lame duck
The transcription factor Twist initiates Drosophila mesoderm development, resulting in the formation of heart, somatic muscle, and other cell types. Using a Drosophila embryo sorter, enough homozygous twist mutant embryos were isolated to perform DNA microarray experiments. Transcription profiles of twist loss-of-function embryos, embryos with ubiquitous twist expression, and wild-type embryos were compared at different developmental stages. The results implicate hundreds of genes, many with vertebrate homologs, in stage-specific processes in mesoderm development. One such gene, gleeful/lame duck, related to the vertebrate Gli genes, is essential for somatic muscle development and sufficient to cause neural cells to express a muscle marker (Furlong, 2001).
Formation of muscles during embryonic development is a complex process that requires coordinate actions of many genes. Somatic, visceral, and heart muscle are all derived from mesoderm progenitor cells. The Drosophila twistgene, which encodes a bHLH transcription factor, is essential for multiple steps of mesoderm development: invagination of mesoderm precursors during gastrulation, segmentation, and specification of muscle types. The role of twist in mesoderm development has been conserved during evolution, perhaps because it controls conserved regulatory mesoderm genes. For example, tinman and dMef2 are regulated by Twist in flies and are highly conserved in sequence and function in vertebrates (Furlong, 2001).
In Drosophila, somatic muscle forms from progenitor cells that divide to become muscle founder cells. Founder cells acquire unique identities controlled by transcription factors including Krüppel, S59, vestigial, and apterous. Each of the 30 body wall muscles in an abdominal hemisegment is initiated by a single founder cell and has unique attachments and innervations. To further clarify mechanisms underlying founder cell specification, myoblast fusion, and muscle patterning, Drosophila mutants together with microarrays of cDNA clones were used (Furlong, 2001).
twist mutant embryos develop no mesoderm. The population of mRNA species isolated from twist homozygous embryos were compared with that of stage-matched wild-type embryos. Drosophila lethal mutations are maintained as heterozygotes, in trans to balancer chromosomes. A twist mutation was established in trans to a balancer chromosome carrying a transgene encoding green fluorescent protein (GFP). Embryos were collected from wild-type and twist/GFP-balancer fly stocks at specific developmental stages. The twist/GFP-balancer collections contain a mixed population of embryos: one-quarter twist homozygotes lacking GFP; half heterozygotes with one copy of GFP, and one-quarter homozygous for the balancer chromosome with two copies of GFP. Homozygous twist mutant embryos were separated from their siblings using an embryo sorter. Putative homozygous twist embryos were assessed by immunostaining with an antibody to dMef2. More than 99% of the selected embryos had the twist phenotype (Furlong, 2001).
Three different periods of mesoderm development were analyzed: stages 9-10, 11, and 11-12. During stage 9-10, the earliest time GFP is detectable in the balancer embryos, mesoderm cells migrate dorsally and become specified as somatic, visceral, cardiac, and fat body mesoderm. twist and its direct targets tinman and dMef2 are expressed throughout stage 9-10 mesoderm. The middle period contains stage 11 embryos and is a transition between the first period (stage 9-10) and the third period (late stage 11-12). During late stage 11 and stage 12, myoblast fusion begins and twist expression remains prominent in only a subset of the somatic muscle cells (Furlong, 2001).
For each developmental period, three independent embryo collections, embryo sortings, and microarray hybridizations were conducted. The microarrays used for the analysis contained over 8500 cDNAs corresponding to 5081 unique genes plus a variety of controls. Each embryonic RNA sample was compared with a reference sample, which contains RNA made from all stages of the Drosophila life cycle and allows direct comparisons among all the experiments (Furlong, 2001).
