InteractiveFly: GeneBrief

nervy : Biological Overview | Regulation | Developmental Biology | Effects of Mutation | Evolutionary Homologs | References


Gene name - nervy

Synonyms -

Cytological map position - 60C5--6

Function - scaffold protein, potential transcriptional co-repressor

Keywords - axon guidance, central nervous system

Symbol - nvy

FlyBase ID: FBgn0005636

Genetic map position - 2R

Classification - AKAP binding protein, zinc finger protein

Cellular location - cytoplasmic and potentially nuclear



NCBI link: Entrez Gene

nvy orthologs: Biolitmine
BIOLOGICAL OVERVIEW

Members of the MTG protein family function in the nucleus as transcriptional corepressors (Davis, 2003; Rossetti, 2004). Although a cytoplasmic function for Nervy, described in this section of The Interactive Fly, cannot be ruled out, it has been suggested that the axonal migration phenotypes observed in nervy mutant Drosophila embryos may be due to alterations in gene expression rather than a failure to anchor PKA to the plasma membrane (Ice, 2005: summarized below). Terman and Kolodkin (2005) respond to Ice (2005) by maintaining that the molecular, genetic, in situ hybridization, immunolocalization, and immunoprecipitation data support that Nervy can be found in the cytoplasm, interacts with the cytoplasmic domain of the plasma membrane receptor PlexA, and directly modulates PlexA signaling by functioning as an AKAP (Terman, 2005; full text of article).

Cyclic nucleotides regulate axonal responses to a number of guidance cues through unknown molecular events. Drosophila nervy, a member of the myeloid translocation gene family of A kinase anchoring proteins (AKAPs), regulates repulsive axon guidance by linking the cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) to the Semaphorin 1a (Sema-1a) receptor Plexin A (PlexA). Nervy and PKA antagonize Sema-1a-PlexA-mediated repulsion, and the AKAP binding region of Nervy is critical for this effect. Thus, Nervy couples cAMP-PKA signaling to PlexA to regulate Sema-1a-mediated axonal repulsion, revealing a simple molecular mechanism that allows growing axons to integrate inputs from multiple guidance cues (Terman, 2004).

Many semaphorin proteins, including the Drosophila transmembrane semaphorin Sema-1a, are axonal repellents that signal through transmembrane plexin proteins. Nervy, a Drosophila homolog of the mammalian MTG8 proto-oncogene, was identified in a yeast interaction screen as a Plexin A-interacting protein. Nervy belongs to a phylogenetically conserved protein family consisting of Drosophila Nervy and three mammalian proteins: myeloid translocation gene (MTG) 8, MTG16, and MTGR1. Mammalian MTG proteins are tumorigenic, but the cellular processes they control are poorly defined. MTG8 and MTG16 were recently found to bind the regulatory subunit of type II cAMP-dependent protein kinase (PKA RIIalpha and function as PKA (or A kinase) anchoring proteins (AKAPs) in lymphocytes (Fukuyama, 2001; Schillace, 2002). AKAPs position type II PKA at defined locations to allow for the spatially and temporally specific phosphorylation of target proteins in response to local increases in cAMP. Drosophila Nervy shows considerable amino acid conservation with MTG proteins within a consensus PKA RII binding site, suggesting that Nervy may be an AKAP that couples cAMP-PKA signaling to semaphorin-plexin-mediated axon guidance. Cyclic nucleotides, including cAMP, are known to alter how axons respond to guidance cues, including semaphorins, but a direct molecular link coupling cAMP-PKA signaling to specific guidance cue signaling pathways has remained elusive (Terman, 2004).

Evidence is provided for cAMP-PKA modulation of Sema-1a–mediated repulsive guidance by the association of the AKAP nervy with the PlexA receptor. These results are consistent with in vitro observations describing a role for cAMP in regulating semaphorin repulsion in vertebrates. cAMP antagonists neutralize the effects of cyclic guanosine monophosphate (cGMP) on Sema3A repulsion, while Sema3A repulsion is increased by inhibiting PKA and neutralized by increasing cAMP. The conserved nature of semaphorin-plexin signaling suggests that vertebrate MTG proteins (Sacchi, 1998) may underlie these observations as well as observations that increased cAMP levels enhance axonal regeneration in the mammalian CNS. The observed interactions between plexin and Nervy are also consistent with roles described for AKAPs in other signaling pathways, allowing precisely localized PKA to be maintained close to its activators and substrates. What activates PKA bound to nervy? Anchored PKA is poorly dissociated by basal cAMP levels, so inputs from other signaling pathways, such as those activated by netrin or G protein–coupled receptors, may specifically regulate semaphorin signaling by locally increasing cAMP and activating PKA. PKA targets in the vicinity of PlexA may include L-type Ca2+ channels, or the Rho guanosine triphosphatase. Therefore, modulation of semaphorin signaling through the direct coupling of PKA to plexin by an AKAP allows for the integration of multiple guidance cues by the neuronal growth cone, enabling local, rapid, and directed responses to a complex extracellular environment (Terman, 2004).

Comment on 'Nervy links protein kinase A to plexin-mediated semaphorin repulsion'

Terman and Kolodkin (2004) recently suggested that Nervy, a Drosophila homolog of the mammalian myeloid translocation gene (MTG) family, functions at the plasma membrane as a protein kinase (PKA) anchoring protein (AKAP). Their findings were surprising because mammalian MTGs localize to nuclei and function as transcriptional corepressors by recruiting histone deacetylases. The antiserum Terman and Kolodkin used to detect endogenous Drosophila Nervy in immunoblot analysis and to localize Nervy to the plasma membrane of neurons by immunostaining (1) was not raised against Nervy but was an antibody to ETO (MTG8) developed in the Heibert laboratory against the C terminus of ETO/MTG8 (marketed through EMD Biosciences as anti-ETO Ab-1). Although the human ETO/MTG family members are well conserved in the C-terminal region, this antibody modestly recognized MTG16 and only weakly recognized the third MTG family member, Mtgr1, which is 61% identical in the antigenic region (Ice, 2005).

To determine whether anti-ETO Ab-1 recognizes the less homologous Drosophila Nervy (which is only 29% homologous in this region), a Myc-epitope tagged form of Nervy (Myc-nvy) was obtained from Terman and Kolodkin. DNA sequence analysis confirmed the identity of the cDNA. A second form of Nervy was created containing both the Myc tag and the GAL4 DNA binding domain (Gal4-nvy). Using the cytomegalovirus (CMV) immediate early promoter, Gal4-Nvy and Myc-Nvy were expressed at very high levels in Cos-7 cells. In numerous experiments with several antibody concentrations, anti-ETO Ab-1 failed to detect either form of Nervy, even when expressed at very high levels and under conditions in which the ETO/MTG8 signal was rapidly overexposed. In contrast, antibodies directed to the epitope tags or to Nervy confirmed robust expression of GAL-Nvy and Myc-Nvy. Although anti-ETO Ab-1 was obtained from a single rabbit, two bleeds of antiserum were supplied to EMD Biosciences. Both bleeds were tested and it was found that neither recognized Nervy. Upon long exposures, however, several background bands were observed, with one migrating in the 75-kD range. Thus, anti-ETO Ab-1 did not recognize Nervy in immunoblot experiments, which suggests that the band observed previously by Terman and Kolodkin was a background band that was serendipitously reduced in the nervy mutant (Ice, 2005).

