared to wild type, and this deficit progressively worsened with age. These fish also presented with significantly disrupted NMJ morphology, and a lower abundance of spinal motor neurons ( approximately 50%,) compared to wild type. Noting the similarity of these symptoms to those of Amyotrophic Lateral Sclerosis (ALS) model mice and fish, it was asked if mutations in gdf6a would enhance the phenotypes observed in the latter, i.e. in zebrafish over-expressing mutant Superoxide Dismutase 1 (SOD1). Among younger adult fish only bigenic fish harboring both the SOD1 transgene and gdf6a mutations, but not siblings with other combinations of these gene modifications, displayed significantly reduced endurance and strength/power, as well as disrupted NMJ morphology compared to wild type siblings. Bigenic fish also had lower survival rates compared to other genotypes. Thus conclusions regarding a role for BMP ligands in effecting NMJ can be extended to vertebrates, supporting conservation of mechanisms relevant to neuromuscular degenerative diseases. These conclusions synergize with past findings to argue for further analysis of GDF6 and other BMP genes as modifier loci, potentially affecting susceptibility to ALS and perhaps a broader suite of neurodegenerative diseases (Duval, 2014).
Search PubMed for articles about Drosophila glass bottom boat/Transforming growth factor beta at 60A
Arkell, R. and Beddington, R. S. (1997). BMP-7 influences pattern and growth of the developing hindbrain of mouse embryos. Development 124(1): 1-12. PubMed Citation: 9006062
Asahina, I., Sampath, T. K. and Hauschka, P. V. (1996). Human osteogenic protein-1 induces chondroblastic, osteoblastic, and/or adipocytic differentiation of clonal murine target cells. Exp. Cell Res. 222(1): 38-47. PubMed Citation: 8549671
Ball, R. W., Warren-Paquin, M., Tsurudome, K., Liao, E. H., Elazzouzi, F., Cavanagh, C., An, B. S., Wang, T. T., White, J. H., Haghighi, A. P. (2010). Retrograde BMP signaling controls synaptic growth at the NMJ by regulating trio expression in motor neurons. Neuron 66: 536-549. PubMed ID: 20510858
Ballard, S. L., Jarolimova, J. and Wharton, K. A. (2010). Gbb/BMP signaling is required to maintain energy homeostasis in Drosophila. Dev Biol. 337: 375-385. PubMed ID: 19914231
Bangi, E. and Wharton, K. (2006a). Dpp and Gbb exhibit different effective ranges in the establishment of the BMP activity gradient critical for Drosophila wing patterning. Dev. Biol. 295(1): 178-93. Medline abstract: 16643887
Bangi, E. and Wharton, K. (2006b). Dual function of the Drosophila Alk1/Alk2 ortholog Saxophone shapes the Bmp activity gradient in the wing imaginal disc.
Development 133(17): 3295-303. Medline abstract: 16887821
Barber, C. F., Jorquera, R. A., Melom, J. E., Littleton, J. T. (2009). Postsynaptic regulation of synaptic plasticity by synaptotagmin 4 requires both C2 domains. J Cell Biol 187: 295-310. PubMed ID: 19822673
Berke, B., Wittnam, J., McNeill, E., Van Vactor, D. L. and Keshishian, H. (2013). Retrograde BMP signaling at the synapse: a permissive signal for synapse maturation and activity-dependent plasticity. J Neurosci 33: 17937-17950. PubMed ID: 24198381
Boden, S. D., et al. (1997). Glucocorticoid-induced differentiation of fetal rat calvarial osteoblasts is
mediated by bone morphogenetic protein-6. Endocrinology 138(7): 2820-2828. PubMed Citation: 9202223
Brody, T., Yavatkar, A., Kuzin, A. and Odenwald, W. F. (2020). Ultraconserved non-coding DNA within Diptera and Hymenoptera. G3 (Bethesda). PubMed ID: 32601058
Callejo, A., et al. (2011). Dispatched mediates Hedgehog basolateral release to form the long-range morphogenetic gradient in the Drosophila wing disk epithelium. Proc. Natl. Acad. Sci. 108: 12591-12598. PubMed Citation: 21690386 Chen, P., et al. (1995). Osteogenic protein-1 promotes growth and maturation of chick sternal
chondrocytes in serum-free cultures. J. Cell Sci. 108( Pt 1): 105-114. PubMed Citation: 7738088
Chen, Y., et al. (1998). A genetic screen for modifiers of Drosophila decapentaplegic signaling
identifies mutations in punt, Mothers against dpp and the BMP-7
homologue, 60A. Development 125(9): 1759-1768. PubMed Citation: 9521913
Chen, J., et al. (2012). Crossveinless d is a vitellogenin-like lipoprotein that binds BMPs and HSPGs, and is required for normal BMP signaling in the Drosophila wing. Development 139(12): 2170-6. PubMed Citation: 22573617
Childs, S. R., Wrana, J. L., Arora, K., Attisano, L., OConnor, M. B. and
Massagué, J. (1993). Identification of a Drosophila activin receptor. Proc.