To determine how transcription was affected by the twist mutation, SAM (significance analysis of microarrays) analysis was used. Genes that are normally highly expressed in mesoderm should have lower transcript levels in twist homozygotes. Genes in other tissues whose expression depends on signals from the mesoderm might also have reduced expression. Transcripts of 130 genes, the 'Twist-low' group, were significantly lower in twist mutants than in wild type. Conversely, cells that would have formed mesoderm may take on other fates in the absence of twist, such as neuroectoderm; therefore, many transcript levels could increase in twist mutants. Genes whose transcription is repressed by signals from the mesoderm would also be enriched in twist mutants. One hundred fifty genes, called the 'Twist-high' group, have increased levels of RNA in twist mutant embryos (Furlong, 2001).
In total, 280 of ~5000 genes had significant changes in transcript levels, with 10 false positives. The genes on the array include 15 previously characterized mesoderm-specific genes, all of which were significantly reduced in twist mutant embryos. The arrays also contain genes known to be
transcribed in both mesoderm and other cell types. Significant changes in expression were detected for many of these genes (Furlong, 2001).
To ectopically express twist, a dominant gain-of-function mutation of the maternal gene Toll (Toll10B) was used. Activated Toll induces the expression of twist and snail in early embryos and of immune response genes in older embryos. Thus, the effects of Toll10B on gene expression reflect the activities of Twist as well as Snail and Dorsal, or their combined actions. Toll10B embryos are essentially bags of mesoderm; epidermal structures are absent or greatly reduced, and they have been used successfully in subtractive hybridization screens to identify mesoderm genes. The gene transcription profile of Toll10B embryos was compared with that of wild-type embryos during four periods of development, using the reference sample to normalize experiments. The earliest period, stage 5, is when twist is initially expressed in presumptive mesoderm. The other three periods analyzed were those used in the twist mutant analysis: stages 9-10, 11, and 11-12 (Furlong, 2001).
Data from loss- and gain-of-function experiments, combined with careful staging, yield a useful picture of genes that are likely to be required for mesoderm specification and muscle differentiation. Of 360 identified mesoderm genes, 273 have not been the focus of developmental studies. The predicted proteins encode transcription factors, signal transduction molecules, kinases, and pioneer proteins. The stage at which each gene is active is one criterion for assigning possible functions. Another key criterion will be finding a mutant phenotype. As a pilot, this additional step was undertaken for the gene CG4677 (LD47926). Changes in CG4677 transcript levels were also observed in a Toll10B subtractive hybridization screen (Furlong, 2001).
CG4677 is transcribed in the visceral mesoderm at stages 10-13 and the somatic mesoderm during stages 11-13. This gene encodes a C2H2 zinc finger transcription factor with high sequence similarity to vertebrate Gli proteins, the gene has been named gleeful (gfl). Mammalian Gli proteins act downstream of Hedgehog signaling proteins to control target gene transcription (Furlong, 2001).
The role of gfl in mesoderm development was assessed by disrupting its function using RNA interference. Injection of a double-stranded RNA (dsRNA) control sequence had no effect on mesoderm development. In contrast, gfl dsRNA injection causes severe loss and disorganization of somatic muscle cells, whereas heart and visceral muscle were unaffected. A similar phenotype was seen in Df(3R)hh homozygous embryos: the deficiency removes gfl but not the nearby hedgehog gene (Furlong, 2001).
To determine whether gfl can induce muscle cell development, a UAS-gfl transgenic fly strain was generated. Ectopic expression of gfl using an en-GAL4 driver results in lethality and induction of ectopic dMEF2 expression in the ventral nerve cord. Remarkably, Gfl is sufficient to induce expression of a muscle gene in neuronal cells. Previous studies have shown an essential role for Sonic hedgehog signaling in the formation of slow muscle in avian and zebrafish embryos. gfl may be performing a similar role in Drosophila somatic muscle development (Furlong, 2001).
lame duck expression was examined in wg and N mutant embryos to determine the relative position of lmd within the genetic hierarchy that controls somatic muscle specification. In wgcx4 mutant embryos, lmd RNA expression is not detectable in dorsolateral and lateral somatic mesodermal cells although there is residual expression in cells located in the ventral region. Thus, activation of lmd expression is mediated via wg-dependent and wg-independent pathways. Significantly, lmd expression in the somatic mesoderm is completely abolished in N5419 mutant embryos, indicating that activation of lmd expression in presumed fusion-competent myoblasts requires active Notch signaling. By contrast, founder cell formation is promoted in the absence of Notch function (Duan, 2001).