Immunolocalization results were compared in Drosophila embryos obtained with antibodies raised against Drosophila Nervy and anti-ETO Ab-1. In wild-type embryos, anti-ETO Ab-1 diffusely labeled the longitudinal axon tracts and several scattered cells, a pattern similar to that previously reported by Terman and Kolodkin. However, an identical pattern was observed in nervy loss-of-function mutant embryos, indicating that it is nonspecific staining. In contrast, an extensively characterized anti-Nvy labeled the nuclei of a subset of central nervous system (CNS) and peripheral nervous system (PNS) cells. The pattern of Nervy protein matched the nervy mRNA pattern and, in contrast to anti-ETO, anti-Nvy produced no detectable staining in nervy mutant embryos. Further, in contrast to the previous study, no maternal nervy expression was observed by in situ hybridization or by immunostaining. Anti-Nvy also failed to label axons, which were labeled by anti-Fasciclin II (FasII). Although these results do not exclude the possibility that there is some Nervy in axons, they demonstrate that Nervy is predominantly, and perhaps exclusively, a nuclear protein and that anti-ETO could not be used to detect Nervy in Drosophila embryos (Ice, 2005).

Although ETO/MTG8 and MTG16 have also been suggested to be AKAPs, these studies found the proteins in the Golgi, not the plasma membrane. The Golgi localization is surprising because MTGs lack membrane translocation signal sequences. The antisera used in some of these experiments detected several proteins approximately 40 kD larger than the predicted or observed molecular weights of MTG8 or MTG16, which raises the possibility that the antisera may cross-react with a Golgi protein or that these proteins correspond to novel isoforms of MTG family members (Ice, 2005).

In summary, the results described here are consistent with previous findings showing that members of the MTG protein family function in the nucleus as transcriptional corepressors (Davis, 2003; Rossetti, 2004). Although a cytoplasmic function for Nervy cannot be ruled out, it is suggested that the axonal migration phenotypes observed in nervy mutant Drosophila embryos may be due to alterations in gene expression rather than a failure to anchor PKA to the plasma membrane (Ice, 2005).

Evidence that nervy promotes mechanosensory organ development by enhancing Notch signaling

In the imaginal tissue of developing fruit flies, achaete (ac) and scute (sc) expression defines a group of neurally-competent cells called the proneural cluster (PNC). From the PNC, a single cell, the sensory organ precursor (SOP), is selected as the adult mechanosensory organ precursor. The SOP expresses high levels of ac and sc and sends a strong Delta (Dl) signal, which activates the Notch (N) receptor in neighboring cells, preventing them from also adopting a neural fate. Previous work has determined how ac and sc expression in the PNC and SOP is regulated, but less is known about SOP-specific factors that promote SOP fate. This study describes the role of nervy (nvy), the Drosophila homolog of the mammalian proto-oncogene ETO, in mechanosensory organ formation. Nvy is specifically expressed in the SOP, where it interacts with the Ac and Sc DNA binding partner Daughterless (Da) and affects the expression of Ac and Sc targets. nvy loss- and gain-of-function experiments suggest that nvy reinforces, but is not absolutely required for, the SOP fate. A model is proposed in which nvy acts downstream of ac and sc to promote the SOP fate by transiently strengthening the Dl signal emanating from the SOP (Wildonger, 2005).

These results suggest that Nvy plays a role, albeit subtle, in the SOP's ability to send a strong Dl signal to neighboring cells. Although the data demonstrate that nvy is not required for the SOP fate, it is suggested that the ability of Nervy to increase the Dl signal sent by the SOP helps to reinforce the SOP fate. When nvy is ectopically expressed it completely inhibits the formation of mechanosensory organs. Using reagents that mark the PNC and SOP, it was found that ectopic Nvy blocks the formation of the SOP, but not the PNC. In contrast, elevating Nvy levels specifically within the SOP (using neur-Gal4) does not affect sensory organ development, indicating that ectopic Nvy blocks the formation of the SOP but does not inhibit its development once it is specified. Furthermore, ectopic Nvy does not block mechanosensory organ formation when Sens is also over-expressed, suggesting that ectopic Nvy blocks SOP formation before there are high levels of Sens in the nascent SOP. Consistent with this idea, no Sens expression is observed in the pnr domain of pnr-Gal4 UAS-nvy wing discs or in clones that ectopically express Nvy. These data suggest that ectopic Nvy interferes with SOP formation at a stage before Sens is expressed, which corresponds to when the SOP is initially specified (Wildonger, 2005).

nvy is normally expressed in the SOP shortly after Ac and Sc levels increase. Given the expression of endogenous nvy within the SOP, the following two possibilities werre considered to explain the ectopic Nvy phenotype and to gain some clues about wild type function of nvy. (1) It is possible that ectopic Nvy blocks SOP formation cell autonomously by inhibiting the expression of ac, sc, or their downstream targets (such as sens) that are necessary for SOP formation. (2) It is possible that ectopic Nvy acts cell non-autonomously by enhancing Dl signaling, resulting in the 'mutual inhibition' of cells expressing precociously high levels of nvy. A closer examination of clones that ectopically express Nvy revealed that SOPs were significantly less likely to form near the borders of Nvy expressing clones than control clones. These results suggest that Nvy is acting, at least in part, cell non-autonomously, perhaps by increasing the strength of the Dl signal (we discuss the possibility that Nvy may also act cell autonomously in the following section). As a test of this idea, Nvy was ectopically expressed in clones lacking nic, which encodes a transmembrane protein required for cleaving and activating N in response to ligand binding. Ectopic Nvy was unable to block SOP formation in nic mutant clones, demonstrating that Nvy's ability to block SOP formation requires the N signaling pathway to be intact. This finding is therefore consistent with the idea that Nvy normally enhances the level of active Dl in the SOP. Importantly, loss-of-function nvy experiments are also consistent with this proposed role for Nvy. Using two different methods to remove nvy (expressing nvy RNAi or generating clones of a nvy deficiency), it was found that PNC cells that neighbor nvy− clones are more likely to adopt the SOP fate than PNC cells that neighbor wild type clones. This result is similar to what was observed when the relative amount of Dl differs between neighboring PNC cells: PNC cells that neighbor cells with less Dl are more likely to differentiate as SOPs. In contrast to the Dl experiments, however, the complete absence of nvy did not cause all PNCs to become SOPs. Keeping in mind that nvy expression is restricted to the SOP (nvy is not detectably expressed in the PNC), these data suggest that nvy is not a general regulator of Dl signaling throughout the PNC, but that nvy enhances Dl activity in the SOP when it is forming (Wildonger, 2005).