Natl. Acad. Sci. 90: 9475-9479. PubMed Citation: 8415726
Conley, C. A., et al. (2000). Crossveinless 2 contains cysteine-rich domains and is required for high
levels of BMP-like activity during the formation of the cross veins in
Drosophila. Development 127: 3947-3959. PubMed Citation: 10952893
Dale, J. K., et al. (1997). Cooperation of BMP7 and SHH in the induction of forebrain ventral
midline cells by prechordal mesoderm. Cell 90(2): 257-269. PubMed Citation: 9244300
Dani, N., Nahm, M., Lee, S. and Broadie, K. (2012). A targeted glycan-related gene screen reveals heparan sulfate proteoglycan sulfation regulates WNT and BMP trans-synaptic signaling. PLoS Genet 8: e1003031. PubMed ID: 23144627
DiLeone, R. J., Russell, L. B. and Kingsley, D. M. (1998). An extensive 3' regulatory region controls expression of Bmp5 in specific
anatomical structures of the mouse embryo. Genetics 148(1): 401-408. PubMed Citation: 9475750
Doctor, J. S., et al. (1992). Sequence, biochemical characterization, and developmental expression of a
new member of the TGF-beta superfamily in Drosophila melanogaster. Dev. Biol. 151(2): 491-505. PubMed Citation: 1601181
Du, W. and Doctor, J. S. (1996). Isolation and sequence of the Drosophila virilis 60 A gene, a
transforming growth factor-beta superfamily member related to
vertebrate bone morphogenetic proteins. Biochim. Biophys. Acta 1307(3): 273-279. PubMed Citation: 8688461
Dudley, A. T. and Robertson, E. J. (1997). Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev. Dyn. 208(3): 349-362. PubMed Citation: 9056639
Duval, M. G., Gilbert, M. J., Watson, D. E., Zerulla, T. C., Tierney, K. B. and Allison, W. T. (2014). Growth differentiation factor 6 as a putative risk factor in neuromuscular degeneration. PLoS One 9: e89183. PubMed ID: 24586579
Eaton, B. A., Fetter, R. D. and Davis, G. W. (2002). Dynactin is necessary for synapse stabilization. Neuron 34: 729-741. 12062020
Eaton, B. A. and Davis, G. W. (2005). LIM kinase1 controls synaptic
stability downstream of the type II BMP receptor. Neuron 47: 695-708. 16129399
Fritsch, C., et al. (2012). Different requirements for proteolytic processing of bone morphogenetic protein 5/6/7/8 ligands in Drosophila melanogaster. J. Biol. Chem. 287(8): 5942-53. PubMed Citation: 22199351
Fuentes-Medel, Y., Ashley, J., Barria, R., Maloney, R., Freeman, M. and Budnik, V. (2012). Integration of a retrograde signal during synapse formation by glia-secreted TGF-beta ligand. Curr Biol 22: 1831-1838. PubMed ID: 22959350
Fung, W. Y., Fat, K. F., Eng, C. K. and Lau C. K. (2007). crm-1 facilitates BMP signaling to control body size in Caenorhabditis elegans. Dev. Biol. 311: 95-105. PubMed Citation: 17869238
Furuta, Y., Piston, D. W. and Hogan, B. L. (1997). Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development 124(11): 2203-2212. PubMed Citation: 9187146
Garcia-Bellido, A. and de Celis, J. F. (1992). Developmental genetics of the venation pattern of Drosophila. A. Rev. Genet. 1992 26: 277-304. PubMed Citation: 1482114
