homothorax
In the embryonic midgut both Decapentaplegic (Dpp) and Wingless (Wg) signaling pathways control the subcellular
localization of Extradenticle protein. Exd
protein is predominantly nuclear in endoderm cells close to the Dpp-and Wg-secreting
cells of the visceral mesoderm, but is found in the cytoplasm in more distant endoderm cells.
Both dpp and wg are required for the nuclear localization of Exd in the endoderm; ectopic expression of dpp and wg expands the domain of nuclear Exd (Mann, 1996). The requirement of Hth for Exd's nuclear localization is apparent in many embryonic tissues, including the ectoderm, visceral mesoderm, and endoderm. This requirement is observed in cells where the signaling molecules Wg and Dpp contribute to Exd's nuclear translocation (e.g., the endoderm). It is suggested that Wg and Dpp both regulate expression of hth in the domains in which Exd nuclear function is required (Rieckhof, 1997).
homothorax expression is regulated by genes of the bithorax
complex. Starting at germband extension, and throughout the rest of
embryonic development, hth expression is modulated in a
segment-specific fashion. Most notable is the repression of hth
expression in the ectoderm and VNC of abdominal segments
during late stages of embryonic development. The genes of the homeotic complexes are the major regulators of segmental identity. hth expression has therefore been analyzed in embryos deficient for the abd-A gene, or the abd-A and Ubx genes together. In the absence of abd-A activity, hth expression is derepressed in the abdominal ectoderm in cells
along the segment boundaries. In the absence of both abd-A and Ubx, the derepression is more prominent; hth is expressed in ectodermal cells throughout the segment. In addition, a uniform level of the Hth protein is observed in all the thoracic and abdominal neuromers of
Df(3R)Ubx 109 homozygous embryos (Kurant, 1998).
Mutations in the clustered homeotic genes (HOM-C genes) can cause specific
homeotic transformation, suggesting that the HOM-C genes determine segmental identities by acting on different target genes. However, misexpression of several
HOM-C genes in the antenna disc causes similar antenna-to-leg transformations. No HOM-C genes are normally expressed in the eye-antenna disc proper. It has been considered that Antp, when ectopically expressed in the eye-antenna disc, suppresses an antenna-determining gene. This study shows that Scr, Antp, Ubx, and abd-A HOM-C genes all exert their
effects through a common mechanism: suppression of the transcription of the homothorax (hth) homeobox gene, thereby preventing the nuclear localization of the
Extradenticle homeodomain protein. If hth is a key effector suppressed by these four HOM-C genes, addition of hth should reverse the antennal transformations. Coexpression of the hth and HOM-C genes completely or partially reverts the transformation phenotype. It is noted, however, that suppression of hth is probably not the only effect of HOM-C expression in the antenna disc, since Scr, Antp, and Ubx each induce the antenna to transform into leg, showing different segmental characters (i.e., thoracic 1, thoracic 2 and thoracic 3 legs, respectively). Ectopic hth expression can cause duplication of the proximodistal axis of the antenna, suggesting that it is
involved in proximodistal development of the antenna (Yao, 1999).
A possible mechanism for the suppression of hth by different HOM-C proteins assumes that the HOM-C proteins compete with a factor required for hth transcription. One candidate protein that fits all of these criteria is Hth itself. The gene spineless exhibits a similar antenna-determining function. It is possible that hth and spineless represent separate pathways specifying antennal identity. Since hth and ss are expressed in the leg discs as well as in the antenna discs, it is not their simple presence that determines antennal identity. What then distinguishes the antenna vs. the leg? One possibility is that the detailed spatial and temporal expression pattern makes the difference. The broader expression pattern of hth in the antenna disc may distinguish the antenna from the leg. It is also possible that the level of spineless makes a difference: high levels of ss correlate with antennal identity and low levels of ss correlate with leg identity. The duplication in the antenna caused by ectopic hth could be explained by the creation of a new proximodistal interface in the distal portion region of the disc. In both antenna and leg discs, Distal-less is expressed in the distal regions and is required for distal development. The roughly complementary expression of hth/nuclear Exd vs. Dll, defines the proximal and distal domains of appendages, respectively. The combined action of Wg and Dpp signaling defines the two domains by activating Dll and repressing hth in the distal domain. Antennal duplication due to ectopic hth could be explained by the juxtaposition of distal (Dll expressing) and proximal (hth expressing) cells (Yao, 1999 and references)
To determine if Exd cooperates with Scr to control salivary gland gene expression, the accumulation
of two early salivary gland proteins, CrebA and
Trh, was examined in embryos lacking exd function. Zygotic loss of exd
function results in a reduction in the number of
salivary gland cells expressing CrebA and Trh, as well
as a decrease in the level of protein made in these cells. This reduced level of salivary gland
protein expression is not as severe as the one seen in Scr mutant
embryos. Unlike SCR, EXD mRNA is
supplied maternally and, thus,
the maternal contribution may partially compensate for the
loss of zygotic function. To test this possibility, the maternal
contribution of exd was removed using the FLP-FRT
system. In embryos lacking
maternal exd function, salivary gland expression of
CrebA and Trh is at wild-type levels. However, salivary gland expression of CrebA and
Trh is completely absent in embryos lacking both the
maternal and the zygotic contributions of exd. Thus, exd is required for embryonic salivary
gland gene expression. Moreover, zygotically provided exd
can rescue the loss of maternally provided exd and maternally
provided exd can partially compensate for zygotic loss
of exd (Henderson, 2000).
Since Scr, exd, and hth are required for salivary gland
formation, the mRNA and/or protein expression
patterns of these genes during normal salivary gland
formation were examined. During stages 9 and 10, when salivary gland gene
expression is established, Scr and hth are expressed in the
salivary gland primordia, as well as other tissues, and Hth
and Exd are nuclear. During stage 11, after the establishment of early
salivary gland gene expression, the salivary glands begin to
invaginate. At this stage, there are several changes in the
expression and/or localization of these genes and/or proteins
in the salivary gland cells: Scr and hth transcripts
disappear, Hth protein disappears, and Exd protein becomes
cytoplasmic (Henderson, 2000).
Hth is known to regulate the nuclear entry of Exd in
other cells of the embryo and in the imaginal discs. In
embryos lacking hth function, Exd is cytoplasmic throughout
the embryo, including the cells of the salivary gland
primordia. Since Hth is required for the activity of Exd,
and Exd is required to maintain Scr expression in the
salivary gland primordia, the expression
of Scr in embryos lacking hth function was also examined. As observed in
exd minus embryos, neither SCR mRNA nor Scr protein expression
is maintained in the ventral cells of PS2 in hth mutants. Exd is required for the stability
of Hth throughout the embryo and, correspondingly,
a loss in Hth protein stability, but not HTH transcript
accumulation is observed in exd mutant embryos. Thus,
hth maintains the expression of Scr in the salivary gland
primordia and regulates the nuclear localization of Exd
throughout the embryo, including the cells of the salivary
gland primordia. Furthermore, exd is required for accumulation
of Hth (Henderson, 2000).
Scr, Exd, and Hth are expressed in the salivary gland
primordia when salivary gland gene expression is established.
Once the salivary gland cells begin to invaginate, the
expression and/or localization of all three proteins changes
in the salivary gland primordia. This result indicates that a
gene(s) expressed in the salivary gland primordia during
stage 11 is required for these changes in gene expression and
protein localization. Since hth expression is specifically lost
in the salivary gland primordia, a test was performed to see if Scr regulates hth
expression in the salivary gland primordia. In embryos
lacking Scr function, HTH mRNA and Hth protein are
maintained in the cells that would normally form the
salivary gland beyond stage 11. Correspondingly, Exd remains
nuclear in the ventral cells of PS2 in embryos lacking Scr
function. Therefore Scr is required to
repress hth expression in the cells of the salivary gland
primordia during stage 11. The loss of hth expression
consequently leads to the loss of nuclear Exd accumulation (Henderson, 2000).
Since Scr may act either directly or indirectly to shut off
hth expression, the expression of hth was examined in
embryos mutant for two early salivary gland genes that
encode transcription factors: fkh, which encodes a winged-helix
transcription factor related to mammalian HNF-3beta, and Creb-A, which encodes a beta-Zip
protein that binds cyclic-AMP-response elements. No change in hth expression is seen in
embryos lacking either fkh or Creb-A function. Therefore, Scr does not act through fkh or
Creb-A to shut off hth transcription.
These findings suggest that prior to stage 11, Hth regulates
the nuclear entry of Exd in the salivary gland primordia.
During stage 11, Hth is no longer expressed in these cells
and, as a consequence, Exd localizes to the cytoplasm.
Without Exd and Hth in the nucleus, Scr expression is not
maintained. To test this idea, hth expression
was maintained in cells of the salivary gland primordia using the
GAL4-UAS system. This expression
pattern was achieved using a fkh-GAL4 construct
to drive expression of UAS-hth in the
salivary gland secretory cell primordia from stage 10 onward.
When hth was expressed under the control of the
fkh-GAL4 driver, Hth protein could be detected in the
salivary gland nuclei throughout embryogenesis. Correspondingly, Exd and Scr were
detected in the salivary gland until late stages of embryogenesis. These results
indicate that Hth is not only necessary, but is also sufficient,
to maintain Scr expression in the salivary gland (Henderson, 2000).
In
the wing blade, wingless activates the gene vestigial (vg), which
is required for the wing blade to grow. wg is also required
for hinge development, but wg does not activate vg in the
hinge, raising the question of what target genes are
activated by wg to generate hinge structures. wg is shown to activate the gene homothorax (hth) in the hinge
and hth is shown to be necessary for hinge development. Further,
hth also limits where along the D/V
compartment boundary wing blade development can
initiate, thus helping to define the size and position of the
wing blade within the disc epithelium. teashirt (tsh), which is coexpressed with hth
throughout most of wing disc development, collaborates
with hth to repress vg and block wing blade development.
These results suggest that tsh and hth block wing blade
development by repressing some of the activities of the
Notch pathway at the D/V compartment boundary (Casares, 2000).
The overlap between wg and high levels of hth in the hinge
region suggested that wg might play a role in
activating hth in this region of the wing disc. Four experiments tested this idea. (1) hth expression was examined in discs in which the wg signaling cascade was compromised due to the expression of a dominant negative
form of dTCF, a downstream transcription factor in the wg
signal transduction pathway. Expression of dominant negative dTCF (dTCFDN) using ptc-Gal4 results in the repression of hth in the hinge. Similar results are obtained when flip-out clones expressing dTCFDN are
generated in the hinge between 72 and 96 hours of
development. (2) A second piece of evidence supporting a role for wg in the
upregulation of hth is the finding that in wgspd-fg mutant discs, in which wg expression is specifically reduced in the IR of third
instar discs, hth expression is no longer upregulated. (3) Clones of cells doubly mutant for frizzled1 and frizzled2 (fz1-;fz2-), which are required for the reception of the Wg signal, were generated. fz1-;fz2- clones show a cell-autonomous loss of hth expression. These findings suggest that wg signaling, mediated by the Frizzled family of receptors, is required for
high levels of hth expression in the hinge region of wing discs.