Although these experiments are consistent with the idea that nvy enhances Dl signaling in the SOP, no changes in Dl protein levels were directly detected in either nvy loss- or gain-of-function situations. There are several possible explanations for this negative result: (1) it is possible that nvy does affect Dl expression levels, but that the change is too slight or brief to distinguish with the available anti-Dl antibody; (2) nvy might not affect Dl expression, but affect its localization and/or signaling ability in a manner that cannot be detected in these experiments; (3) it is also possible that nvy does not affect Dl at all, but interacts with other factors to produce the phenotypes observed. It is suggested that experiments using VP16-Nvy help to distinguish between these possibilities. Expressing VP16-Nvy produces results opposite to those resulting from expressing Nvy: VP16-Nvy enhances E-lacZ expression, which ectopic Nvy represses, and its expression results in ectopic Sens+ SOPs. Based on these data and the evidence that ETO, the mammalian homolog of Nvy, acts as a transcriptional repressor, it is suggested that VP16-Nvy acts as a transcriptional activator of targets that wild type Nvy normally represses. When expressed in a PNC, VP16-Nvy strongly reduces the amount of Dl observed at the cell surface and in intracellular vesicles. This result suggests that wild type Nvy has the potential to affect Dl, although the result does not distinguish an effect on expression from an effect on protein stability or trafficking. That ectopic Nvy does not inhibit the expression of Dl-lacZ suggests that Nvy may be more likely to transcriptionally regulate a factor is involved in Dl stability or trafficking. Regardless of the mechanism, the finding that VP16-Nvy reduces Dl levels suggests that wild type Nvy has the potential to increase Dl levels, a proposal that is consistent with loss- and gain-of-function experiments (Wildonger, 2005).

The VP16-Nvy results, while consistent with the idea that Nvy affects Dl, do not explain why no change in Dl levels were detected in nvy loss- and gain-of-function experiments. Thus, it is thought that Nvy causes a small and/or transient increase in Dl activity (by affecting its expression, stability or localization). Nevertheless, no change in the amount or localization of Dl in wild type SOPs has been observed, despite genetic evidence that Dl signaling is a critical step in SOP fate determination. The lack of an observable change in Dl during wild type development, in combination with the current findings, lead to a proposal that the presumptive SOP may send a transient pulse of increased Dl signal that is sufficient to bias cell fates within the PNC. Nvy may, therefore, contribute to this transient pulse of Dl (Wildonger, 2005).

The experiments described here shed some light on the molecular activities Nvy has in the SOP. (1) Based on its ability to repress well-defined lacZ reporter genes, Nvy appears to be a transcriptional repressor, as is its mammalian homolog ETO. (2) This study shows that ectopic Nvy appears to interfere with the function (as opposed to the expression) of Ac and Sc because re-supplying Ac and Sc in pnr-Gal4 UAS-nvy flies was unable to rescue the bald phenotype. In contrast, expression of Da, a bHLH DNA binding partner for Ac and Sc, was able to partially rescue the bald phenotype of pnr-Gal4 UAS-nvy flies. Moreover, nvy and da were found to genetically interact (e.g., reducing nvy levels enhanced a da gain-of-function phenotype), and Nvy and Da were found to physically interact. These findings are consistent with a recent report showing that ETO directly interacts with HEB, a bHLH factor in the same class as Da. The domain through which ETO interacts with HEB (and other mammalian class I bHLH transcription factors) is conserved in Nvy, and HEB's ETO interaction domain is found in Da. These data lead to a proposal that Nvy, a presumptive transcriptional repressor, has the ability to function with Ac/Da and Sc/Da heterodimers to repress the transcription of some target genes. In the absence of Nvy, such as in the non-SOP cells of a PNC, Ac/Da and Sc/Da may have the potential to activate these same target genes. However, these experiments also suggest that the interaction between Nvy and Da may not be required for all of Nvy's functions because VP16-Nvy is able to lower Dl levels even in da mutant clones. One potential explanation for this Da-independent function is that Nvy may be able to directly interact with DNA. In summary, it is speculated that the Nvy–Da interaction is only required for the regulation of a subset of target genes (Wildonger, 2005).

The proposal that Nvy works with Ac/Da and Sc/Da to repress target genes may on the surface seem at odds with the suggestion that Nvy can transiently increase the levels of Dl, because it is thought that Ac/Da and Sc/Da heterodimers activate Dl expression in the SOP. However, it is not known if Dl levels are in fact directly increased by Ac/Sc. It is stressed that the timing of expression of these genes is critical to understanding how they function in vivo. Based on the wild type timing of its expression, nvy is likely to be a target of Ac/Sc in the presumptive SOP. Accordingly, there will be a window of time when Ac/Sc levels are high and Nvy levels are low in the presumptive SOP. This window of time may be sufficient for Ac/Sc to affect Dl expression and initiate the bias in favor of the SOP fate. Once Nvy levels increase, it may then work with Ac/Sc to repress the expression of some target genes, some of which may cause a further increase in Dl signaling. However, it is hypothesized that nvy's role in this process is after the bias has already been initiated (Wildonger, 2005).

In summary, it is suggested that Nvy plays a subtle but observable role in the establishment of the SOP fate. Although it is not essential for the SOP fate, it may be that Nvy helps the SOP/non-SOP bias by increasing the strength of the Dl signal sent by the SOP. Because nvy is evolutionarily conserved, both in its protein sequence and nervous system expression, it is suggested that this role, although subtle, is important for the stereotyped uniformity of mechanosensory organ development. In addition, nvy may also play a role in later stages of neurogenesis, in particular axon pathfinding. Because of Nvy's role as a transcriptional repressor, it is further suggested that Nvy increases the Dl signal indirectly, by repressing a gene (factor X) that normally inhibits Dl activity. Based on Nvy's ability to interact with Da, this hypothetical target may be repressed by Nvy in combination with Ac/Da and Sc/Da heterodimers. Interestingly, it follows that in non-SOP cells of the PNC, which express ac and sc but not nvy, this hypothetical target may continue to be expressed, helping to downregulate Dl activity in these cells and thereby further increase the SOP/non-SOP bias. Clearly, the test of this proposal requires the identification of factor X as well as a more detailed understanding of how Dl levels and activity are modulated in the SOP (Wildonger, 2005).


REGULATION

Promoter

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

Drosophila Hindsight and mammalian RREB-1 are evolutionarily conserved DNA-binding transcriptional attenuators

The Drosophila Hindsight (hnt) gene encodes a C2H2-type Zinc-finger protein, HNT, that plays multiple developmental roles including control of embryonic germ band retraction and regulation of retinal cell fate and morphogenesis. While the developmental functions of the human HNT homolog, RREB-1, are unknown, it has been shown to function as a transcriptional modulator of several tumor suppressor genes. This study investigated HNT's functional motifs, target genes and its regulatory abilities. The C-terminal region of HNT, containing the last five of its 14 Zinc fingers, binds in vitro to DNA elements very similar to those identified for RREB-1. HNT's in vivo binding sites were mapped on salivary gland polytene chromosomes, and where HNT is bound to two target genes, hnt itself and nervy (nvy), was defined at high resolution. Data from both loss-of-function and over-expression experiments show that HNT attenuates the transcription of these two targets in a tissue-specific manner. RREB-1, when expressed in Drosophila, binds to the same polytene chromosome sites as HNT, attenuates expression of the hnt and nvy genes, and rescues the germ band retraction phenotype. HNT's ninth Zinc finger has degenerated or been lost in the vertebrate lineage. A HNT protein mutant for this finger can also attenuate target gene expression and rescue germ band retraction. Thus HNT and RREB-1 are functional homologs at the level of DNA binding, transcriptional regulation and developmental control (Ming, 2013).