Golden, J. A., et al. (1999). Ectopic bone morphogenetic proteins 5 and 4 in the chicken forebrain lead to cyclopia and holoprosencephaly. Proc. Natl. Acad. Sci. 96(5): 2439-2444. PubMed Citation: 10051661
Goold, C. P. and Davis, G. W. (2007). The BMP Ligand Gbb gates the expression of synaptic homeostasis independent of synaptic growth control. Neuron 56: 109-123. Medline abstract: 17920019
Griffith, D. L., et al. (1996). Three-dimensional structure of recombinant human osteogenic protein 1:
structural paradigm for the transforming growth factor beta superfamily. Proc. Natl. Acad. Sci. 93(2): 878-883
Haerry, T. E., et al. (1998). Synergistic signaling by two BMP ligands through the SAX
and TKV receptors controls wing growth and patterning in
Drosophila. Development 125(20): 3977-3987
Haghighi, A. P., McCabe, B. D., Fetter, R. D., Palmer, J. E., Hom, S. and Goodman, C. S. (2003). Retrograde control of synaptic transmission by postsynaptic CaMKII at the Drosophila neuromuscular junction. Neuron 39: 255-267. 12873383
Hofmann, C., et al. (1996). Analysis of limb patterning in BMP-7-deficient mice. Dev. Genet. 19(1): 43-50
Hong, S. H., Kang, M., Lee, K. S. and Yu, K. (2016). High fat diet-induced TGF-beta/Gbb signaling provokes insulin resistance through the tribbles expression. Sci Rep 6: 30265. PubMed ID: 27484164
Israel, D. I., et al. (1996). Heterodimeric bone morphogenetic proteins show enhanced activity in
vitro and in vivo. Growth Factors 13(3-4): 291-300
Fung, W. Y., et al. (2007). crm-1 facilitates BMP signaling to control body size in Caenorhabditis elegans. Dev. Biol. 311: 95-105. PubMed Citation: 17869238
James, R. E. and Broihier, H. T. (2011). Crimpy inhibits the BMP homolog Gbb in motoneurons to enable proper growth control at the Drosophila neuromuscular junction. Development 138(15): 3273-86. PubMed Citation: 21750037
James, R. E., Hoover, K. M., Bulgari, D., McLaughlin, C. N., Wilson, C. G., Wharton, K. A., Levitan, E. S. and Broihier, H. T. (2014). Crimpy enables discrimination of presynaptic and postsynaptic pools of a BMP at the Drosophila neuromuscular junction. Dev Cell 31: 586-598. PubMed ID: 25453556
Jones, W. K., et al. (1994). Osteogenic protein-1 (OP-1) expression and processing in Chinese hamster
ovary cells: isolation of a soluble complex containing the mature and
pro-domains of OP-1. Growth Factors 11(3): 215-225
Jena, N., et al. (1997). BMP7 null mutation in mice: developmental defects in skeleton, kidney,
and eye. Exp. Cell Res. 230(1): 28-37
Kawase, E., Wong, M. D., Ding, B. C. and Xie, T. (2004). Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis.
Development 131(6): 1365-75. 14973292
Khalsa, O., et al. (1998). TGF-beta/BMP superfamily members, Gbb-60A and Dpp, cooperate to provide
pattern information and establish cell identity in the Drosophila wing. Development 125: 2723-2734
Kim, S., Wairkar, Y. P., Daniels, R. W. and DiAntonio, A. (2010),
The novel endosomal membrane protein Ema interacts with the class C Vps-HOPS complex to promote endosomal maturation. J. Cell Biol. 188(5): 717-34. PubMed Citation: 20194640
Kirilly, D., Spana, E. P., Perrimon, N., Padgett, R. W. and Xie, T. (2005).