Smooth muscle plays a prominent role in many fundamental processes and diseases, yet understanding of the transcriptional network regulating its development is very limited. The FoxF transcription factors are essential for visceral smooth muscle development in diverse species, although their direct regulatory role remains elusive. A transcriptional map of Biniou (a FoxF transcription factor) and Bagpipe (an Nkx factor) activity is presented as a first step to deciphering the developmental program regulating Drosophila visceral muscle development. A time course of chromatin immunoprecipitatation followed by microarray analysis (ChIP-on-chip) experiments and expression profiling of mutant embryos reveal a dynamic map of in vivo bound enhancers and direct target genes. While Biniou is broadly expressed, it regulates enhancers driving temporally and spatially restricted expression. In vivo reporter assays indicate that the timing of Biniou binding is a key trigger for the time span of enhancer activity. Although bagpipe and biniou mutants phenocopy each other, their regulatory potential is quite different. This network architecture was not apparent from genetic studies, and highlights Biniou as a universal regulator in all visceral muscle, regardless of its developmental origin or subsequent function. The regulatory connection of a number of Biniou target genes is conserved in mice, suggesting an ancient wiring of this developmental program (Jakobsen, 2007; full text of article).
The dynamic enhancer binding of Biniou suggested that the timing of Biniou occupancy is important for the timing of enhancer activity. To assess this in vivo, a number of regions from each of the three temporal clusters were linked to a GFP reporter. The timing of enhancer activity was assayed in vivo by in situ hybridization in transgenic embryos, to avoid time delays due to GFP protein folding and protein perdurance. All regions examined drive expression in a subset of Biniou-expressing cells and recapitulate all or part of the target genes' expression. This study focused on their temporal activity (Jakobsen, 2007).
The initiation of enhancer activity closely matches the first time point of Biniou binding for >90% of enhancers examined (10 of 11 CRMs). The early-bound enhancers (ttk, fd64a-e, lame duck (lmd), bap3) drive expression at stages 10-11, reflecting the binding of Biniou at these stages of development. Similarly, all four continuous-bound enhancers (HLH54F, otk, mib2, bap-FH) initiate expression at the first time period when Biniou binds. The two late-bound enhancers, in contrast, do not initiate expression at stages 10 or 11 of development, matching the lack of Biniou binding during these stages. Instead, the expression of the fd64a late enhancer initiates at stage 13, while the ken enhancer initiates VM expression at stage 14. This shift in the initiation of activity mirrors Biniou binding to these enhancers at stages 12-13 and 13-14, respectively. The only exception is the CG2330 enhancer, which initiates expression at stage 11, while Biniou enhancer binding was first detected at stage 13-14). As the expression of endogenous CG2330 does not initiate until stage 13, the apparent discrepancy in enhancer activity may simply reflect the exclusion of some regulatory motifs within the limits of the cloned region (Jakobsen, 2007).
Remarkably, the duration of enhancer activity is also tightly correlated with the time span of Biniou binding in 10 out of 11 CRMs examined. This is particularly striking in the early-bound enhancers: When Biniou ceases to bind to these CRMs (lmd, ttk, fd64a early, and bap3), their ability to regulate expression is lost. The converse is also true. Continuous Biniou binding correlates with continuous enhancer activity, specifically for bap-FH, HLH54F, and otk. The exception is the mib2 enhancer. In the context of this module Biniou binding it is not sufficient to maintain enhancer activity in the VM at late developmental time points (Jakobsen, 2007).