Protein Interactions
Nervy, like PlexA, is highly expressed in the Drosophila embryonic central nervous system (CNS), including in motor neurons (Feinstein, 1995) and their axons. An antibody to a conserved region of mammalian MTG proteins also identified Drosophila Nervy within CNS and motor axons. Immunoprecipitation of hemagglutinin (HA) epitope–tagged neuronal PlexA from Drosophila embryonic lysates revealed associated Nervy, and neuronal HA-PlexA was detected in immunoprecipitates of Nervy, which suggests that nervy and PlexA interact in neurons. Nervy also immunoprecipitates with PKA RII in Drosophila embryos, and an epitope (Myc) tagged neuronal nervy immunoprecipitated with Drosophila PKA RII, which indicates that nervy is a neuronal AKAP (Terman, 2004).

If Nervy serves to tether PKA to the PlexA receptor, then type II PKA should associate in a complex with PlexA. An antibody specific for PKA RII decorates embryonic Drosophila CNS and motor axons, and PKA RII coimmunoprecipitated (co-IP) with HA-PlexA expresses in neurons, showing that type II PKA is associated with the PlexA receptor complex. pka RII LOF mutant embryos also exhibit highly penetrant axon guidance defects that closely resemble the guidance defects observed in nervy LOF, PlexA GOF, and MICAL GOF mutants. In addition, pka RII LOF mutants, like nervy LOF mutants, enhance the repulsive effects of Sema-1a, which suggests that type II PKA antagonizes Sema-1a repulsive axon guidance (Terman, 2004).

To test the necessity of nervy-type II PKA interactions in regulating Sema-1a-PlexA signaling, a single amino acid substitution of a proline for a valine residue was made in Nervy (nervyV523P) that was analogous to a mutation that disrupts MTG16-PKA RII interactions. Transgenic flies were generated expressing epitope (myc)-tagged nervyV523P, but unlike neuronal expression of wild-type nervy in a nervy LOF mutant background, neuronal nervyV523P failed to rescue the nervy LOF mutant phenotypes. Therefore, it was reasoned that nervyV523P might function in a dominant-negative manner by retaining its ability to bind to PlexA but blocking the coupling of PKA to PlexA. Indeed, expression of myc-nervyV523P in all neurons in a wild-type background results in axon guidance phenotypes similar to those seen in nervy or pka RII LOF mutants. These phenotypes are the opposite of those seen when wild-type Nervy is expressed in all neurons and are indicative of increased Sema-1a-PlexA repulsion because they resemble MICAL and PlexA GOF mutants. These results suggest that nervy's ability to bind type II PKA is critical for the modulation of Sema-1a-PlexA repulsive guidance (Terman, 2004).


DEVELOPMENTAL BIOLOGY

Embryonic

In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. A subtractive hybridization procedure was used to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, a set of mutant genotypes was developed that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, it was demonstrated that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. In abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes, nervy, whose expression is confined to the nervous system, predicts a protein that is similar to a human proteoncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes (Feinstein, 1995).


EFFECTS OF MUTATION

Two nervy loss-of-function (LOF) mutants, nervy PDFKG1 and nervy PDFKG38 were generated; they exhibit highly penetrant axon guidance phenotypes consistent with increased axonal repulsion. Motor axons within the intersegmental nerve b (ISNb) pathway require Sema-1a-PlexA repulsive signaling to selectively defasciculate from the intersegmental nerve (ISN) and normally innervate muscles 6/7 and 12/13. In nervy LOF mutants, motor axons within the ISNb pathway often exit the ISN and ISNb in abnormal locations, are excessively defasciculated, and project incorrectly within the ventral musculature. Motor axons within other pathways such as segmental nerve a (SNa) are also abnormally defasciculated in nervy LOF mutants and project to inappropriate areas. CNS projections are also abnormal in nervy LOF mutants. In wild-type embryos, three evenly spaced and uniformly thick longitudinal axon bundles are detected on each side of the CNS with an antibody to Fasciclin II (FasII). In nervy LOF mutants, axons within the third, most lateral, longitudinal bundle are less tightly fasciculated and often extend away from the CNS in inappropriate bundles. A full-length nervy transgene expressed in all neurons rescues these axon guidance defects in nervy LOF mutants, demonstrating that these phenotypes result from a lack of neuronal Nervy. nervy LOF mutant phenotypes are qualitatively and quantitatively similar to those phenotypes observed following increased expression in all neurons [gain of function (GOF)] of PlexA or its downstream signaling partner MICAL, which suggests that Nervy may antagonize Sema-1a-PlexA repulsive axon guidance (Terman, 2004).

In contrast to nervy LOF phenotypes, overexpression of Nervy in all neurons in a wild-type background (nervy GOF) decreases the ability of motor axons to defasciculate and innervate their muscle targets. These phenotypes are consistent with the absence of, or inability to respond to, an axonal repellent and are identical to those seen in Sema1a, PlexA, MICAL, and Off-track (OTK, part of the Sema-1a signaling cascade) LOF mutants. ISNb axons often fail to defasciculate from each other, or even from the ISN, in nervy GOF mutants and bypass their muscle targets. Likewise, axons within the SNa pathway fail to defasciculate in nervy GOF mutants and often stall along their trajectory. Sema1a, PlexA, MICAL, and OTK LOF-like phenotypes are also seen in the CNS of nervy GOF mutants: The outermost 1D4-positive longitudinal connective was thinner in some segments, discontinuous in others, and often fused with the middle Fas2-positive fascicle. These results support a role for nervy in antagonizing Sema-1a-PlexA repulsive axon guidance (Terman, 2004).

If nervy antagonizes Sema-1a signaling, then reducing nervy expression should increase the repulsive effects of Sema-1a. Very few axon guidance defects were observed when low levels of Sema1a were expressed in all muscles. Expression of low levels of Sema-1a in all muscles in a nervy heterozygous background, however, results in an increase in Sema-1a repulsion and leads to the inability of motor axons to defasciculate and innervate their muscle targets. These phenotypes are identical to those seen when high levels of Sema-1a are expressed in all muscles. This dominant enhancement of a weak Sema1a GOF phenotype by nervy, together with dominant suppression of a weak Sema1a LOF phenotype by nervy, suggest that Nervy and Sema1a function in the same signaling pathway but have opposing effects, and that Nervy acts downstream of Sema-1a to regulate repulsive guidance (Terman, 2004).