BMP signaling is required for controlling somatic stem cell self-renewal in the Drosophila ovary. Dev. Cell 9(5): 651-62. 16256740
Knittel, T., et al. (1997). Bone morphogenetic protein-6 is expressed in nonparenchymal liver cells
and upregulated by transforming growth factor-beta 1. Exp. Cell Res. 232(2): 263-269
Knutsen, R., et al. (1995). Regulation of insulin-like growth factor system components by osteogenic
protein-1 in human bone cells. Endocrinology 136(3): 857-865
Korkut, C., Li, Y., Koles, K., Brewer, C., Ashley, J., Yoshihara, M., Budnik, V. (2013). Regulation of postsynaptic retrograde signaling by presynaptic exosome release. Neuron 77: 1039-1046. PubMed ID: 23522040
Kundu M., Kuzin A., Lin T. Y., Lee C. H., Brody T. et al., (2013). Cis-regulatory complexity within a large non-coding region in the Drosophila genome. PLoS One 8: e60137 10.137. PubMed ID: 23613719
Le Dréau, G., et al. (2011). Canonical BMP7 activity is required for the generation of discrete neuronal populations in the dorsal spinal cord. Development 139(2): 259-68. PubMed Citation: 22159578
Lein. P., et al. (1995). Osteogenic protein-1 induces dendritic growth in rat sympathetic neurons. Neuron 15(3): 597-605
Lein, P., et al. (1996). The effects of extracellular matrix and osteogenic protein-1 on the morphological differentiation of rat sympathetic neurons. Int. J. Dev. Neurosci. 14(3): 203-215
Luo, G., et al. (1995). BMP-7 is an inducer of nephrogenesis, and is also required for eye
development and skeletal patterning. Genes Dev. 9(22): 2808-2820
Lyons, K. M., Hogan, B. L. and Robertson, E. J. (1995). Colocalization of BMP 7 and BMP 2 RNAs suggests that these factors cooperatively mediate tissue interactions during murine development. Mech. Dev. 50(1):71-83
Macias, D., et al. (1997). Role of BMP-2 and OP-1 (BMP-7) in programmed cell death and
skeletogenesis during chick limb development. Development 124(6): 1109-1117
Marqués, G., et al. (2003). Retrograde Gbb signaling through the Bmp type 2 receptor Wishful thinking regulates systemic FMRFa expression in Drosophila. Development 130: 5457-5470. 14507784
McCabe, B. D., et al. (2003). The BMP homolog Gbb provides a retrograde signal that regulates synaptic growth at the Drosophila neuromuscular junction. Neuron 39: 241-254. 12873382
Miya, T., et al. (1996). An ascidian homologue of vertebrate BMPs-5-8 is expressed in the midline
of the anterior neuroectoderm and in the midline of the ventral epidermis
of the embryo. Mech. Dev. 57(2): 181-190
Nahm, M., et al. (2010a), The Cdc42-selective GAP rich regulates postsynaptic development and retrograde BMP transsynaptic signaling. J Cell Biol 191: 661–675. PubMed ID: 21041451
Nahm M, et al. (2010b). dCIP4 (Drosophila Cdc42-interacting protein 4) restrains synaptic growth by inhibiting the secretion of the retrograde Glass bottom boat signal. J Neurosci 30: 8138–8150. PubMed ID: 20554864
Newfeld, S. J. and Gelbart, W. M. (1995). Identification of two Drosophila TGF-beta family members in the
grasshopper Schistocerca americana. J. Mol. Evol. 41(2): 155-160
Nishitoh, H., et al. (1996). Identification of type I and type II serine/threonine kinase receptors for
growth/differentiation factor-5. J. Biol. Chem. 271(35): 21345-21352
Pennisi D. J., et al. (2007). Crim1KST264/KST264 mice display a disruption of the Crim1 gene resulting in perinatal lethality with defects in multiple organ systems. Dev. Dyn. 236: 502-511. PubMed Citation: 17106887
Piccioli, Z. D., Littleton, J. T. (2014). Retrograde BMP signaling modulates rapid activity-dependent synaptic growth via presynaptic LIM kinase regulation of cofilin. J Neurosci 34: 4371-4381. PubMed ID: 24647957
Raftery, L.A. and Sutherland, D. J. (1999). TGF-beta family signal transduction in Drosophila development: from Mad to Smads. Dev. Biol. 210(2): 251-68
Ray, T. P. and Wharton, K. A. (2001). Context-dependent relationships between the BMPs gbb and dpp during development of the Drosophila wing imaginal disk. Development 128: 3913-3925. 11641216
Rodal, A. A., et al. (2011). A presynaptic endosomal trafficking pathway controls synaptic growth signaling. J. Cell Biol. 193(1): 201-17. PubMed Citation: 21464232
Rojas-Ríos, P., Guerrero, I. and González-Reyes, A. (2012). Cytoneme-mediated delivery of hedgehog regulates the expression of bone morphogenetic proteins to maintain germline stem cells in Drosophila. PLoS Biol 10(4): e1001298. PubMed Citation: 22509132 Roy, S., Hsiung, F. and Kornberg T. B (2011). Specificity of Drosophila cytonemes for distinct signaling pathways. Science 332: 354-358. PubMed Citation: 21493861 Ruberte, E., Narty, T., Nellen, D., Affolter, M. and Basler, K. (1995). An
absolute requirement for both the type II and type I receptors, Punt and
thickveins, for dpp signaling in vivo. Cell 80: 889-897
Sampath, T. K., et al (1993). Drosophila TGF-beta superfamily proteins induce endochondral
bone formation in mammals. Proc. Natl. Acad. Sci 90: 6004-6008
Shimmi, O., Umulis, D., Othmer, H. and O'Connor, M. B. (2005a).