(4) A test was performed to see if ectopic expression of wg could trigger the expression of hth in more proximal regions
of the wing disc, where hth levels are usually low and tsh levels
are high. Based on the expression patterns of tsh and hth in third instar discs, it was predicted that, if induced by wg, hth would also repress tsh. Flip-out clones of wild-type (secreted) Wg or of a membrane-tethered, and therefore non-diffusable, form of Wg, Nrt-Wg were generated, and the expression of wg, hth and tsh were monitored. Expression of either Wg or Nrt-Wg in clones in the notum (just dorsal to the hinge region) non-autonomously induces high levels of hth and repressed tsh, recapitulating the situation found in the wild-type hinge. In contrast to clones induced in the notum portion of the disc, Nrt-Wg was never observed to
activate hth in the wing pouch. Instead, activation of the
Wg pathway in the wing pouch induces higher levels of vg expression.
These data suggest that hth is a wg target gene in the
wing hinge. In addition, they suggest that, in response to
wg, cells in the wing pouch are biased in favor of
activating vg, whereas in more proximal positions, induction
of hth is favored (Casares, 2000).
The gene homothorax is required for the nuclear import of Extradenticle, The functions of exd/hth and of the
Hh/Wg/Dpp pathway are mutually antagonistic: exd blocks the response
of Hh/Wg/Dpp target genes such as optomotor-blind and
dachshund; high levels of Wg and Dpp eliminate exd function by repressing hth. This
repression is mediated by the activity of Dll and dac.
One prerequisite for
appendage development is the inactivation of the exd/hth
genes (Azpiazu, 2000 and references therein).
htx is originally expressed
uniformly in the wing imaginal disc but, during
development, its activity is restricted to the cells that form
the thorax and the hinge, where the wing blade attaches to
the thorax, and it is eliminated in the wing pouch, which forms
the wing blade. Repression of hth in the wing
pouch is a prerequisite for wing development; forcing hth
expression prevents growth of the wing blade. Both the Dpp
and the Wg pathways are involved in hth repression. Cells
unable to process the Dpp signal (lacking thick veins or Mothers against Dpp activity) or the Wg signal (lacking dishevelled
function) express hth in the wing pouch. vestigial has been identified as a Wg and Dpp response factor
that is involved in hth control. In contrast to its repressing
role in the wing pouch, wg upregulates hth expression in
the hinge; teashirt is
a positive regulator of hth in the hinge. tsh plays a role
specifying hinge structures, possibly in co-operation with
hth (Azpiazu, 2000).
In the second instar wing disc, the Hth product accumulates
uniformly in the thoracic and appendage regions of the disc, but throughout the third larval period hth expression
is downregulated and, by the late third instar, Hth only appears
in the presumptive regions of the thorax and the wing hinge.
The central part of the disc, which gives rise to the wing pouch,
shows no hth expression. The repression of hth
function is important for wing development, because if hth
activity is forced in the wing pouch, the wing does not form. A similar observation has been made in the leg disc;
hth or exd expression in the distal part results in a truncated
appendage in which all the distal components are missing. In the leg, the
subdivision between distal and proximal regions results from
the antagonism between Hh signaling and exd/hth function. Hh response genes such as Dll and dac are instrumental in repressing hth (Azpiazu, 2000 and references therein).
The downregulation of hth in the wing
pouch is a consequence of the activity of the Dpp and the Wg
signaling pathways. In cells in which the response to the Dpp
signal is prevented, as in tkv or Mad mutant cells, hth is
expressed at high levels. Similarly, dsh minus cells, in which
the transduction of Wg is blocked, show ectopic hth activity and
consequently nuclear exd expression. These results also indicate
that hth is latently active in the wing cells and has to be repressed
by the continuous activity of the Dpp and Wg signals. The
inability of cell clones to proliferate, cells in which the Dpp or the Wg pathways
have been totally eliminated, may be due to high
levels of hth expression. The Dpp
and Wg pathways repress hth expression independently. This is
illustrated by the experiments inducing dsh mutant clones:
ectopic hth expression is only observed in clones located away
from the AP border. This suggests that the high levels of
Dpp expression near the AP border are sufficient to impede hth
expression despite the removal of the control by Wg (Azpiazu, 2000).
vg is one of the factors involved in the
downregulation of hth: the elimination of vg activity in the
wing pouch results in hth activation and its ectopic
expression in the hinge region represses the normal activity of
hth. Since a principal role of vg is to specify wing development, it appears that a component of this
function is to eliminate hth activity and therefore exd function.
Since vg is a target gene of both the Hh and the Wg pathways in
the wing, it seems that the downregulation of hth by both
pathways is mediated by vg. One question that is not fully
understood about the role of vg is that, although it is able to
repress hth, there is some vg activity normally in the wing
hinge that coincides with that of hth. The levels of the Vg
protein appear to be similar in the pouch and the hinge regions
so that different levels of product do not seem to be a likely
reason. It is believed that there may be other factors in the hinge;
tsh is a likely candidate that counteracts the repression by Vg (Aspiazu, 2000).
The negative regulation of hth is a
modification of the original uniform expression found in the
early wing disc. Since the wing disc derives from the second
thoracic embryonic segment, which shows high and uniform
levels of hth expression, the initial levels
of hth in the thoracic region and the wing hinge are likely to
be inherited from the progenitor cells. The mechanism of hth
activation during embryogenesis is not known, although its
expression is modulated by the activity of the BX-C genes.
At least during the larval period, hth
expression in the wing disc is positively regulated by tsh. This
is based on two findings. (1) An increase of Tsh levels in the
hth domain results in increased levels of Hth product; possibly,
one of the normal functions of tsh in the wing hinge is to
maintain high hth levels. (2) Ectopic tsh expression in the wing
pouch causes ectopic hth activity, at least in the clones located
close to the hinge (or far from the DV border). The results indicate
that tsh is not the only factor involved: hth and tsh are normally
co-expressed only in the proximal ring of hth expression,
therefore there should be other factor(s) maintaining hth
expression in the distal ring. Since dsh mutant clones show a
reduction in hth expression in the hinge, a wg response gene is
likely to be involved. In addition, the fact that tsh cannot
activate hth near the DV border in the wing pouch may suggest
that other factors are required (Aspiazu, 2000).
The main role of hth is to regulate exd function. The loss of hth activity during adult patterning results
in changes in segmental identity and morphogenetic alterations
that appear to be similar or identical to those produced by
eliminating exd. Thus hth and exd can be considered to perform
the same developmental function.
In the wing disc, hth and exd are only required in the wing
hinge region and, in their absence, the cells proliferate but form
aberrant patterns indicating that hth/exd function is involved in
specifying the wing hinge region. The experiments inducing
ectopic hth expression suggest that it has a role in controlling
growth, for hth is able to prevent the formation of the wing
pouch. It is also consistent with the observation that hth mutant clones in the hinge may reach very
large size. The finding that hth suppresses wg activity in the DV
border may be related with the repression of growth, a process
with which wg has been shown to be involved. The lack of effect of hth on dpp expression emphasizes
the independence of the AP wing axis from hth/exd function.
One aspect that is not fully understood is the effect of
hth on the proximodistal pattern, which has also been observed
on the leg disc and on the chicken limb.
In the experiments described here, the presence of the Hth product influences
the reading of proximodistal signals by the cells towards
differentiating more proximal patterns. It is not known which
factors are responsible for the proximodistal pattern in the
wing, but since hth prevents wg response to Notch, it is possible
that a Wg response element or some other Notch response gene
may be involved in patterning (Aspiazu, 2000).
It is also not clear what is the role of hth in the specification
of the wing hinge, where it is expressed at high levels. Its
ectopic expression in the pouch does not produce any specific
transformation towards hinge structures, but rather a general
proximalization of the whole pattern. This is in contrast with
the effect of ectopic tsh that induces sclerites and very proximal
hinge structures. Since tsh activates hth in the hinge,
it suggests that the formation of proximal hinge requires the
activity of the two gene products (Aspiazu, 2000).
Altogether, the results presented here suggest the
subdivision of the non-thoracic part of the wing disc into two
major domains: the wing hinge, where hth is expressed and
Exd is functional (nuclear), and the wing pouch where hth is
not expressed, and Exd is cytoplasmic and therefore inactive. By
homology with the leg disc, the latter would be the
genuine appendage part of the disc. These two regions are
formed by two antagonistic genetic systems: in the hinge, the
high levels of hth, inherited from the embryo and probably
maintained by wg, tsh and maybe other regulators, prevent wg
response to Notch signaling, which is necessary for the
development of the wing pouch. In the wing pouch, the
activities of the Wg and Dpp pathways suppress hth so that
Notch may induce wg activity and the appendage is formed.
In addition to its role in preventing excessive proliferation,
hth may also contribute, together with tsh, wg and nub, to the
partition of the wing hinge into two regions that correspond to
the outer and inner rings of hth expression. The outer ring
domain expresses tsh, wg and hth; has nuclear Exd and does
not express vg and nub. The inner domain expresses wg, nub
and hth, has nuclear Exd and does not express tsh. The
individual role of these genes is not yet established, but it is
possible that they function in some combinatorial manner (Aspiazu, 2000).
In Drosophila, the Hox gene Abdominal-B is required
to specify the posterior abdomen and the genitalia.
Homologs of Abdominal-B in other species are also
needed to determine the posterior part of the body. The function of Abdominal-B in the formation of
Drosophila genitalia has been studied, and the absence of
Abdominal-B in the genital disc of Drosophila is shown to transform
male and female genitalia into leg or, less frequently, into
antenna. These transformations are accompanied by
the ectopic expression of genes such as Distal-less or
dachshund, which are normally required in these
appendages. The extent of wild-type and ectopic Distal-less
expression depends on the antagonistic activities of the
Abdominal-B gene (as a repressor), and of the
decapentaplegic and wingless genes (as activators).
Absence of Abdominal-B also changes the expression of
Homothorax, a Hox gene co-factor. These results suggest that
Abdominal-B forms genitalia by modifying an underlying
positional information and repressing appendage
development. It is proposed that the genital primordia should
be subdivided into two regions, one of them competent to
be transformed into an appendage in the absence of Abdominal-B (Estrada, 2001).
Abd-B clones were induced, and they transform posterior abdominal segments into more anterior ones but are normal in the analia. Rare clones transform to distal antennae (second and/or third antennal segment and arista).
Transformations to legs or antennae are cell autonomous.
The formation of legs requires
the activity of genes such as homothorax (hth), dac and Dll, which specify the proximal, medial and distal parts of the leg,
respectively. Dll expression in wild-type discs is regulated by the combined activities of wingless and dpp in the genital
primordia, and is confined to two groups of cells in
male and female discs, the female domains being smaller and
expressing lower levels of Dll protein.
Since Abd-B is transcribed in the entire genital primordia of the
two sexes, some cells co-express Abd-B and Dll. In
the male disc, hth is not expressed in the Dll-expressing cells
and is also excluded from a large group of cells surrounding
them. Levels of antibody signal vary within the
disc, and are higher in the female repressed primordium. In
females, the hth domain of expression occupies the whole
primordium. Lower levels of Hth are detected in a region
encompassing the Dll-expressing cells, whereas higher levels
are observed in the male repressed primordium. In
both sexes, hth expression is absent from the anal primordium.
dac is expressed differently in male and female genital
primordia: in male discs, Dac protein is
detected in two broad lateral bands, while in female
discs it is found in the central region, almost coincident with
the wg-expressing region. Therefore, the expression
patterns of hth, dac and Dll differ substantially from those
observed in legs (Estrada, 2001).