Nervy was identified in a genome-wide analyses for transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites

Dendrite arborization patterns are critical determinants of neuronal function. To explore the basis of transcriptional regulation in dendrite pattern formation, RNA interference (RNAi) was used to screen 730 transcriptional regulators and 78 genes involved in patterning the stereotyped dendritic arbors of class I da neurons were identified in Drosophila. Most of these transcriptional regulators affect dendrite morphology without altering the number of class I dendrite arborization (da) neurons and fall primarily into three groups. Group A genes control both primary dendrite extension and lateral branching, hence the overall dendritic field. Nineteen genes within group A act to increase arborization, whereas 20 other genes restrict dendritic coverage. Group B genes appear to balance dendritic outgrowth and branching. Nineteen group B genes function to promote branching rather than outgrowth, and two others have the opposite effects. Finally, 10 group C genes are critical for the routing of the dendritic arbors of individual class I da neurons. Thus, multiple genetic programs operate to calibrate dendritic coverage, to coordinate the elaboration of primary versus secondary branches, and to lay out these dendritic branches in the proper orientation (Parrish, 2006; Full text of article).

To assay for the stereotyped dendrite arborization pattern of class I da neurons (hereafter referred to as class I neurons) in RNAi-based analysis of dendrite development, a Gal4 enhancer trap line (Gal4221) was used that is highly expressed in class I neurons and weakly expressed in class IV neurons during embryogenesis. Because of the simple and stereotyped dendritic arborization patterns of the dorsally located ddaD and ddaE, the studies of dendrite development focused on these two dorsally located class I neurons (Parrish, 2006).

To establish that RNAi is an efficient method to systematically study dendrite development in the Drosophila embryonic PNS, it was demonstrated that injecting embryos with double-stranded RNA (dsRNA) for green fluorescent protein (gfp) is sufficient to attenuate Gal-4221-driven expression of an mCD8::GFP fusion protein as measured by confocal microscopy. Next whether RNAi could efficiently phenocopy loss-of-function mutants known to affect dendrite development was tested. Similar to the mutant phenotype of short stop (shot), which encodes an actin/microtubule cross-linking protein, shot(RNAi) caused routing defects, dorsal overextension, and a reduction in lateral branching of dorsally extended primary dendrites. Likewise, RNAi of sequoia or flamingo resulted in overextension of ddaD and ddaE, RNAi of hamlet resulted in supernumerary class I neurons, and RNAi of tumbleweed resulted in supernumerary class I neurons and a range of arborization defects, consistent with the reported mutant phenotypes. Thus, RNAi is effective in generating reduction of function phenotypes in embryonic class I dendrites (Parrish, 2006).

In addition to genes with functions in promoting dendrite arborization, 20 group A genes were identified that regulate dendrite arborization by limiting dendrite growth and/or branching. Consistent with recent reports that loss of function of the BTB/POZ domain TF abrupt (ab) causes an increase in dendritic branching and altered distribution of branches, it was found that ab(RNAi) altered the arborization of class I dendrites. ab(RNAi) caused an increase in the number and length of lateral branches, expanding the coverage field most noticeably along the anteroposterior (AP) axis. In addition to these defects, ab(RNAi) also caused frequent cell death, consistent with the phenotype observed for a hypomorphic allele of ab (Parrish, 2006).

Increased dendritic branching also resulted from RNAi of several genes known to affect nervous system development, including Adh transcription factor 1 (Adf1), the zinc finger TF nervy (nvy), the basic helix–loop–helix (bHLH) TF deadpan (dpn), as well as genes not previously known to affect neuronal function, such as the putative transcription elongation factor Elongin c. Both Adf1 and dpn mutants have defects in larval locomotion and, in light of recent findings suggesting that da neurons may regulate aspects of larval locomotion, it is possible that dendrite defects underlie these behavioral defects. Consistent with its role in class I dendrite development, dpn is expressed in all PNS neurons. Likewise, nervy has been implicated in regulation of axon branching in motorneurons and is apparently expressed in most neurons. Thus, nervy likely regulates multiple aspects of neuronal differentiation. Finally, Elongin C may regulate transcriptional elongation but also likely functions as a component of a multimeric protein complex that includes the von Hippel-Lindau (VHL) tumor suppressor and targets specific proteins for poly-ubiquitination and degradation. Moreover, BTB/POZ domain proteins (such as cg1841 and ab) function as substrate adaptors for cullin E3 ligases. Interestingly, RNAi of a Drosophila homolog (tango) of a known VHL substrate (HIF-1) also affected dendrite arborization. It thus appears that protein degradation pathways regulate dendrite arborization (Parrish, 2006).


EVOLUTIONARY HOMOLOGS

Structure and expression of Nervy homologs

The t(8;21) translocation associated with acute myeloid leukemia (AML) disrupts two genes, the AML1 gene also known as the core binding factor A2 (CBFA2) on chromosome 21, and a gene on chromosome 8, hereafter referred to as MTG8, but also known as CDR and ETO. Extensive information is available on AML1, a member of the CBF family of transcription factors, containing a highly conserved domain, the runt box, of the Drosophila segmentation gene runt. This gene is essential for the hematopoietic development and is found disrupted in several leukemias. In contrast, the function of the MTG8 gene is poorly understood. The predicted protein sequence shows two unusual, putative zinc-fingers, three proline-rich regions, a PEST domain and several phosphorylation sites. In addition, a region was found encompassing aa 443-514 that was predicted to have a significant propensity to form coiled coil structures. MTG8 displays a high degree of similarity with nervy, a homeotic target gene of Drosophila, expressed in the nervous system. Human and mouse wild-type MTG8 are also highly expressed in brain relative to other tissues. For these reasons, the expression and subcellular localization of the MTG8 protein in neural cells was investigated. Immunohistochemical experiments in a 12.5-day-old mouse embryo clearly show that the protein was expressed in the neural cells of the developing brain and the spinal cord. In primary cultures of hippocampal neurons of 2-3 day-old mice, MTG8 is found in the nucleus, in the cytoplasm and as fine granules in the neurites. Cytoplasmic localization of the protein is observed in Purkinje cells of both human and mouse cerebellum. The molecular mass of MTG8 in total human and mouse brain was analysed by immunoblotting and determined to be between 70 and 90 kDa. Isoforms with the same molecular mass were demonstrated in synaptosomes isolated from mouse forebrain. The evidence of MTG8 in the nucleus and cytoplasm of neural cells suggests a specific mechanism regulating the subcellular localization of the protein (Sacchi, 1998).