Taken together, these data indicate that the timing of Biniou enhancer binding is predictive for temporal enhancer activity in the large majority of cases (Jakobsen, 2007).
Multiple enhancers mediate regulated Mef2 expression during embryogenesis. Among them is the enhancer I-E, which drives Mef2 expression in fusion-competent myoblasts. The phenotype of lame duck (lmd) mutant embryos suggests that lmd may be activating Mef2 in fusion-competent myoblasts via enhancer I-E. Wild-type and lmd mutant embryos, carrying the enhancer I-E construct, were double-labeled for Mef2 and lacZ expression. In the wild-type background, lacZ expression is detected in a large number of Mef2-positive somatic myoblasts. By contrast, there is a complete absence of lacZ expression in lmd mutant background. Activation of two other somatic muscle enhancers, II-E and III-F, which drive Mef2 expression in founder cells and muscle fibers, respectively, is not affected in mutant embryos (Duan, 2001).
Functional dissection of enhancer I-E has also identified a 170 bp subfragment, I-ED5, which is still active in somatic myoblasts. Further analysis with deletion reporter gene constructs, each of which contain a small internal deletion within enhancer I-ED5, has defined the essential [C/D]* region. Notably, robust lacZ expression levels are obtained with I-ED5, while a nearly complete absence of lacZ expression is observed with I-ED5-DelD. lacZ expression is slightly reduced with the overlapping I-ED5-DelC construct. Moreover, a multimerized construct consisting of five copies of the [C/D]* region can direct lacZ expression comparably to I-ED5. Thus, the sequences within [C/D]* are both necessary and sufficient to direct expression in fusion-competent myoblasts (Duan, 2001).
To identify factors that bind specifically to [C/D]*, a yeast one-hybrid screen was indertaken, using the multimerized [C/D]* region as target. From this molecular screen, 37 His-positive/lacZ-positive cDNA fusion clones were obtained that encode proteins which bind the [C/D]* region. Twelve of the 37 clones encode truncated versions of the Lmd protein. These can be grouped into four classes based upon the position of their N-terminal end. The encoded polypeptides in all 12 clones include the Zn-finger domain. To ascertain that the Zn-finger domain is responsible for specific target recognition, constructs that encode defined portions of the protein were tested in yeast cells. Indeed, constructs that include the Zn-finger domain are capable of activating robust levels of His and lacZ expression whereas those that span the N- or C-terminal region of Lmd, flanking the Zn-finger domain, are not able to activate His expression (Duan, 2001).
Standard DNA-binding assays were performed to confirm that Lmd can bind specifically to enhancer I-ED5. In the presence of in vitro-translated Lmd protein, a slower-migrating protein-DNA complex is observed with the gamma32P-labeled I-ED5 fragment. Formation of this complex is specifically competed by an excess amount of cold I-ED5 DNA fragment but not by cold III-F7, an unrelated DNA fragment of similar length (Duan, 2001).
Sequence analysis of enhancer I-ED5 did not reveal any sequence elements that conform to the canonical binding site for Ci/Gli proteins, indicating that Lmd recognizes a novel DNA sequence motif. To attempt to define the binding site, four other mutated I-ED5 derivatives (I-ED5-mt1, I-ED5-mt2, I-ED5-mt3, I-ED5-mt4), each of which contains a 10 bp block of substitutions were tested in vivo. Normal levels of activation of reporter gene expression in somatic myoblasts are observed with I-ED5-mt3 and I-ED5-mt4. By contrast, dramatically reduced levels of reporter gene expression are observed with I-ED5-mt1 and I-ED5-mt2. These results, together with additional in vitro binding and competition data, indicate that the functional binding site of Lmd is within the sequence TTACCTACGCAGCGTTTACA (Duan, 2001).