It is known that expression of Dll is not required to make male
genitalia and that it has only a minor role in the formation of
the female one. To ascertain the role
of hth in the genitalia, hth minus clones were induced during the third larval period and they were examined in the adult structures. In
the female genitalia, hth minus clones cause extra growths with
additional vaginal teeth. In males, these clones show
occasionally some abnormalities in the clasper teeth. hth clones in the analia are wild type.
Possible interactions between Dll and hth in the
genital disc were sought. In these experiments, unless stated,
the results apply both to male and female genital primordia. Dll minus
clones in the Dll domain of the male disc have no hth expression. Similarly, in hth minus clones Dll is not ectopically
expressed. Dll was also expressed ectopically and
the effect on hth expression was examined. Dll-expressing cells close
to the wild-type Dll domain repress hth expression, although not
all the cells do so. By contrast, clones far from the Dll domain
do not affect hth expression (Estrada, 2001).
To characterize the transformation of genitalia into leg or antennal tissues, Abd-B minus clones were examined. Abd-B
minus clones in the genital primordia tend to segregate from
the rest of the tissue, round up and have smooth borders,
suggesting they have acquired different affinities. By
contrast, clones in the analia have indented borders and do
not segregate. Abd-B minus clones in the genital
primordium close to the normal Dll domain show ectopic,
cell-autonomous Dll expression, whereas those far
apart do not show such expression. dac is also activated cell
autonomously in many Abd-B minus clones.
As expected, Dll target genes, such as Bar, also become
activated in these clones (Estrada, 2001).
Abd-B minus clones exhibit differential effects on hth, depending on their position: those close to the Dll domain show no hth
expression, whereas those located away from the Dll domain
show a slight increase in hth signal. Clones in intermediate
positions do not significantly change hth levels.
This distribution, however, is clearer in females, since in males
there is a wide region with no hth expression. The repression of hth observed in some Abd-B minus clones may be mediated by the ectopic Dll
(Estrada, 2001).
The wing imaginal disc comprises the primordia of the adult wing and the dorsal thoracic body wall. During second
larval instar, the wing disc is subdivided into distinct domains that correspond to the presumptive wing and body wall.
Early activity of the signaling protein Wingless has been implicated in the specification of the wing primordium.
Wingless mutants can produce animals in which the wing is replaced by a duplication of thoracic structures.
Specification of wing fate has been visualized by expression of the POU-homeodomain protein Nubbin in the
presumptive wing territory and by repression of the homeodomain protein Homothorax. Repression of the zinc-finger transcription
factor Teashirt (Tsh) is the earliest event in wing specification. Repression of Tsh by the combined action of Wingless and Decapentaplegic is
required for wing pouch formation and for subsequent repression of Hth. Thus, repression of Tsh defines the presumptive wing earlier in development
than repression of Hth, which must therefore be considered a secondary event (Wu, 2002).
To understand the early specification of the wing field within the imaginal disc the patterns of expression of Wg,
Tsh, Hth, Vestigial and Nubbin were examined at very early stages. Vestigial is expressed in every cell of the wing disc primordium in the embryo. In wing discs from early and mid second instar larvae, Vestigial expression has begun to retract from the presumptive notum, but is expressed in both cell layers in the ventral part of the disc. At this stage, Hth is expressed in
every cell. By contrast, Tsh is expressed in the presumptive body wall but has already begun to be repressed in the future wing pouch (Wu, 2002).
As Hth expression retracts from the wing pouch, it resolves into three distinct domains in the proximal region. Two of the Hth domains overlap with the
proximal rings of Wg expression that are observed in the presumptive wing hinge region. Hth is regulated by Wg at these late stages. Both rings of Wg expression are distal to the Tsh expression domain. The most proximal ring of Hth, which is regulated by secreted Wg, overlaps the edge of the Tsh domain. At this stage,
Vestigial and Nubbin expression are centered on the stripe of Wg expression at the DV boundary. Vestigial expression is limited to the distal wing pouch and does
not extend as far as the first ring of Hth expression. Nubbin extends more proximally, overlapping the first and second rings of Hth and the first ring of Wg
expression. Tsh expression is proximal to the outer ring of Wg expression, which runs through the base of the wing hinge.
Thus, the border of Tsh expression coincides with border between wing and the body wall, whereas Hth is expressed in rings in the wing hinge as well as more
proximally in the notum (Wu, 2002).
Evidence has been presented that repression of Tsh in the earliest phase of wing specification appears to be required for subsequent Notch-dependent induction of Wg at the DV boundary. Clones of cells lacking Hth activity cause outgrowth of extra wing tissue along the DV boundary. The results presented here suggest that this is unlikely to be due to an early role of Hth in specification of the size of the wing field because Hth is expressed in the early presumptive wing well after Tsh is repressed. Instead, Hth appears to act in the second stage in conjunction with Tsh to limit the region in which Notch
can activate Wg at the DV boundary. Wg expression at the DV boundary extends proximally into the domain of Hth expression in the anterior wing hinge but does
not extend into the Tsh domain. In ectopic expression experiments, Hth has a limited ability to repress Notch-dependent activation of Wg on its own, but is able to
do so when co-expressed with Tsh. These observations support the view that Hth cooperates with Tsh during later stages to repress
Wg activation. This does not exclude a role for Hth as a co-factor in conjunction with Tsh at earlier stages, but if so, the positional information would
seem to derive from regulation of Tsh expression (Wu, 2002).
Interestingly, Hth and Tsh can also repress the vestigial quadrant enhancer, which depends on Wg and Dpp signaling in phase 3.
Homothorax, Tsh and Vestigial appear to form a loop of mutual repression at this stage, since Vestigial also represses expression of Hth.
Together, these observations suggest that Wg and Dpp have a complex regulatory interaction with Hth. Their activities repress it in the pouch, perhaps through
activation of Vestigial and Scalloped. At the same time, the outer rings of Wg expression are required for Hth expression in the wing hinge. It is suggested that regulation of Hth may be secondary to regulation of Tsh in specification of the wing field (Wu, 2002).
teashirt (tsh) encodes a Drosophila zinc-finger protein. Misexpression of tsh has been shown to induce ectopic eye formation in the antenna. tsh can also suppress eye development. This novel function of tsh is due to the induction of homothorax (hth), a known repressor of eye development, and requires Wingless (Wg) signaling. Interestingly, tsh has different functions in the dorsal and ventral eye, suppressing eye development close to the ventral margin, while promoting eye development near the dorsal margin. It affects both growth of eye disc and retinal cell differentiation (Singh, 2002).
Since ectopic tsh can regulate hth expression, the endogenous expression of these genes in imaginal discs was compared. Expression of tsh was examined using tsh-GAL4-driven UAS-GFP (tsh>GFP). In the eye disc, tsh expression can be detected as early as first larval instar in the entire disc proper, overlapping with hth and the pro-eye gene eyeless (ey. In the late second instar eye disc, tsh>GFP expression retracts anteriorly and occupied nearly three quarters of the disc. hth expression also retracts anteriorly. Ey is also expressed in the same region. In early third instar eye discs, tsh expression regresses to the anterior two-thirds of the disc. hth expression is restricted to the anterior margin in a 10- to 15-cell wide domain. tsh and hth expression overlaps in a 3- to 4-cell wide stripe. Ey expression largely overlaps tsh. In late third instar eye disc, tsh>GFP expression is anterior to the MF and is similar to the expression pattern determined by tsh-lacZ, anti-Tsh antibody and in situ hybridization. The co-expression of tsh and hth during the early phase of eye disc development is consistent with the finding that tsh induces hth expression (Singh, 2002).
Interestingly, although tsh is expressed symmetrically in the dorsal and ventral halves of the eye disc, overexpressing tsh in these regions suppresses eye development in the ventral region, while it promotes eye development in the dorsal region. Why would overexpressing tsh in a region where it is normally expressed cause phenotype reciprocal to the loss-of-function tsh mutant phenotype? It is possibly a dose effect, since the ectopic expression of two copies of tsh transgene causes a stronger effect. The normal level of Tsh may be balanced with some opposing forces for proper development, thus too little and too much of Tsh will cause reciprocal effects. A similar case is Wg, which is normally expressed in both dorsal and ventral margins. Reducing Wg level causes ectopic MF formation, while raising Wg level blocks MF initiation (Singh, 2002).
The eye-suppression function of tsh is accompanied by the induction of hth at the transcriptional level. Eye suppression is reduced when the hth dose is reduced, suggesting that Hth is the major mediator of tsh-induced eye suppression. This is consistent with the known role of hth as a repressor of eye development. In the wing disc, tsh also induces Hth, but tsh has additional effects (e.g. protecting wg from suppression by Hth and splitting the wing pouch). Whether tsh has additional effects in the eye disc awaits further study (Singh, 2002).
The eye-suppression function of tsh requires Wg signaling, since blocking Wg signaling by co-expressing dTCFDeltaN or sgg with tsh, or overexpressing tsh in a wgts mutant at the non-permissive temperature blocks the suppression effect. The critical time for wg involvement is 48-72 hours AEL, corresponding to the second instar larval stage. At this stage, the expression patterns of tsh, hth and wg in the eye disc overlap considerably, consistent with their functional interaction (Singh, 2002).
Tsh can induce Hth and suppress eye development only in the ventral margin of the eye disc. Internal clonal induction of tsh expression (Act>tsh) clones has no eye-suppression effects. The restriction of eye suppression to the eye disc margin, where wg is expressed, suggests that tsh does not induce wg but requires high level Wg signaling. Indeed, clonal expression of tsh internal in the eye disc does not induce Wg expression. When Tsh is co-expressed with Wg or an activated Arm, eye suppression can occur away from the margin, possibly because higher levels of Wg signaling are provided by the ectopic expression. Tsh also requires a high level of Wg to repress Ubx transcription in the embryonic midgut (Singh, 2002).
Ectopic expression of Wg in the region ahead of MF induces Hth, while blocking Wg signaling (by clonal expression of dTCFDeltaN) reduced Hth in the presumptive head region of the eye disc. These locations correspond to tsh expression domain, consistent with the Tsh-Wg collaboration. Act>hth clones can block MF initiation without inducing ectopic wg expression, also suggesting that hth acts downstream of Wg. Thus, these results suggest that Tsh collaborates with Wg signaling to induce Hth to suppress eye development (Singh, 2002).
Tsh and Wg signaling also collaborate during embryonic development. Tsh acts in the late phase of Wg signaling to promote the naked cuticle cell fate of larvae. Tsh phosphorylation and nuclear accumulation is partially promoted by Wg signaling. Hypophosphorylated Tsh can bind directly to the intracellular Arm. The effect of Tsh overexpression on embryo development is dependent on the interaction with Arm. Tsh can also associate with Sgg, an inhibitory component of Wg signaling that promotes Arm degradation and acts downstream of Sgg. Whether the same molecular interaction operates in the eye disc awaits further study (Singh, 2002).