MTG8 (HGMW-approved symbol: CBFA2T1) was originally identified as one of the loci involved in the t(8;21)(q22;q22) of acute myeloid leukemia. Two human MTG8-related genes, MTGR1 and MTGR2 (HGMW-approved symbols: CBFA2T2 and CBFA2T3) have been characterized. The former is duplicated in mouse, one locus possibly being a retroposon. Multiple MTG8-related sequences are found in several vertebrate species, from fish to mammals, albeit not in a urodele. MTGR2 maps to 16q24 and, like MTG8 and MTGR1, is close to one of three loci encoding a syntrophin (dystrophin-associated proteins). Moreover, an alternative MTGR1 promoter/5' exon is contained within the alpha1-syntrophin locus. Thus, the two classes of genes may define novel paralogous groups. MTGR1 is expressed mainly in brain, while MTGR2 is expressed in the thymus and possibly in monocytes. Like MTG8, MTGR1 is transcribed into a number of isoforms due to alternative splicing of different 5' exons onto a common splice acceptor site. Comparison of the three predicted human MTG8-related polypeptides to their Drosophila counterpart (Nervy) highlights four separate regions of sequence conservation that may correspond to distinct domains. The most NH2-terminal of these is proportionately more conserved among the human polypeptides, presumably due to specific structural/functional constraints (Calabi, 1998).

Nervy homologs serve as an AKAP by interacting with a subunit of PKA

MTG8 interacts with the regulatory subunit of type II cyclic AMP-dependent protein kinase (PKA RIIalpha). The binding site of MTG8 is NHR3 domain, and that of RIIalpha is the N-terminus for interacting with PKA anchoring proteins (AKAPs). NHR3 contains a putative alpha-amphipathic helix which is characteristic in binding of AKAPs with RII. Indirect immunofluorescence microscopy showed that MTG8 and RIIalpha overlap at the centrosome-Golgi area in lymphocytes. These findings suggest that MTG8 may function as an AKAP at the centrosome-Golgi area in lymphocytes (Fukuyama, 2001).

Increased levels of intracellular cAMP inhibit T cell activation and proliferation. One mechanism is via activation of the cAMP-dependent protein kinase (PKA). PKA is a broad specificity serine/threonine kinase whose fidelity in signaling is maintained through interactions with A kinase anchoring proteins (AKAPs). AKAPs are adaptor/scaffolding molecules that convey spatial and temporal localization to PKA and other signaling molecules. To determine whether T lymphocytes contain AKAPs that could influence the inflammatoryresponse, PBMCs and Jurkat cells were analyzed for the presence of AKAPs. RII overlay and cAMP pull down assays detected at least six AKAPs. Western blot analyses identified four known AKAPs: AKAP79, AKAP95, AKAP149, and WAVE. Screening of a PMA-stimulated Jurkat cell library identified two additional known AKAPs, -- AKAP220 and AKAP-KL, and one novel AKAP, myeloid translocation gene 16 (MTG16b). Mutational analysis identified the RII binding domain in MTG16b as residues 399-420, and coimmunoprecipitation assays provide strong evidence that MTG16b is an AKAP in vivo. Immunofluorescence and confocal microscopy illustrate distinct subcellular locations of AKAP79, AKAP95, and AKAP149 and suggest colocalization of MTG and RII in the Golgi. These experiments represent the first report of AKAPs in T cells and suggest that MTG16b is a novel AKAP that targets PKA to the Golgi of T lymphocytes (Schillace, 2002).

Nervy homologs interact with a repressor complex

The t(8;21) translocation between two genes known as AML1 and ETO is seen in approximately 12%-15% of all acute myeloid leukemia (AML) and is the second-most-frequently observed nonrandom genetic alteration associated with AML. AML1 up-regulates a number of target genes critical to normal hematopoiesis, whereas the AML1/ETO fusion interferes with this trans-activation. The fusion partner ETO binds to the human homolog of the murine nuclear receptor corepressor (N-CoR). The interaction is mediated by two unusual zinc finger motifs present at the carboxyl terminus of ETO. Human N-CoR (HuN-CoR), which was cloned and sequenced in its entirety, encodes a 2,440-amino acid polypeptide and has a central domain that binds ETO. N-CoR, mammalian Sin3 (mSin3A and B), and histone deacetylase 1 (HDAC1) form a complex that alters chromatin structure and mediates transcriptional repression by nuclear receptors and by a number of oncoregulatory proteins. ETO, through its interaction with the N-CoR/mSin3/HDAC1 complex, is also a potent repressor of transcription. This observation provides a mechanism for how the AML1/ETO fusion may inhibit expression of AML1-responsive target genes and disturb normal hematopoiesis (Wang, 1998).

Nuclear receptor corepressor (CoR)-histone deacetylase (HDAC) complex recruitment is indispensable for the biological activities of the retinoic acid receptor fusion proteins of acute promyelocytic leukemias. ETO (eight-twenty-one or MTG8), which is fused to the acute myelogenous leukemia 1 (AML1) transcription factor in t(8;21) AML, interacts via its zinc finger region with a conserved domain of the corepressors N-CoR and SMRT and recruits HDAC in vivo. The fusion protein AML1-ETO retains the ability of ETO to form stable complexes with N-CoR/SMRT and HDAC. Deletion of the ETO C terminus abolishes CoR binding and HDAC recruitment and severely impairs the ability of AML1-ETO to inhibit differentiation of hematopoietic precursors. These data indicate that formation of a stable complex with CoR-HDAC is crucial to the activation of the leukemogenic potential of AML1 by ETO and suggest that aberrant recruitment of corepressor complexes is a general mechanism of leukemogenesis (Gelmetti, 1998).

ETO interacts with the nuclear receptor corepressor N-CoR, the mSin3 corepressors, and histone deacetylases. Endogenous ETO also cosediments on sucrose gradients with mSin3A, N-CoR, and histone deacetylases, suggesting that it is a component of one or more corepressor complexes. Deletion mutagenesis indicates that ETO interacts with mSin3A independently of its association with N-CoR. Single amino acid mutations that impair the ability of ETO to interact with the central portion of N-CoR affect the ability of the t(8;21) fusion protein to repress transcription. Finally, AML-1/ETO associates with histone deacetylase activity and a histone deacetylase inhibitor impairs the ability of the fusion protein to repress transcription. Thus, t(8;21) fuses a component of a corepressor complex to AML-1 to repress transcription (Lutterbach, 1998).

Distinct domains of ETO contact the mSin3A and N-CoR corepressors; two binding sites within ETO are described for each of these corepressors. Of eight histone deacetylases (HDACs) tested, only the class I HDACs HDAC-1, HDAC-2, and HDAC-3 bind ETO. However, these HDACs bind ETO through different domains. The murine homologue of MTG16, ETO-2, is also a transcriptional corepressor that works through a similar but distinct mechanism. Like ETO, ETO-2 interacts with N-CoR, but ETO-2 fails to bind mSin3A. Furthermore, ETO-2 binds HDAC-1, HDAC-2, and HDAC-3 but also interacts with HDAC-6 and HDAC-8. Expression of AML-1-ETO causes disruption of the cell cycle in the G(1) phase. Disruption of the cell cycle requires the ability of AML-1-ETO to repress transcription because a mutant of AML-1-ETO, Delta469, which removes the majority of the corepressor binding sites, has no phenotype. Moreover, treatment of AML-1-ETO-expressing cells with trichostatin A, an HDAC inhibitor, restores cell cycle control. Thus, AML-1-ETO makes distinct contacts with multiple HDACs and an HDAC inhibitor biologically inactivates this fusion protein (Amann, 2001).