Facilitated transport of a Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm embryo. Cell 120(6): 873-86. PubMed Citation: 15797386
Shimmi, O., Ralston, A., Blair, S. S. and O'Connor, M. B. (2005b). The crossveinless gene encodes a new member of the Twisted gastrulation family of BMP-binding proteins which, with Short gastrulation, promotes BMP signaling in the crossveins of the Drosophila wing. Dev. Biol. 282(1): 70-83. PubMed Citation: 15936330
Shivdasani, A. A. and Ingham, P. W. (2003). Regulation of stem cell maintenance and transit amplifying cell proliferation by TGF-ß signaling in Drosophila spermatogenesis. Curr. Biol. 13: 2065-2072. 14653996
Smith, R. B., Machamer, J. B., Kim, N. C., Hays, T. S. and Marqués, G.. (2012). Relay of retrograde synaptogenic signals through axonal transport of BMP receptors. J. Cell Sci. [Epub ahead of print]. PubMed Citation: 22573823
Solloway, M. J., et al. (1998). Mice lacking Bmp6 function. Dev. Genet. 22(4): 321-339
Solursh, M., et al. (1996). Osteogenic protein-1 is required for mammalian eye development. Biochem. Biophys. Res. Commun. 218(2): 438-443
Song, X., et al. (2004). Bmp signals from niche cells directly repress transcription of a differentiation-promoting gene, bag of marbles, in germline stem cells in the Drosophila ovary.
Development 131(6): 1353-64. 14973291
Staehling-Hampton, K. (1994). Specificity of bone morphogenetic protein-related factors: cell fate and gene
expression changes in Drosophila embryos induced by decapentaplegic but
not 60A. Cell Growth Differ 5(6): 585-593. PubMed Citation: 8086336
Sulkowski, M., Kim, Y. J. and Serpe, M. (2013). Postsynaptic glutamate receptors regulate local BMP signaling at the Drosophila neuromuscular junction. Development 141(2):436-47. PubMed ID: 24353060
Suzuki, A., et al. (1997). Mesoderm induction by BMP-4 and -7 heterodimers. Biochem. Biophys. Res. Commun. 232(1): 153-156. PubMed Citation: 9125121
Tauscher, P. M., Gui, J. and Shimmi, O. (2016). Adaptive protein divergence of BMP ligands takes place under developmental and evolutionary constraints. Development 143(20):3742-3750. PubMed ID: 27578781
Tolias, K. F., Duman, J. G., Um, K. (2011). Control of synapse development and plasticity by Rho GTPase regulatory proteins. Prog Neurobiol 94: 133-148. PubMed ID: 21530608
Veverytsa, L. and Allan, D. W. (2011). Retrograde BMP signaling controls Drosophila behavior through regulation of a peptide hormone battery. Development 138(15): 3147-57. PubMed Citation: 21750027
Vilmos, P., et al. (2005). Crossveinless defines a new family of Twisted-gastrulation-like modulators of bone morphogenetic protein signalling. EMBO Rep. 6: 262-267. PubMed Citation: 15711536
Vukicevic, S., et al (1996). Induction of nephrogenic mesenchyme by osteogenic protein 1 (bone morphogenetic protein 7). Proc. Natl. Acad. Sci. 93(17): 9021-9026
Wharton, K. A., Thomsen, G. H. and Gelbart, W. M. (1991). Drosophila
60A gene, a new TGF-beta family member is closely related to human bone
morphogenetic proteins. Proc. Natl. Acad. Sci. 88(20): 9214-9218
Wharton, K. A., et al. (1999). Genetic analysis of the bone morphogenetic protein-related gene, gbb, identifies multiple requirements during Drosophila development. Genetics 152: 629-640
Wilkinson, L., et al. (2003). CRIM1 regulates the rate of processing and delivery of bone morphogenetic proteins to the cell surface. J. Biol. Chem. 278: 34181-34188. PubMed Citation: 12805376
Yamashita, H., et al. (1995). Osteogenic protein-1 binds to activin type II receptors and induces certain