Based on the loss-of-function phenotype and overexpression phenotype, tsh suppresses eye development only in the ventral eye, while promoting eye development in the dorsal eye. The DV difference in Tsh function is not likely to be due to wg, since wg is expressed in both dorsal and ventral margins, with even higher levels in dorsal parts. In a wg temperature-sensitive mutant, an ectopic MF initiates more on the dorsal side. Wg signaling upregulates hth in both dorsal and ventral regions of the eye disc. Thus, wg can induce hth and suppress eye development in both ventral and dorsal margins, but through different mechanisms. Tsh collaborates with Wg signaling for eye suppression only in the ventral margin, but not in the dorsal margin. Whether Wg requires other co-factors in the dorsal margin is not known (Singh, 2002).
The critical period for eye suppression by tsh is in the second instar larval stage, based on tsh mutant clones and on misexpression of tsh in wgts background. At this time, the morphogenetic furrow has not initiated and photoreceptor differentiation has not begun. tsh mutant clones induced in second instar caused enlargement in the ventral eye field and reduction of eye cells in the dorsal eye field. In the ventral overgrowth, not all cells have differentiated into photoreceptors. These results suggest that the primary effect of tsh function is on growth in the early eye disc. When the relative frequency and size of Act>GFP and Act>tsh+GFP clones are compared, the results show that tsh promotes growth in the dorsal and suppressed growth in the ventral region. A dorsal clone anterior to the MF shows overgrowth, suggesting that the effect can be a general growth promotion and is not limited to differentiating retinal cells (Singh, 2002).
However, tsh8 mutant clones in the dorsal eye cause a transformation of eye cells into cuticle fate, suggesting that tsh also plays a role in promoting eye fate (in the dorsal part of the disc). This role is consistent with the finding that tsh could induce ectopic eye formation in antenna. In the ventral eye disc, a role in directly suppressing photoreceptor fate is also supported by the finding of an isolated ventral eye field in the eye disc with tsh8 clone induction. This direct role is consistent with the ventral activation of hth, which can directly suppress photoreceptor differentiation. Thus, tsh can affect both the growth of the eye disc and the differentiation of photoreceptors (Singh, 2002).
The related genes buttonhead (btd) and Drosophila
Sp1 (the Drosophila homolog of the human SP1 gene)
encode zinc-finger transcription factors known to play a developmental role in
the formation of the Drosophila head segments and the mechanosensory
larval organs. A novel function of btd and Sp1 is reported:
they induce the formation and are required for the growth of the ventral
imaginal discs. They act as activators of the headcase (hdc)
and Distal-less (Dll) genes, which allocate the cells of the
disc primordia. The requirement for btd and Sp1 persists
during the development of ventral discs: inactivation by RNA interference
results in a strong reduction of the size of legs and antennae. Ectopic
expression of btd in the dorsal imaginal discs (eyes, wings and
halteres) results in the formation of the corresponding ventral structures
(antennae and legs). However, these structures are not patterned by the
morphogenetic signals present in the dorsal discs; the cells expressing
btd generate their own signalling system, including the establishment
of a sharp boundary of engrailed expression, and the local activation
of the wingless and decapentaplegic genes. Thus, the Btd
product has the capacity to induce the activity of the entire genetic network
necessary for ventral imaginal discs development. It is proposed that this
property is a reflection of the initial function of the btd/Sp1 genes
that consists of establishing the fate of the ventral disc primordia and
determining their pattern and growth (Estella, 2003).
In a search for genes with restricted expression in the adult cuticle,
the MD808 Gal4 line was found to direct expression in the ventral derivatives
of the adult body; proboscis, antennae, legs and genitalia. In the abdomen and
analia no clear expression was discerned. It was also noticed that the
insertion was located in the first chromosome and associated with a lethal
mutation. The mutant larvae showed a head phenotype resembling that described
for mutants at the btd gene: loss of antennal organ and the ventral
arms of the cephalopharyngeal skeleton, and complementation analysis indicated that the chromosome carrying the insert contained a mutation at btd. The expression pattern found in MD808/UAS-lacZ embryos was also similar to that
reported for btd, suggesting that the Gal4 insertion was
located at this gene. In addition, the imaginal expression of MD808 and of
btd was largely coincident (Estella, 2003).
Further to the genetic analysis and the expression data, DNA
fragments at the insertion site were cloned to map the position of the P-element on the genome. It is located 753 bp 5' of the
btd gene. The related gene Sp1 is
immediately adjacent. It is likely that btd and
Sp1 have originated by a tandem duplication of a primordial
btd-like gene (Estella, 2003).
One particularly significant result about the mode of action of
btd comes from the analysis of the ectopic leg patterns observed with ectopic btb expression in the wing and halteres. The clones of cells ectopically expressing btd tend to recapitulate
the complete development of leg and antennal discs. For example, the whole
genetic network necessary to make a leg appears to be activated. btd
induces the activity of hth, dac and Dll, the domains of
which account for the entire disc. Furthermore, hth, dac and Dll are
activated in a spatially discriminated manner. The formation of the dac and Dll domains is dependent on signalling from Wg and Dpp, although they require different
signal thresholds. In one clone, for example hth is expressed only in the peripheral region, resembling the normal expression in the leg disc; in another clone the discriminate expressions of dac and Dll define three distinct regions. The formation of the dac and Dll domains is dependent on signalling from Wg and Dpp, although they require different signal thresholds, but the hth domain is independent from Wg and Dpp (Estella, 2003).
The generation of distinct hth, dac and Dll domains within the clones
suggested that btd-expressing cells in the wing and haltere generate
their own signalling process. Indeed, within these clones there
is local activation of en, the transcription factor that initiates
Hh/Wg/Dpp signalling in imaginal discs.
btd-expressing clones also acquire wg and dpp
activity in subsets of cells. It is probably in the boundary of en-expressing with
non expressing cells where the Wg and Dpp signals are generated de novo;
subsequently, their diffusion initiates the same patterning mechanism which
operates during normal leg development. The result of this process is that the
hth, dac and Dll genes are expressed in different domains
contributing to form leg patterns containing DV and PD axes. One question for
which there is no clear answer is how the initial asymmetry is generated, so
that a few cells within the group gain (or lose) en activity. The cells expressing en within the clones are those closer to the posterior compartment cells. It is conceivable that there might be an external signal, perhaps mediated by Hh, which triggers the initial asymmetry (Estella, 2003).
The wave of differentiation that traverses the Drosophila eye disc requires rapid transitions in gene expression that are controlled by a number of signaling molecules also required in other developmental processes. A mosaic genetic screen has been used to systematically identify autosomal genes required for the normal pattern of photoreceptor differentiation, independent of their requirements for viability. In addition to genes known to be important for eye development and to known and novel components of the Hedgehog, Decapentaplegic, Wingless, Epidermal growth factor receptor, and Notch signaling pathways, several members of the Polycomb and trithorax classes of genes, encoding general transcriptional regulators, were identified. Mutations in these genes disrupt the transitions between zones along the anterior-posterior axis of the eye disc that express different combinations of transcription factors. Different trithorax group genes have very different mutant phenotypes, indicating that target genes differ in their requirements for chromatin remodeling, histone modification, and coactivation factors (Janody, 2004).
Very similar phenotypes were observed in clones mutant for Pc or E(z), which encode components of two distinct complexes implicated in transcriptional repression. Although likely null alleles for both genes were used, the phenotype of E(z) clones appeared slightly stronger, with a greater likelihood of derepressing hth in posterior regions of the eye disc. The E(z) protein has been shown to act as a histone methyltransferase for H3 K27 within a complex that also includes Extra sex combs (Esc), Suppressor of zeste 12 [Su(z)12], and the histone-binding protein NURF-55. esc appears to act only early in embryonic development, while E(z) and Su(z)12 are continuously required to repress inappropriate homeotic gene expression in wing imaginal discs. The core PRC1 complex contains Pc, as well as Ph, Psc, and dRing1, and can prevent SWI/SNF complexes from binding to a chromatin template. Pc, Psc, and ph are all required to prevent homeotic gene misexpression in wing discs; however, Psc and ph act redundantly with closely related adjacent genes. The two complexes are thought to be linked through binding of the Pc chromodomain to K27-methylated H3. The stronger phenotype of E(z) mutations in the eye disc might suggest that methylation of H3 K27 can recruit other proteins in addition to Pc (Janody, 2004).
In the eye disc, loss of E(z) or Pc leads to misexpression of the homeotic gene Ubx, but this does not seem to account for the entire phenotype. Although Ubx is sufficient to turn on tsh ectopically, misexpression of hth and tsh can occur in E(z) or Pc clones in which Ubx is not misexpressed. This suggests that hth and tsh are either direct targets of Pc/E(z)-mediated repression or targets of a downstream gene other than Ubx, possibly one of the homeotic genes not examined. Tsh misexpression would be sufficient to explain the suppression of photoreceptor differentiation in clones close to the morphogenetic furrow, since it is able to maintain expression of Hth and Ey and, in combination with them, to repress eya. Misexpression of Tsh can also account for overgrowth of Pc or E(z) mutant cells at the posterior margin of the eye disc (Janody, 2004).
trithorax group genes were initially identified as suppressors of Polycomb phenotypes and are therefore thought to contribute to the activation of homeotic gene expression. Some members of the group encode components of the Brahma chromatin-remodeling complex, others encode components of the mediator coactivation complex, and still others encode histone methyltransferases. In addition to their distinct biochemical functions, members of the trithorax group act on different sets of target genes during eye development and can also have different effects on the same target genes. Components of the Brahma complex are strongly required for cell growth and/or survival; brm and mor, but not osa, are also absolutely required for photoreceptor differentiation. However, these three genes do not seem to be required for the restricted expression in anterior-posterior domains of the eye disc of the transcription factors examined. In contrast, the mediator complex subunits encoded by skd and kto are not required for cell proliferation, although they are strongly required for photoreceptor differentiation. trx, which encodes a histone methyltransferase, is required primarily for the normal development of marginal regions of the disc. No significant effect on photoreceptor differentiation were seen in clones mutant for kismet1, which encodes chromodomain proteins, or ash21, which encodes a PHD protein. These differences are unlikely to be due to different expression patterns of the trithorax group genes, since Trx, Skd, Kto, and Osa are ubiquitously expressed in the eye disc (Janody, 2004).
The effects of these genes on the rapid transitions between domains of expression of different transcription factors are of particular interest. In the most anterior region of the eye disc, hth expression is enhanced by skd and kto. The domain just posterior to this also expresses tsh and ey, and activation of both of these genes requires trx. However, skd and kto have opposite effects on the two genes, enhancing tsh expression and preventing the maintenance of ey expression in posterior cells. Since Hth and Tsh can positively regulate each other's expression, it is possible that only one of these genes is directly dependent on skd and kto. Next, dac and h are activated transiently and eya is activated and sustained. The establishment of both dac and eya is delayed in trx mutant clones, and h expression is reduced. This delay in establishing the preproneural domain may be due to the failure to activate ey and tsh earlier in development, since Ey and Tsh combine to activate eya. The effect of Pc or E(z) mutations on eya, dac, and h appears very similar to the effect of trx mutations. However, in Pc or E(z) clones, the delay in eya and dac expression is likely to be caused by the failure to repress tsh and hth, since the combination of these two proteins has been shown to repress genes expressed in the preproneural domain. skd and kto clones also show a reduction in h and anterior eya expression, but an inappropriate maintenance of dac and dpp. These mediator complex components may thus contribute both to the activation of genes such as h in the preproneural domain and to the activation of unknown genes that shut off the expression of ey, dac, and dpp. Alternatively, skd and kto could be directly involved in the repression of these genes. Finally, trx is important to prevent misexpression of hth in cells near the posterior and lateral margins. Although Dpp normally represses hth, in trx mutant clones dpp and hth are both inappropriately expressed in marginal cells. This may reflect a role for trx in the process of morphogenetic furrow initiation, perhaps contributing to the ability of dpp to control gene expression (Janody, 2004).