Nervy homologs as transcriptional co-repressors

The promyelocytic leukemia zinc finger (PLZF) protein is a sequence-specific DNA-binding transcriptional factor fused to retinoic acid receptor alpha in acute promyelocytic leukemia associated with the (11;17)(q23;q21) translocation. PLZF also mediates transcriptional repression through the actions of corepressors and histone deacetylases. ETO is one of the corepressors recruited by PLZF. The PLZF and ETO proteins associate in vivo and in vitro, and ETO can potentiate transcriptional repression by PLZF. The N-terminal portion of ETO forms complexes with PLZF, while the C-terminal region, which binds to N-CoR and SMRT, is required for the ability of ETO to augment transcriptional repression by PLZF. The second repression domain (RD2) of PLZF, not the POZ/BTB domain, is necessary to bind to ETO. Corepression by ETO is completely abrogated by histone deacetylase inhibitors. This identifies ETO as a cofactor for a sequence-specific transcription factor and indicates that, like other corepressors, it functions through the action of histone deactylase (Melnick, 2000).

DRPLA is one of the family of neurodegenerative diseases caused by expansion of a polyglutamine tract. The drpla gene product, atrophin-1 (Drosophila homolog: Grunge), is widely expressed, has no known function or activity, and is found in both the nuclear and cytoplasmic compartments of neurons. Truncated fragments of atrophin-1 accumulate in neuronal nuclei in a transgenic mouse model of DRPLA, and may underlie the disease phenotype. Using the yeast two-hybrid system, studies have identified ETO/MTG8, a component of nuclear receptor corepressor complexes, as an atrophin-1-interacting protein. When cotransfected into Neuro-2a cells, atrophin-1 and ETO/MTG8 colocalize in discrete nuclear structures that contain endogenous mSin3A and histone deacetylases. These structures are sodium dodecyl sulfate-soluble and are associated with the nuclear matrix. Cotransfection of ETO/MTG8 with atrophin-1 recruits atrophin-1 to the nuclear matrix, while atrophin-1 and ETO/MTG8 cofractionate in nuclear matrix preparations from brains of DRPLA transgenic mice. Furthermore, in a cell transfection-based assay, atrophin-1 represses transcription. Together, these results suggest that atrophin-1 associates with nuclear receptor corepressor complexes and is involved in transcriptional regulation. Emerging links between disease-associated polyglutamine proteins, nuclear receptors, translocation-leukemia proteins, and the nuclear matrix may have important repercussions for the pathobiology of this family of neurodegenerative disorders (Wood, 2000).

Nearly 40% of cases of acute myelogenous leukemia (AML) of the M2 subtype are due to a chromosomal translocation that combines a sequence-specific DNA binding protein, AML1, with a potent transcriptional repressor, ETO. ETO interacts with nuclear receptor corepressors SMRT and N-CoR, which recruit histone deacetylase to the AML1-ETO oncoprotein. SMRT-N-CoR interaction requires each of two zinc fingers contained in C-terminal Nervy homology region 4 (NHR4) of ETO. However, polypeptides containing NHR4 are insufficient for interaction with SMRT. NHR2 is also required for SMRT interaction and repression by ETO, as well as for inhibition of hematopoietic differentiation by AML1-ETO. NHR2 mediates oligomerization of ETO as well as AML1-ETO. Fusion of NHR4 polypeptide to a heterologous dimerization domain allows strong interaction with SMRT in vitro. These data support a model in which NHR2 and NHR4 have complementary functions in repression by ETO. NHR2 functions as an oligomerization domain bringing together NHR4 polypeptides that together form the surface required for high-affinity interaction with corepressors. Since nuclear receptors also interact with corepressors as dimers, oligomerization may be a common mechanism regulating corepressor interactions (Zhang, 2001).

E protein silencing by the leukemogenic AML1-ETO fusion protein

The AML1-ETO fusion protein, generated by the t(8;21) chromosomal translocation, is causally involved in nearly 15% of acute myeloid leukemia (AML) cases. This study shows that AML1-ETO, as well as ETO (Drosophila homolog: Nervy), inhibits transcriptional activation by E proteins (e.g. Drosophila Daughterless) through stable interactions that preclude recruitment of p300/CREB-binding protein (CBP) coactivators. These interactions are mediated by a conserved ETO TAF4 homology domain and a 17-amino acid p300/CBP and ETO target motif within AD1 activation domains of E proteins. In t(8;21) leukemic cells, very stable interactions between AML1-ETO and E proteins underlie a t(8;21) translocation-specific silencing of E protein function through an aberrant cofactor exchange mechanism. These studies identify E proteins as AML1-ETO targets whose dysregulation may be important for t(8;21) leukemogenesis, as well as an E protein silencing mechanism that is distinct from that associated with differentiation-inhibitory proteins (Zhang, 2004).

Nervy homologs and leukemia

Leukemic disease can be linked to aberrant gene expression. This often is the result of molecular alterations in transcription factors that lead to their misrouting within the nucleus. The acute myelogenous leukemia-related fusion protein AML1ETO is a striking example. It originates from a gene rearrangement t(8;21) that fuses the N-terminal part of the key hematopoietic regulatory factor AML1 (RUNX1) to the ETO (MTG8) repressor protein. AML1ETO lacks the intranuclear targeting signal of the wild-type AML1 and is directed by the ETO component to alternate nuclear matrix-associated sites. To understand this aberrant subnuclear trafficking of AML1ETO, a series of mutations in the ETO protein was created. These were characterized biochemically by immunoblotting and in situ by immunofluorescence microscopy. Two independent subnuclear targeting signals were identified in the N- and C-terminal regions of ETO that together direct ETO to the same binding sites occupied by AML1ETO. However, each segment alone is targeted to a different intranuclear location. The N-terminal segment contains a nuclear localization signal and the conserved hydrophobic heptad repeat domain responsible for protein dimerization and interaction with the mSin3A transcriptional repressor. The C-terminal segment spans the nervy domain and the zinc finger region, which together support interactions with the corepressors N-CoR and HDACs. These findings provide a molecular basis for aberrant subnuclear targeting of the AML1ETO protein, which is a principal defect in t(8;21)-related acute myelogenous leukemia (Barseguian, 2002).

Developmental roles of Nervy homologs

The interaction between early proneural genes and lateral inhibition determines the number of primary neurons. The mechanism for regulating the size of the proneural domain, however, has not been clarified. This study shows that inhibition of the function of XETOR in Xenopus, a homolog of human oncoprotein ETO/MTG8, leads to a neurogenic phenotype of expanded proneural domain without alteration in the density of primary neurons. This result suggests that XETOR is a prerequisite for regulating the size of the proneural domain. Such a regulation is accomplished by establishing a negative feedback loop between XETOR and proneural genes except Xngnr-1, as well as by antagonism between XETOR and lateral inhibition (Cao, 2002).