activin-like effects. J. Cell Biol.. 130(1): 217-226
Ying, Y., Qi, X. and Zhao, G.-Q. (2001). Induction of primordial germ cells from murine epiblasts by synergistic action of BMP4 and BMP8B signaling pathways. Proc. Natl. Acad. Sci. 98: 7858-7862. 11427739
Yoshihara, M., Adolfsen, B., Galle, K. T., Littleton, J. T. (2005). Retrograde signaling by Syt 4 induces presynaptic release and synapse-specific growth. Science 310: 858-863. PubMed ID: 16272123
Yu, K., et al. (2000). Processing of the Drosophila Sog protein creates a novel BMP inhibitory
activity. Development 127: 2143-2154. 10769238
Yu, K., et al. (2004). Cysteine repeat domains and adjacent sequences determine distinct Bone morphogenetic protein modulatory activities of the Drosophila Sog protein. Genetics 166: 1323-1336. 15082551
Zhao, G. Q., Liaw. L. and Hogan, B. (1998). Bone morphogenetic protein 8A plays a role in the maintenance of
spermatogenesis and the integrity of the epididymis. Development 125(6): 1103-1112. PubMed ID: 9463357
date revised: 10 April 2026
Home page: The Interactive Fly © 2026 Thomas Brody, Ph.D.
A screen was carried out for dominant enhancer mutations magnifying the effects of a
hypomorphic allele of thick veins (tkv), a type I receptor for dpp.
tkv 6 is a mutation in a splice acceptor site that results in
aberrant in-frame splicing, deleting two extracellular amino
acids of the receptor. When expressed in COS1 cells, the
mutant receptor fails to bind BMP-2 homodimers. However, tkv 6 behaves genetically as a hypomorph. In contrast to the embryonic lethal tkv null alleles, tkv 6 is
homozygous viable: the only visible phenotype is the thickened wing veins. All other imaginal-disc-derived
structures of tkv 6 homozygotes appear normal. Interestingly, tkv 6/Df(2L)tkv2 flies are phenotypically identical to tkv 6 homozygotes. To test if tkv 6 is a suitable genetic background for a modifier screen, the effects of lowering the activity of other known dpp pathway components were examined. Heterozygous mutations in shn or punt enhance the tkv 6 homozygous phenotype. In the tkv 6 background, shn IB is a dominant enhancer of the venation pattern in the wing and the proximal/distal patterning of the leg. In the wing, longitudinal vein 2 fails to reach the wing margin. In the leg, distal elements such as claws and distal tarsal segments are deleted. Such phenotypes are reminiscent of hypomorphic dpp phenotypes. punt 135 also enhances the tkv 6 phenotypes. Based on these observations, it was reasoned that the dpp signaling output through the mutant receptor tkv 6 is near the threshold for proper patterning of the imaginal discs. The tkv 6 mutation is therefore an appropriate genetic background for identifying
new components essential for mediating dpp signaling.
Enhancers of tkv 6 are phenotypically similar to dpp
mutants. The enhancers are recessive lethal in a wild-type background. tkv 6
homozygotes that are heterozygous for the enhancer mutations
have defects in imaginal disc development. During pupal development, the dorsal proximal region of the two wing imaginal discs fuse to form the adult notum. A heterozygous mutation, mapping to Tgfbeta-60A, causes deletions of distal and dorsal structures and occasional duplication of ventrolateral structures such as sex combs on male prothoracic legs. These phenotypes are indistinguishable from those of dpp disk alleles, suggesting that this enhancer acts in the dpp signal transduction pathway (Chen, 1998).
Biological Overview