Further study will be needed to determine which genes are direct targets of each trithorax group protein. However, the results point to a strong specificity of these general transcriptional regulators, suggesting that they may be specialized to mediate the effects of particular signaling pathways or to control specific subsets of downstream genes (Janody, 2004).
Secreted signaling molecules such as Wingless (Wg) and Decapentaplegic
(Dpp) organize positional information along the proximodistal (PD) axis of the
Drosophila wing imaginal disc. Responding cells activate different
downstream targets depending on the combination and level of these signals and
other factors present at the time of signal transduction. Two such factors,
teashirt (tsh) and homothorax (hth), are
initially co-expressed throughout the entire wing disc, but are later
repressed in distal cells, permitting the subsequent elaboration of distal
fates. Control of tsh and hth repression is, therefore,
crucial for wing development, and plays a role in shaping and sizing the adult
appendage. Although both Wg and Dpp participate in this control, their
specific contributions remain unclear. In this report, tsh
and hth regulation were analyzed in the wing disc; Wg and Dpp act
independently as the primary signals for the repression of tsh and
hth, respectively. In cells that receive low levels of Dpp,
hth repression also requires Vestigial (Vg). Furthermore, although
Dpp is required continuously for hth repression throughout
development, Wg is only required for the initiation of tsh
repression. Instead, the maintenance of tsh repression requires
Polycomb group (PcG) mediated gene silencing, which is dispensable for
hth repression. Thus, despite their overall similar expression
patterns, tsh and hth repression in the wing disc is
controlled by two very different mechanisms (Zirin, 2004).
In the course of a screen for mutations affecting the PD axis of the wing,
an allele of the Drosophila Smad4 homolog Med was isolated.
Like other Dpp pathway mutations, Medadro clones located
in the wing pouch cell autonomously de-repress hth. This is evident
even in late-induced clones, demonstrating the continuous role of Dpp
signaling in shaping the wing blade/hinge subdivision during larval
development. By contrast, no de-repression of tsh was detected
resulting from any manipulations of the Dpp pathway (Zirin, 2004).
The ability of ectopic Dpp activity to repress tsh in
early-induced proximal clones was interpreted to suggest that Wg and Dpp
cooperate to repress tsh in the early pouch. However,
because Dpp is dispensable for tsh repression, this model must be an
over-simplification. It is concluded that Wg, not Dpp, must be considered the
primary repressor of tsh in the wing. The lack of synergy between the
two pathways is reminiscent of the regulation of Dll, which is
activated in the leg by the combined activities of Wg and Dpp, but requires
only Wg for its expression in the wing pouch (Zirin, 2004).
In the absence of Dpp signaling, wing pouch cells co-express hth,
nub and Dll, but not tsh. This combination of factors
is normally found only in the distal hinge (DH), suggesting a transformation
from pouch to DH when the Dpp pathway is compromised. The
expression of the Iro-C genes, normally restricted to the notum, extends to
the distal limit of the tsh domain in dpp mutant discs,
leading to the hypothesis that Dpp signaling is essential for the separation
of wing and body wall. However, because loss of Dpp signaling transforms wing
pouch to DH, an alternative view is proposed in which Dpp further divides an
already extant appendage/trunk subdivision by repression of hth in the pouch and Iro-C in the proximal hinge (PH). According to this proposal, the distal limit of tsh expression, initiated by early Wg expression and maintained by PcG silencing, denotes the boundary between the appendage and the body (Zirin, 2004).
The results suggest that repression of hth in the wing disc
occurs only in cells with a history of vg expression and continuous Dpp
input. Consistent with this, ectopic vg expression in the medial DH and
loss of brk in the lateral DH both result in hth repression.
The requirement for vg can be separated into two distinct stages. The
first stage occurs in the second instar, when vg expressed at the DV
compartment boundary determines which cells are competent to repress
hth in response to Dpp signaling. Thus, both
vg or Dpp-pathway mutant clones induced at this early stage fail to
repress hth (Zirin, 2004).
In the third instar, vg expression is required for
hth repression only at the lateral edges of the wing pouch, whereas Dpp
signaling is required at all positions along the AP axis. Accordingly, the
boundary between the lateral hinge and pouch is dictated by the threshold of
Dpp activity that permits the Vg-dependent repression of hth. Wg
signal transduction is also required to repress hth in pouch cells
far from the AP boundary. However, the requirement for Wg
signaling in this part of the wing pouch could be due to its role in
vg activation. Alternatively, it is possible that Wg and Vg are
independently required to repress hth in these cells (Zirin, 2004).
A model that encompasses these observations is that Vg and Dpp activate
another factor that directly represses hth. This factor would be
activated in Vg-positive cells by Dpp signaling beginning in the late second
instar. By the third instar, high levels of Dpp signaling would be sufficient
to maintain its activation, with additional input by Vg and Wg required only
at the lateral regions of the pouch. Even further from the source of Dpp, in
the lateral hinge, high levels of Brk would prevent expresssion of this
factor, thus allowing hth expression despite the presence of Vg. This
model is consistent with the idea that Brk is a transcriptional repressor
and Vg is a transcriptional activator. There is
also precedent for the idea that early vg expression predisposes
cells to a particular Dpp response, which was also proposed for the activation
of the vgQE (Zirin, 2004).
The above model does not apply to PH cells, which have a
distinct response to Dpp signaling. For example,
Medadro clones located near the AP boundary of the PH
ectopically expressed vg. tsh is an
attractive candidate for mediating this switch in response to Dpp signaling,
since it is expressed in the PH but not the DH, and is reported to bind Brk in
vitro. However, the absence of reagents to readily examine tsh
loss-of-function clones prevents this idea from being tested (Zirin, 2004).
If tsh repression marks a fundamental subdivision along the PD
axis, then the maintenance of tsh repression is crucial for the
maintenance of this subdivision. Although Wg signaling is clearly required for
the initiation of tsh repression, it is dispensable by the time the
DV margin is established. The elbow-no ocelli (el-noc) gene complex
has been identified as a target of both Dpp and Wg that is necessary for
tsh repression in the wing. However, tsh de-repression is
observed in el-noc loss-of-function clones induced only in first or early
second instar larvae. tsh repression must therefore be maintained by
a wg- and el-noc-independent mechanism. The
possibility of redundant Wg- and Dpp-mediated tsh repression was ruled out by
making clones doubly mutant for both signaling pathways. Such clones upregulate hth, and lose Dll expression, but show no ectopic tsh expression. Thus, neither of the two major long-range signaling systems of the wing pouch is involved in the maintenance of tsh repression (Zirin, 2004).
Instead, analysis of Su(z)12daed and Pc
mutant clones indicates that the maintenance of tsh repression is
mediated by a heritable silencing mechanism. By inducing Pc mutant
clones in third instar discs, it was demonstrated that this ectopic tsh
expression represents a failure to maintain rather than a failure to establish
repression. The weak hth levels observed in some PcG mutant clones
may be due to the ability of tsh to upregulate
hth. This interpretation is supported by the fact that
hth expression is seen only in large Pc mutant clones, and
only in cells expressing the highest levels of tsh. The general
absence of hth expression in PcG mutant clones, together with the
ectopic hth expression resulting from late Dpp pathway disruption,
points to the need for continuous signaling input to maintain hth
repression. By contrast, tsh requires PcG gene activity, but not continuous Wg or Dpp input, to maintain its repression during the third instar (Zirin, 2004).
At this stage the possibility that the affects of PcG
mutant clones on tsh repression described here are indirectly due to
the de-repression of another factor cannot be ruled out. It is suggested that this is unlikely, however, in part because the spatial distribution of tsh
de-repression in PcG mutant clones differs significantly from reports of Hox
gene de-repression. Additionally, the ectopic tsh expression in
Pc mutant clones is repressible by Nrt-Wg, indicating that
tsh is still subject to regulation by Wg signaling (Zirin, 2004).
In the embryo, Hox genes are repressed in some segments by the transient
presence of the gap genes. This
initial repression is then maintained by the PcG proteins through a heritable
silencing mechanism. A model of tsh repression follows this general
outline, whereby Wg signaling is required transiently to establish the limits
of the tsh expression domain. PcG proteins subsequently maintain the tsh silenced state, while the appendage is further subdivided along the PD axis. Similar mechanisms may be important for tsh regulation in other tissues, as is suggested by tsh de-repression in PcG mutant
clones in the eye disc (Zirin, 2004).
tsh and hth repression are distinct events during the
development of the wing imaginal disc. The requirement for PcG activity in
tsh, but not hth, repression points to the primacy of
tsh repression in determining appendage versus trunk fate. PcG
regulation ensures a strict and inflexible pattern of gene expression, ideal
for defining the fundamental divisions of the disc. Within the specified
appendage domain, Wg and Dpp signaling can then modify the shape and size of
the hinge and wing blade through continuous input into transcription factors
that control patterning and growth. In the absence of Tsh, Hth is an essential
mediator of this process, since it promotes hinge development at the expense of
wing pouch growth. The complexity of hth relative to tsh
regulation may, therefore, reflect the greater need for plasticity in the
response of hth to the Wg and Dpp morphogen gradients (Zirin, 2004).
Polycomb group (PcG) proteins are negative regulators that maintain the expression of homeotic genes and affect cell proliferation. Pleiohomeotic (Pho) is a unique PcG member with a DNA-binding zinc finger motif and has been proposed to recruit other PcG proteins to form a complex. The pho null mutants exhibits several mutant phenotypes such as the transformation of antennae to mesothoracic legs. This study examined the effects of pho on the identification of ventral appendages and proximo-distal axis formation during postembryogenesis. In the antennal disc of the pho mutant, Antennapedia (Antp), which is a selector gene in determining leg identity, is ectopically expressed. The homothorax (hth), dachshund (dac) and Distal-less (Dll) genes involved in proximo-distal axis formation are also abnormally expressed in both the antennal and leg discs of the pho mutant. The engrailed (en) gene, which affects the formation of the anterior-posterior axis, is also misexpressed in the anterior compartment of antennal and leg discs. These mutant phenotypes are enhanced in the mutant background of Posterior sex combs (Psc) and pleiohomeotic-like (phol), which are also PcG genes. These results suggest that pho functions in maintaining expression of genes involved in the formation of ventral appendages and the proximo-distal axis (Kim, 2008).