The putative transcriptional corepressor ETO/MTG8 has been extensively studied due to its involvement in a chromosomal translocation causing the t(8;21) form of acute myeloid leukemia. Despite this, the role of ETO in normal physiology has remained obscure. ETO is highly expressed in preadipocytes and acts as an inhibitor of C/EBPbeta during early adipogenesis, contributing to its characteristically delayed activation. ETO prevents both the transcriptional activation of the C/EBPalpha promoter by C/EBPbeta and its concurrent accumulation in centromeric sites during early adipogenesis. ETO expression rapidly reduces after the initiation of adipogenesis, and this is essential to the normal induction of adipogenic gene expression. These findings define, for the first time, a molecular role for ETO in normal physiology as an inhibitor of C/EBPbeta and a novel regulator of early adipogenesis (Rochford, 2004).

A TAF4-homology domain from the corepressor ETO is a docking platform for positive and negative regulators of transcription

ETO, is implicated in 12%-15% of acute human leukemias as part of a gene fusion with RUNX1. Of the four ETO domains related to Drosophila Nervy, only two are required to induce spontaneous myeloid leukemia upon transplantation into the mouse. One of these domains is related in sequence to TAF4, a component of TFIID. The structure of this domain, ETO-TAFH, is similar to yeast Rpb4 and to Escherichia coli sigma(70); it is the first TAF-related protein with structural similarity to the multisubunit RNA polymerases. Overlapping surfaces of ETO-TAFH interact with an autonomous repression domain of the nuclear receptor corepressor N-CoR and with a conserved activation domain from the E-box family of transcription factors. Thus, ETO-TAFH acts as a structural platform that can interchange negative and positive coregulatory proteins to control transcription (Wei, 2007).


REFERENCES

Search PubMed for articles about Drosophila nervy

Amann, J. M., et al. (2001). ETO, a target of t(8;21) in acute leukemia, makes distinct contacts with multiple histone deacetylases and binds mSin3A through its oligomerization domain. 11533236

Barseguian, K., et al. (2002). Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins. Proc. Natl. Acad. Sci. 99(24): 15434-9. 12427969

Brody, T., Rasband, W., Baler, K., Kuzin, A., Kundu, M. and Odenwald, W. F. (2008). Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers. BMC Genomics 9: 371. PubMed Citation: 18673565

Calabi, F. and Cilli, V. (1998). CBFA2T1, a gene rearranged in human leukemia, is a member of a multigene family. Genomics 52(3): 332-41. Medline abstract: 9790752

Cao, Y., Zhao, H. and Grunz, H. (2002). XETOR regulates the size of the proneural domain during primary neurogenesis in Xenopus laevis. Mech. Dev. 119(1): 35-44. 12385752

Davis, J. N., McGhee, L. and Meyers, S. (2003). The ETO (MTG8) gene family. Gene 303: 1-10. PubMed citation: 12559562

Feinstein, P. G., Kornfeld, K., Hogness, D. S., Mann, R. S. (1995). Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue. Genetics 140(2): 573-86. 7498738

Fukuyama, T., Sueoka, E., Sugio, Y., Otsuka, T., Niho, Y., Akagi, K. and Kozu, T. (2001). MTG8 proto-oncoprotein interacts with the regulatory subunit of type II cyclic AMP-dependent protein kinase in lymphocytes. Oncogene 20(43): 6225-32. 11593431

Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G. and Lazar, M. A. (1998). Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO. Mol. Cell. Biol. 18(12): 7185-91. 9819405

Ice, R. J., Wildonger, J., Mann, R. S. and Hiebert, S. W. (2005). Comment on 'Nervy links protein kinase A to plexin-mediated semaphorin repulsion'. Science 309(5734): 558. PubMed citation: 16040690

Lutterbach, B., et al. (1998). ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors. Mol. Cell. Biol. 18(12): 7176-84. 9819404

Melnick, A. M., et al. (2000). The ETO protein disrupted in t(8;21)-associated acute myeloid leukemia is a corepressor for the promyelocytic leukemia zinc finger protein. Mol. Cell. Biol. 20(6): 2075-86. 10688654

Ming, L., Wilk, R., Reed, B. H. and Lipshitz, H. D. (2013). Drosophila Hindsight and mammalian RREB-1 are evolutionarily conserved DNA-binding transcriptional attenuators. Differentiation 86(4-5): 159-70. PubMed ID: 24418439

Parrish, J. Z., Kim, M. D., Jan, L. Y. and Jan, Y. N. (2006). Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites. Genes Dev. 20(7): 820-35. Medline abstract: 16547170

Rochford, J. J., et al. (2004). ETO/MTG8 is an inhibitor of C/EBPbeta activity and a regulator of early adipogenesis. Mol. Cell. Biol. 24(22): 9863-72. 15509789

Rossetti, S., Hoogeveen, A. T. and Sacchi, N. (2004). The MTG proteins: chromatin repression players with a passion for networking. Genomics 84(1): 1-9. PubMed citation: 15203199

Sacchi, N., et al. (1998). Subcellular localization of the oncoprotein MTG8 (CDR/ETO) in neural cells. Oncogene 16(20): 2609-15. 9632137

Schillace, R. V., Andrews, S. F., Liberty, G. A., Davey, M. P. and Carr, D. W. (2002). Identification and characterization of myeloid translocation gene 16b as a novel a kinase anchoring protein in T lymphocytes. J. Immunol. 168(4): 1590-9. 11823486

Terman, J. R. and Kolodkin, A. L. (2004). Nervy links protein kinase a to plexin-mediated semaphorin repulsion. Science 303(5661): 1204-7. Medline abstract: 14976319

Terman, J. R. and Kolodkin, A. L. (2004). Response to comment on 'Nervy links Protein kinase A to Plexin-mediated Semaphorin repulsion.' Science 309; 558. Online text

Wang, J., Hoshino, T., Redner, R. L., Kajigaya, S. and Liu J. M. (1998). ETO, fusion partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the human N-CoR/mSin3/HDAC1 complex. Proc. Natl. Acad. Sci. 95(18): 10860-5. 9724795

Wei, Y., et al. (2007). A TAF4-homology domain from the corepressor ETO is a docking platform for positive and negative regulators of transcription. Nat. Struct. Mol. Biol. 14(7): 653-61. Medline abstract: 17572682

Wildonger, J. and Mann, R. S. (2005). Evidence that nervy, the Drosophila homolog of ETO/MTG8, promotes mechanosensory organ development by enhancing Notch signaling. Dev. Biol. 286(2): 507-20. Medline abstract: 16168983

Wood, J. D., et al. (2000). Atrophin-1, the dentato-rubral and pallido-luysian atrophy gene product, interacts with ETO/MTG8 in the nuclear matrix and represses transcription. J. Cell Biol. 150: 939-948. Medline abstract: 10973986

Zhang, J., et al. (2001). Oligomerization of ETO is obligatory for corepressor interaction. Mol. Cell. Biol. 21(1): 156-63. Medline abstract: 11113190

Zhang, J., et al. (2004). E protein silencing by the leukemogenic AML1-ETO fusion protein. Science 305: 1286-1289. Medline abstract: 15333839


Biological Overview

date revised: 23 July 2014

Home page: The Interactive Fly © 2017 Thomas Brody, Ph.D.