Many PcG genes act as zygotic as well as maternal effect genes during whole Drosophila development, but it is not well known when and how they function. Pho is known to work with its redundant DNA-binding protein, Phol and recruits other PcG complexes by binding its binding sites on PREs. pho functions as a maternal effect gene. Its maternal effect mutant embryos show several segment defects and weak homeotic transformation. When pho functions as a zygotic gene, its zygotic mutant adults show homeotic transformation of antennae and legs. In accord to these results, pho functions in identification of ventral appendage were investigated (Kim, 2008).
Mutations in a few PcG genes result in the transformation of antennae to legs. Mutation in esc induces the ectopic expression of Antp and Ubx in the antennal disc, thus transforming antennae to legs. This indicates that esc represses Antp and Ubx expression in the antennal disc during antennal development. Therefore, the possibility was investigated that pho mutation, like esc mutation, would affect the expression of the selector genes that determine the identity of antenna or leg. In the wild type antennal disc, Antp is not expressed, but hth is expressed in almost all cells except for the presumptive arista, allowing for the development of antenna. However, in the leg disc, Antp is expressed and restricts hth expression to the proximal cells, which permits leg development (Kim, 2008).
Antp is ectopically expressed in the antennal disc of the pho mutant, and its expression subsequently but partially represses hth expression in the presumptive a2 or a3. Moreover, in the pho mutant, dac, which is expressed in the presumptive a3 of wild type antennal discs, is overexpressed in the presumptive a2 or a3 where hth expression is reduced. Ectopic expression of Antp in the presumptive a2 represses hth expression, which subsequently results in the transformation from antenna to leg. Ectopic Antp expression in the presumptive a1 permits expression of hth. In addition, when dac is ectopically expressed in a3 using the UAS/GAL4 system, leg-like bristles are newly formed in a3, indicating transformation of a3 to femur. However, the antennal disc of pho mutant shows that hth expression does not completely disappear in all regions of the presumptive a2 and a3 where Antp is ectopically expressed. These indicate that a pho single mutation partially affects expression of Antp, which leads to the incomplete repression of hth. Moreover, as the increased dosage of PcG mutants causes stronger mutant phenotypes than each single mutant, double mutation of pho and Psc strongly affects the expression of Antp, which leads to the complete repression of hth. Therefore, these results indicate that a pho mutation results in the ectopic expression of Antp, which directly represses hth expression in antennal disc and indirectly regulates dac expression through hth expression, which consequently transforms antennae to legs (Kim, 2008).
In the wing imaginal disc, Polycomb (Pc) and Suppressor of zeste (Su(z)) regulate the expression of teashirt (tsh), which specifies the proximal domain with hth. The polyhomeotic (ph) gene regulates the expression of en and the hedgehog (hh) signaling pathway in the wing imaginal disc. Pc also regulates eye specification genes such as tsh and eyeless (ey). PcG genes have recently been found to regulate organ specification genes in addition to homeotic genes, segmentation genes and cell cycle genes (Kim, 2008).
Therefore, it was proposed that pho might regulate the expression of organ specification genes for several reasons. First, Dll is ectopically expressed in the proximal region of the posterior compartment in the antennal disc of the pho mutant. Additionally, Dll is ectopically expressed in the more proximal region of the leg disc in the pho mutant, while dac is ectopically expressed in both the proximal and distal regions. These ectopic expressions do not antagonize each other in their normal region of expression, and result in duplication of distal tibia. Finally, en expression extends to the anterior compartment of both the antennal and leg discs of the pho mutant (Kim, 2008).
According to these reasons the following is proposed; first, pho regulates the expression of Antp in the antennal disc, which in turn might activate Dll. It has been shown that Dll is activated in AntpNS discs, which is similar in younger and older pho discs. Second, pho regulates the expression of en, which affects the expression of Dll. As a gene determining the A/P axis during antenna and leg development, en affects expression of wg and dpp, which determine the D/V axis via Hh signaling. Wg and Dpp act as morphogens, restricting the expression domain of hth, dac and Dll. This study has demonstrated that en is misexpressed in the anterior compartment in the antennal and leg discs of the pho mutant, which leads to misexpression of wg in the anterior-dorsal compartment. Although it has been shown that in the pho zygotic mutant embryos en is hardly derepressed, the current study showed that it is depressed in the pho zygotic mutant adults, suggesting that pho is involved in regulation of en expression and indirect regulation of Dll expression. Finally, pho might directly regulate expression of Dll, because recent studies using X-ChIP analysis have shown that PcG proteins bind PREs of appendage genes including Dll and hth. Hence, pho may directly or indirectly maintain the expression of Antp and en and regulates P/D patterning genes during ventral appendage formation (Kim, 2008).
Pho and Phol are the only PcG proteins that have a zinc finger domain. A mutation in pho results in weaker phenotypes than other PcG mutations despite the functioning of Pho as a DNA-binding protein. Therefore, Pho may interact with other corepressors and repress the homeotic selector genes. In fact, Pho binds to PRE, which is facilitated by GAGA. PRE-bound Pho and Phol directly recruit PRC2, which leads to the anchoring of PRC1. Pho interacts with PRC1 as well as with the BRM complex. Pho has recently been used to construct a novel complex, called the Pho-repressive complex (PhoRC), which has selective methyl-lysine-binding activity. It is currently known that pho interacts with two other PcG genes, Pc and Pcl, in vivo (Kim, 2008 and references therein).
Pho binds to approximately 100 sites on the polytene chromosome and colocalizes with PSC in about 65% of these binding sites. PSC is a component of PRC1 and inhibits chromatin remodeling. In the third instar larvae, PSC is found in the nuclei in all regions of all imaginal discs. Therefore, it is possible that pho and Psc interact with each other during the adult structure formation from the imaginal discs. pho and Psc interact in ventral appendage formation. While the Psc heterozygote was normal, it enhanced the adult mutant phenotypes exhibited by the pho homozygous mutant. Antp is more widely expressed in the antennal disc of the double mutant of pho and Psc than in that of the pho single mutant, while Psc mutant clones induced by FRT/FLP system showed normal expression of Antp, which indicated that Psc does not directly act by itself in regulating expression of Antp, but it certainly interacts with pho (Kim, 2008 and references therein).
hth is expressed in the distal region regardless of Antp expression so that dac was expressed not only in presumptive a3 but also in other segments, which results in the formation of a new P/D axis. According to recent study showing that hth may have a PRE, these results suggest that pho and Psc might interact to maintain hth expression during antennal development. Moreover, Dll expression in the antennal disc might be repressed by an unknown factor that was affected by the double mutation of pho and Psc, suggesting that the factor might be regulated by pho interaction with Psc during antennal development. In addition, legs of the double mutant had fused segments and weakly jointed tarsi, which may be because extension of Hh signal lead to the abnormal expression of the P/D patterning genes. In sum, pho functions as a regulator of selector genes for the identification of ventral appendages and axis formation by interaction with Psc during postembryogenesis (Kim, 2008).
In addition, Pho interacts with Phol in ventral appendage formation. Adults of double mutants showed more severe defects in appendage formation than those of single mutant. The stronger ectopic expression of Antp in the antennal disc of phol; pho double mutant seems to be one of reasons for severe defects. While Antp is not expressed in phol mutant clones of the wild type antennal discs, it is more strongly ectopically expressed in phol mutant clones of the pho mutant antennal discs than in their surrounding phol/+; pho/pho cells, indicating that Phol may not regulate the expression of Antp alone, but it may do that by interaction with Pho, suggesting that this may lead to recruit PRC1 including PSC to PRE sites of Antp and other appendage genes (Kim, 2008).
A general question in development is how do adjacent primordia adopt different developmental fates and stably maintain their distinct fates? In Drosophila, the adult eye and antenna originate from the embryonic eye-antenna primordium. These cells proliferate in the larval stage to form the eye-antenna disc. The eye or antenna differs at mid second instar with the restricted expression of Cut (Ct), a homeodomain transcriptional repressor, in the antenna disc and Eyeless (Ey), a Pax6 transcriptional activator, in the eye disc. This study shows that ey transcription in the antenna disc is repressed by two homeodomain proteins, Ct and Homothorax (Hth). Loss of Ct and Hth in the antenna disc resulted in ectopic eye development in the antenna. Conversely, the Ct and Hth expression in the eye disc was suppressed by the homeodomain transcription factor Sine oculis (So), a direct target of Ey. Loss of So in the eye disc caused ectopic antenna development in the eye. Therefore, the segregation of eye and antenna fates is stably maintained by mutual repression of the other pathway (Wang, 2012).
In l-L3 eye-antenna disc, although the expression domain of Ct/Hth and Ey/So are juxtaposed, so3 clones showed derepression of Ct and Hth only in the most posterior region (zone 4) but not in the more anterior regions behind MF (zones 2 and 3). Thus, there may be an additional mechanism to repress Ct and Hth expression. For Hth, the repression is by Dpp and Hh signaling in L3 eye disc. It has not been tested whether Ct is also repressed by Dpp and Hh (Wang, 2012).
For individual cells in the eye-antenna disc, the mutual repression provided a mechanism for a choice of bistable states, either eye or antenna fate. A bistable state can often be maintained by positive-feedback loop, in addition to mutual repression. Such a positive-feedback loop is known for the eye pathway, but has not been reported for the antenna pathway (Wang, 2012).
The mutual transcriptional repression mechanism is expected to work at the level of individual cells. Therefore, a salt-and-pepper mosaic pattern would be predicted unless there is additional patterning influence. The patterning gene dpp is expressed in the posterior margin of e-L2 eye disc, and is required for Eya expression at this stage. However, dpp is not required for the restricted expression of Ct and Ey. It is proposed that there is another patterning gene that biases the antenna disc to express Ct. Thus, the difference between eye and antenna primordia may be predetermined before the onset of Ct and Eya at e-L2 (Wang, 2012).
The subdivision of a developmental primordium into subprimordia with specific fates is a common requirement in development. For example, the mammalian ventral foregut endoderm differentiates into the adjacent liver and pancreas, and a bipotential population of foregut endoderm cells give rise to both liver and pancreas. The maintenance of such division by mutual antagonism has been reported before. For example, the division between the presumptive thalamus and prethalamus in Xenopus is due to the mutual repression by the Irx homeodomain proteins and the Fezf zinc-finger proteins. The boundary between optic cup and optic vesicle is maintained by mutual transcriptional repression between Pax6 and Pax2. The current findings provide a new example, with clear correlation, both temporal and causal, of gene expression changes and developmental fate specification (Wang, 2012).
The maxillary palp and ocelli are derived from specific regions in the eye-antenna disc. The maxillary palp fate does not become segregated from the rest of eye-antenna disc as late as late L3. The timing of ocelli fate decision is not clear. otd is required for ocelli development, and is the first marker for the ocellar region: it is ubiquitously expressed in the early L2 eye-antenna disc, and becomes restricted to the ocellar region in the eye disc in early L3. Thus, the palp and ocelli may be determined as subfields of the antenna disc and eye disc, respectively. This is consistent with the finding that hth>mi-ct+mi-hth (knocking down both ct and hth in their endogenous expression domain) resulted in the loss of palp, whereas so affected ocelli but not palp (Wang, 2012).
The results showed that Ct and Hth are repressed by So. Previous studies also found induction of Ct and Hth expression in so3 clones in a region far posterior to the MF in l-L3 eye disc. The fact that So represses Ct and Hth in two spatially and temporally distinct situations suggest that this is a conserved function of So (Wang, 2012).
Whether the repression of Ct and Hth by So is direct transcriptional repression is not clear. Ectopic So expression caused cell-autonomous repression of Ct and Hth, suggesting that the repression could be direct. Recently it was shown that So acts as a transcriptional repressor to repress ct transcription (Anderson, 2012). So may interact with a repressor and Groucho (Gro) is a likely candidate. So can bind to Gro and the So-Gro complex was postulated to repress Dac transcription in eye disc. The zebrafish So homologue Six3 interacts with Groucho and functions as a transcriptional repressor. The transcriptional co-repressor CtBP has been shown to functionally and physically interact with Ey, Dac and Dan. Whether the protein complex also involves So has not been determined. Overexpression of CtBP caused eye and antenna defect, but the phenotype was not affected by reducing so dose. Therefore, CtBP is probably not the co-repressor for So (Wang, 2012).
so3 clones caused non-autonomous induction of Ct in its surrounding wild-type cells. Similar non-autonomous induction of Dac has been reported in L3 disc. Elevated Delta was observed within the mutant clone and elevated activated N at the border of mutant clone, thus suggesting that the non-autonomous induction is due to N signaling to surrounding cells. Whether a similar mechanism operates in the L2 disc remains to be tested (Wang, 2012).
The finding that ey and toy do not repress Ct and Hth, in both gain-of-function and loss-of-function experiments, was initially perplexing. Clonal ey expression in the antenna disc did not repress Ct and Hth. In these clones, so-lacZ was induced, but not in all ey+ cells and at a level lower than the endogenous level in most cells in the eye disc. When ey was clonally induced at 29°C, Ct level was reduced. These results suggested that the ectopic ey and toy at 25°C induced so at a level not sufficient to repress Ct. The strength of Ey has been shown to be crucial for its ability to induce ectopic eye development. In the double knockdown of ey and toy in the eye disc, Ct and Hth were not induced. Judging from the eye disc phenotype and residual neuronal differentiation, the knockdown was not complete and may account for the failure to detect Ct and Hth derepression. Alternatively, additional factors, independent of ey and toy, may also repress Ct and Hth expression. This would be consistent with the weak effect of so3 clones in inducing Ct and Hth expression (Wang, 2012).
Hth expression is initially uniform in the eye-antenna disc but becomes restricted to the antenna disc in e-L2. In L3 eye disc, Hth expression is downregulated by Dpp and Hh, produced from the progressing MF and developing photoreceptors, respectively. However, Hth expression retracted from the posterior part of the eye disc in e-L2, even before the initiation of MF and photoreceptor differentiation. At e-L2, dpp and hh are expressed in the posterior region of the eye disc. It is possible that the early Hh and Dpp contributed to the repression of Hth from the eye disc, in addition to the repression by So (Wang, 2012).
The results showed that Ct and Hth represses ey transcription. The binding sites for both Hth and Ct in ey3.6 are required for its repression in the antenna disc, suggesting that both Hth and Ct bind to the ey3.6 enhancer directly. The ChIP assay results showed that both Hth and Ct can bind to the ChIP-1 fragment, which contains the binding site for Ct but not for Hth. This suggests that the Hth may bind through a Hth-Ct complex. However, as ectopic expression of either Hth or Ct is sufficient to repress ey transcription, the repression does not require the formation of the Hth-Ct complex (Wang, 2012).
In the RNAi experiments, knocking down Ct or Hth individually did not cause de-repression of the eye pathway genes. However, when the Ct- or Hth-binding site in ey3.6 was separately mutated, the repression of ey3.6 in the antenna disc was partially lost. One possible explanation for the discrepancy is that the RNAi knockdown was not complete. When the binding sites for both Ct and Hth were mutated, the de-repression of ey3.6 in the antenna disc was strongly enhanced. It is possible that both Ct and Hth contributed to the repression of ey transcription, and a threshold net amount of these repressors is required (Wang, 2012).
Hth physically interacts with Exd through the MH domain of Hth and the PBC-A domain of Exd to promote Exd nuclear localization. Hth generally acts as a transcriptional activator , but Hth and Exd can interact with En or UbxIa to repress transcription. Thus, Hth would need to interact with a repressor to repress ey. Ct can serve such a role. Ct can act as a transcriptional repressor by direct binding to a target gene. The human and mouse Ct homologues generally function as transcriptional repressor. However, as ectopic expression of Hth alone in the eye disc, in the absence of Ct, is sufficient to repress ey, Hth must be able to interact with an additional repressor (Wang, 2012).
This study found that Ct can also block the function of Ey when co-expressed with Ey. It is possible that the block resulted from the repression of toy transcription, which may reduce the strength of the feedback regulation of the retinal determination gene network (Wang, 2012).
Although Ct is expressed in L2 in the entire antenna disc, the phenotype caused by ct clones affected only restricted domains, perhaps owing to its later restricted expression. This study reports a novel function of Ct in antenna development. Ct and Hth function redundantly to repress the retinal determination pathway. Because of this functional redundancy, this Ct function was not revealed in ct clones (Wang, 2012).
hth or exd mutations caused antenna-to-leg transformation. Hth has a role in blocking eye development at the anterior margin of the eye disc, where Ct is not expressed. In the antenna disc, this function is masked because of the functional redundancy with Ct revealed in this study (Wang, 2012).
Even when both ct and hth were knocked down in their endogenous expression domain (hth>mi-hth+mi-ct), no significant transformation of the antenna to eye was seen in adult. One possible reason is that the hth>mi-hth+mi-ct caused lethality and the flies have to be raised at a lower temperature, thereby excluding a stronger phenotype. Another possibility is that the Dll expression in the antenna disc served to block eye development. Dll and hth are required in parallel for normal antenna development. Co-expression of Dll and hth can induce the formation of antenna structures in many ectopic sites. It may be the presence of Dll that blocked eye development and provided a leg identity to cause the distal antenna-to-leg transformation found in hth>mi-hth+mi-ct flies (Wang, 2012).
This study has taken advantage of the availability of the assembled genomic sequence of flies, mosquitos, ants and bees to explore the presence of ultraconserved sequence elements in these phylogenetic groups. Non-coding sequences found within and flanking Drosophila developmental genes were compared to homologous sequences in Ceratitis capitata and Musca domestica. Many of the conserved sequence blocks (CSBs) that constitute Drosophila cis-regulatory DNA, recognized by EvoPrinter alignment protocols, are also conserved in Ceratitis and Musca. Also conserved is the position but not necessarily the orientation of many of these ultraconserved CSBs (uCSBs) with respect to flanking genes. Using the mosquito EvoPrint algorithm, uCSBs shared among distantly related mosquito species were identified. Side by side comparison of bee and ant EvoPrints of selected developmental genes identify uCSBs shared between these two Hymenoptera, as well as less conserved CSBs in either one or the other taxon but not in both. Analysis of uCSBs in these dipterans and Hymenoptera will lead to a greater understanding of their evolutionary origin and function of their conserved non-coding sequences and aid in discovery of core elements of enhancers (Brody, 2020).
Phylogenetic footprinting of Drosophila genomic DNA has revealed that cis-regulatory enhancers can be distinguished from other essential gene regions based on their characteristic pattern of conserved sequences. Cross-species alignments have also identified conserved non-coding sequence elements associated with vertebrate developmental genes, and sequences that are conserved among ancient and modern vertebrates (e.g., the sea lamprey and mammals). Elements conserved between disparate taxa are considered to be 'ultraconserved elements'. Previous studies have identified ultra-conserved elements in dipterans, Drosophila species and sepsids and mosquitos. Comparison of consensus transcription factor binding sites in the spider Cupiennius salei and the beetle Tribolium castaneum have been shown to be functional in transgenic Drosophila (Brody, 2020).
This study describes sequence conservation of non-coding sequences within and flanking developmentally important genes in the medfly Ceratitis capitata, the house fly Musca domestica and Drosophila genomic sequences (see Genomic regions analyzed for presence of uCSBs). The house fly and Medfly have each diverged from Drosophila for ~100 and ~120 My respectively. This analysis reveals that, in many cases, CSBs that are highly conserved in Drosophila species, as detected using the Drosophila EvoPrinter algorithm, are also conserved in Ceratitis and Musca. Additionally, the linear order of these ultraconserved CSBs (uCSBs) with respect to flanking structural genes is also maintained. However, a subset of the uCSBs exhibits inverted orientation relative to the Drosophila sequence, suggesting that while enhancer location is conserved, their orientation relative to flanking genes is not (Brody, 2020).
For detection of conserved sequences in mosquitos, EvoPrinter algorithms were adapted to include 22 species of Anopheles plus Culex pipens and Aedes aegypti. Use of Anopheles species allows for the resolution of CSB clusters that resemble those of Drosophila. Comparison of Anopheles with Culex and Aedes, separated by ∼150 million years of evolutionary divergence, reveals uCSBs shared among these taxa. Although mosquitoes are considered to be Dipterans, uCSBs were identified conserved between mosquito species but these were generally not found in flies (Brody, 2020).
In addition, EvoPrinter tools were developed for sequence analysis of seven bee and thirteen ant species. Both ants and bees belong to the Hymenoptera order and have been separated by ~170 million years. Within the bees, Megachile and Dufourea are sufficiently removed from Apis and Bombus (~100 My) that only portions of CSBs are shared between species: these can be considered to be uCSBs. uCSBs are found that are shared between ant and bee species, and these are positionally conserved with respect to their associated structural genes. Finally, this study show sthat ant specific and bee specific CSB clusters that are not shared between the two taxa are in fact interspersed between shared uCSBs (Brody, 2020).
A previous study of 19 consecutive in vivo tested Drosophila enhancers, contained within a 28.9 kb intragenic region located between the vvl and Prat2 genes, revealed that each CSB cluster functioned independently as a spatial/temporal cis-regulatory enhancer (Kundu, 2013). Submission of this enhancer field to the RefSeq Genome Database of Ceratitis capitata via BLASTn revealed 17 uCSBs; all 17 regions were colinear and located between the Ceratitis orthologs of Drosophila vvl and Prat2 genes. In each case the matches between Ceratitis and Drosophila corresponded to either a complete or a portion of a CSB identified by the Drosophila EvoPrinter as being highly conserved among Drosophila species (Kundu, 2013). Submission of the same Drosophila region to Musca domestica RefSeq Genome Database using BLASTn revealed 13 uCSBs that were colinearly arrayed within the Musca genome. Nine of these Ceratitis and Musca CSBs were present in both species and corresponded to CSBs contained in several of the enhancers identified in a previous study of the Drosophila enhancer field (Kundu, 2013). The conservation within one of these embryonic neuroblast enhancers, vvl-41, is shown in the following figure (Ultra-conserved sequences shared among a Drosophila ventral veins lacking enhancer and orthologous DNA within the Ceratitis capitata and Musca domestica genomes.). Each of the CSB elements in vvl-41 that are shared between Dm and Ceratitis are in the same orientation with respect to the vvl structural gene. Three-way alignments of each of the other eight uCSBs within the vvl enhancer field that are shared between Dm, Ceratitis and Musca are shown in a supplemental figure. The uCSB of vvl-49 in Ceratitis is in reverse orientation with respect to the vvl structural gene. Many of the uCSBs in Musca are in a different orientation on the contig than in Dm, indicating microinversions. One of the two uCSBs in Ceratitis goosecoid was in reverse orientation compared to Drosophila CSBs, while three of the four uCSBs in Musca goosecoid were in reverse orientation. One uCSB each in Ceratitis and Musca castor was in reverse orientation compared to Drosophila castor. 10 of the 15 uCSBs in the Musca wingless non-coding region were in the reverse orientation compared to the orientation in Drosophila, while all uCSBs in Ceratitis Dscam2 were in forward orientation compared to the orientation in Drosophila. It is concluded that, except for microinversions, the order and orientation is the same, with respect to flanking genes of highly conserved non-coding sequences in select developmental determinants of Drosophila, Ceratitis and Musca (Brody, 2020).
Many of the non-coding regions in dipteran genomes contain uCSBs, especially in and around developmental determinants, and many of these are likely to be cis-regulatory elements such as those found in the vvl enhancer field. Another example is the prevalence of uCSBs found in the non-coding sequences associated the Dm hth gene locus. A previous study identified an ultraconserved region in hth shared between Drosophila and Anopheles. This study has identified additional hth uCSBs shared among Dm, Ceratitis and Musca. A 55,100 bp upstream region of Dm hth terminating just after the start of the first exon. A total of 11 CSBs shared between the three species, 5 CSBs were shared between Dm and Ceratitis but not Musca, and 6 CSBs were shared between Dm and Musca, but not Ceratitis. Ceratitis exhibited 4 uCSBs and Musca exhibited 8 uCSBs that were in reversed orientation with respect to the Drosophila orthologous regions. Additional genes analyzed in this paper were also analyzed for association with uCSBs in Ceratitis and Musca, and these results are summarized in the table. In some cases, for example wingless in Ceratitis, the presence of uCSBs could not be verified because of the incomplete assembly of the genome, leaving coding sequences and uCSBs on different contigs. In another case, Dscam2 in Musca, no uCSBs were identified (Brody, 2020).
EvoPrint analysis of Drosophila hth sequences immediately upstream and including the first exon, revealed a conserved sequence cluster associated with the transcriptional start site. Two of the longer CSBs were conserved in both Ceratitis and Musca, one shorter CSB was conserved only in Musca, and a second shorter CSB was conserved only in Ceratitis. Each of the uCSBs was in the same orientation with respect to the hth structural gene (Brody, 2020).
EvoPrinting combinations of species using A. gambiae as a reference species and multiple species from the Neocellia and Myzomyia series and the Neomyzomyia provides a sufficient evolutionary distance from A. gambiae to resolve CSBs. Phylogenic analysis has revealed the Anopheles species diverged from ~48 My to ~30 My while Aedes and Culex diversified from the Anopheles lineage in the Jurassic era or even earlier (Brody, 2020).
This study sought to identify uCSBs in selected mosquito developmental genes by comparing Anopheles species with Aedes and Culex. Non-coding sequences associated with the mosquito homolog of the morphogen wingless were examined to discover associated conserved non-coding sequences. A CSB cluster slightly more than 27,000 bp upstream of the A. gambiae wingless coding exons is shown (EvoPrint analysis of the intragenic region adjacent to the Anopheles Wnt-4 and wingless genes identifies ultra-conserved sequences shared with the evolutionary distant Culex pipiens and Aedes aegypti genomes). CSB orientation in A. gambiae was reversed with respect to the ORF when compared to the orentations of both Culex and Aedes CSBs. It is noteworthy that this EvoPrint, carried out using multiple Anopheles, consists of a cluster of CSBs, resembling EvoPrints carried out using Drosophila species. This general pattern of CSB clusters separated by poorly conserved 'spacers' is prevalent among other developmental determinants in mosquitos. uCSBs, conserved in Culex and Aedes, coincide with CSBs revealed by EvoPrint analysis of Anopheles non-coding sequences. A supplemental figure illustrates an EvoPrinter scorecard for the non-coding wingless-associated CSB cluster described in the above figure. Scores for the first four species, all members of the gambiae complex, are similar to that of A. gambiae against itself, with subsequent scores reflecting increased divergence from A. gambiae. Culex and Aedes are distinguished from the other species by their belonging to a distinctive branch of the mosquito evolutionary tree, the Culicinae subfamily and their low scores against the A. gambiae input sequence. No uCSBs were detected associated with gbb or gsc, while uCSBs were readily detected associated with vvl, cas and hth. A single uCSB in Aedes cas and two uCSBs in Culex cas exhibited a reverse configuration compared to the uCSBs in Anopheles. One uCSB in Culex vvl and no uCSBs in Aedes vvl exhibited a reverse configuration compared to the uCSB in Anopheles. Finally, all uCSBs in Culex and Aedes hth were in forward orientation compared to Anopheles. None of the uCSBs shared between Drosophila, Ceratitis and Musca were conserved in mosquitos, with the exception of a single uCSB associated with a 3'UTR (CTTCGTTTTTGCAAGAGGCCCATATAGCTCGCCAA) that is fully conserved in the Dipteran species tested, A possible explanation for this lack of conservation is the observation that mosquitos are only distantly related to Diptera (Brody, 2020).
Bees and ants are members of the Hymenoptera Order, representing the Apoidea (bee) and Vespoidea (ant) super-families. Current estimates suggest that the two families have evolved separately for over 100 million years. To identify conserved sequences either shared by bees and ants or unique to each family, EvoPrinter alignment tools were developed for seven bee and 13 ant species and searched for CSBs that flank developmental determinants. Three approaches were employed to identify/confirm conserved elements and their positioning within bee and ant orthologous DNAs. First, EvoPrinter analysis of bee and ant genes identified conserved sequences in either bees or ants and ultra-conserved sequence elements shared by both families. Second, BLASTn alignments of the orthologous DNAs identified/confirmed CSBs that were either bee or ant specific or shared by both. Third, side-by-side comparisons of ant and bee EvoPrints and BLASTn comparisons revealed similar positioning of orthologous CSBs relative to conserved exons (Brody, 2020).
To identify conserved sequences within bee species EvoPrints of the honey bee (Apis mellifera) genes were generated using other Apis and Bombus species. Using EvoPrints of the Dscam2 locus, clusters of conserved sequences were resolved. Dscam2 is implicated in axon guidance in Drosophila and in regulation of social immunity behavior in honeybees. The EvoPrint scorecard revealed a high score (close relationship) with the homologous region in the other two Apis species. The more distant Bombus species score lower by greater than 50%, and Habropoda represents a step down from the more closely related Bombus species. Megachile shows a significantly lower score reflecting its more distant relationship to Apis mellifera. The relaxed EvoPrint readout reveals two CSB clusters. Only one sequence cluster, the lower 3' cluster, is conserved in all six test species examined, while the 5' cluster is present in all species except Megachile. BLAST searches confirmed that the 3' cluster was absent from Megachile, a more distant species Dufourea novaeangliae, and all ant species in the RefSeq genome database. BLASTn alignments also revealed conservation of the 3' cluster in D. novaeangliae, the wasp species Polistes canadensis and two ant species, Vollenhavia emeryi and Dinoponera quadriceps (Brody, 2020).
EvoPrinter analysis of bee and ant genes that are orthologs of Drosophila neural development genes goosecoid (gsc) and castor (cas) revealed conserved non-coding DNA that is unique to either bees or ants or conserved in both. EvoPrints of the Hymenoptera orthologs identify non-coding conserved sequence clusters that contained core uCSBs shared by both ant and bee superfamilies, and these uCSBs are frequently flanked by family-specific conserved clusters. For example, analysis of the non-coding sequence upstream of the Wasmannia auropunctata (ant) cas first exon identifies both a conserved sequence cluster that contains ant and bee uCSBs and an ant specific conserved cluster that has no counterpart found in bees. It is likely that the ant specific cluster was deleted in bees, since BLASTn searches of Wasmannia against the European paper wasp Polistes dominula reveals conservation of a core sequence corresponding to this cluster. The combined evolutionary divergence in the gsc and cas EvoPrints, accomplished by use of multiple test species, reveals that many of the amino acid codon specificity positions are conserved while wobble positions in their ORFs are not. The lack of wobble conservation indicates that the combined divergence of the test species used to generate the prints afford near base pair resolution of essential DNA (Brody, 2020).
Cross-group/side-by-side bee and ant comparison of their conserved DNA was performed using bee specific and ant specific EvoPrints and by BLASTn alignments (see Side-by-side comparison of conserved sequences within the bee and ant glass bottom boat loci identify clusters of conserved and species-specific sequences.). This figure highlights the conservation observed among bee and ant exons and flanking sequence of the glass bottom boat (gbb, 60A) locus of Apis melliflera EvoPrinted with four bee test species and the Wasmannia auropunctata gbb locus EvoPrinted with three ant species. Position and orientation of these CSB clusters and uCSBs is conserved. Similarly, EvoPrinting a single exon and flanking regions of the Apis mellifera homothorax locus with four bee species and generating an ant specific EvoPrint of the orthologous ant sequence of the Ooceraea biroi homothorax locus with ten other ant species, reveals CSBs that are conserved in both Apis and Ooceraea, as well as sequences that are restricted to one of the two Hymenopteran families (Brody, 2020).
This study describes the use of EvoPrinter to detect the presence of ultraconserved non-coding sequences in flies, including Drosophila species, Ceratitis and Musca, in mosquitos and in Hymenoptera species. uCSBs of the three fly taxa have, for the most part, maintained their linear order suggesting a functional constraint on the order of regulatory sequences. For mosquitos, an older taxon than that of flies and the Hymenoptera, uCSBs are found to be shared between Anopheles, Culex and Aedes. Importantly, in Hymenoptera, uCSBs were found within clusters of conserved sequences shared between ants and bees. This conservation of core sequences in enhancers suggests that these morphologically divergent taxa share common regulatory networks. These approaches to detection of uCSBs in flies, mosquitos and ants and bees will lead to a greater understanding of their evolutionary origin and the function of their conserved non-coding sequences. Knowledge of clusters of CSBs and of uCSBs is an important tool for discovery of the core elements of enhancers and their sequence extent (Brody, 2020).
In most cases both nBLAST and the EvoPrinter algorithm had similar sensitivities and gave comparable results. However, it is recommended that the two techniques should be used in conjunction with one another to enhance CSB and uCSB detection. For example, by using both approaches, uCSBs were discovered that were identified by one tool but not both. The advantage of EvoPrinter is the presentation of an interspecies comparison as a single sequence, while the advantage of nBLAST is that it provides a sensitive detection of sequence homology in a one-on-one alignment. EMBOSSED Needle alignment gives an even more sensitive detection of shorter sequences and is of use once BLAT or EvoPrinter has been used to discover shared CSBs and/or CSB clusters (Brody, 2020).
homothorax:
Biological Overview
| Evolutionary Homologs
| Targets of Activity
| Protein Interactions
| Developmental Biology
| Effects of Mutation
| References
Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.
The Interactive Fly resides on the
Society for Developmental Biology's Web server.