Skeletal muscle formation in Drosophila melanogaster requires two types of myoblasts, muscle founders and fusion-competent myoblasts. Lame duck (Lmd), a member of the Gli superfamily of transcription factors, is essential for the specification and differentiation of fusion-competent myoblasts. Appropriate levels of active Lmd protein are attained by a combination of posttranscriptional mechanisms. Evidence is provided that two different regions of the Lmd protein are critical for modulating the balance between its nuclear translocation and its retention within the cytoplasm. Activation of the Lmd protein is also tempered by posttranslational modifications of the protein that do not detectably change its subcellular localization. Overexpression of Lmd protein derivatives that are constitutively nuclear or hyperactive results in severe muscle defects. These findings underscore the importance of regulated Lmd protein activity in maintaining proper activation of downstream target genes, such as Mef2, within fusion-competent myoblasts (Duan, 2006).
This study provides evidence that appropriate levels of active Lmd protein are regulated by at least two distinct mechanisms. First, Lmd activity is modulated by changes in nuclear translocation of the protein versus its retention in the cytoplasm. Indeed, protein localization studies showed that two separate regions (I and II) are critical for the cytoplasmic retention of the Lmd protein. The amino-terminal region I (~aa 1 to 141) is necessary but not sufficient, in any context, for effecting cytoplasmic retention, whereas region II (~aa 691 to 866) is necessary and sufficient when present in truncated Lmd proteins. It is noteworthy that region II is not sufficient within the context of the full-length protein (e.g., aa141-866 or aa183-866 protein) and that the inclusion of both regions in the wild-type protein does not make it exclusively cytoplasmic, thus suggesting the existence of a yet-to-be-defined regulatory component(s) that counteracts the action of the two regulatory regions. Based upon these data, it is proposed that some unknown factor binds in a signal-dependent manner to the region that spans ~aa 183 to 382 and abrogates the capability of region I and/or region II to mediate interactions (direct or indirect) with the microtubule network/cytoskeleton. Alternatively, interactions (direct or indirect) between regions I and II could be important for masking the NLS and the binding of this unknown factor may disrupt this masking. In general terms, these findings regarding the regulation of the subcellular distribution of Lmd are reminiscent of those associated with the Ci protein. For example, a recent study showed that the kinesin-like protein Costal2 (Cos2) interacts with two separate domains of Ci to inhibit its nuclear translocation . It was also reported that Cos2 relies on microtubule-dependent and microtubule-independent mechanisms to retain the Ci protein in the cytoplasm. Furthermore, it has been suggested that the formation of distinct protein complexes, consisting of Cos2, Fu, Su(fu), and Ci, is a mechanism by which Ci can be sequestered in the cytoplasm. Consequently, it will be important to characterize the components that recognize the different regulatory regions within the Lmd protein. By analogy to the Ci protein, it will also be interesting to determine whether there could exist in vivo distinct Lmd protein-containing complexes (Duan, 2006).
Understanding how complex patterns of temporal and spatial expression are regulated is central to deciphering genetic programs that drive development. Gene expression is initiated through the action of transcription factors and their cofactors converging on enhancer elements leading to a defined activity. Specific constellations of combinatorial occupancy are therefore often conceptualized as rigid binding codes that give rise to a common output of spatio-temporal expression. This study assessed this assumption using the regulatory input of two essential transcription factors within the Drosophila myogenic network. Mutations in either Myocyte enhancing factor 2 (Mef2) or the zinc-finger transcription factor Lame duck (Lmd) lead to very similar defects in myoblast fusion, yet the underlying molecular mechanism for this shared phenotype is not understood. Using a combination of ChIP-on-chip analysis and expression profiling of loss-of-function mutants, a global view was obtained of the regulatory input of both factors during development. The majority of Lmd-bound enhancers are co-bound by Mef2, representing a subset of Mef2's transcriptional input during these stages of development. Systematic analyses of the regulatory contribution of both factors demonstrate diverse regulatory roles, despite their co-occupancy of shared enhancer elements. These results indicate that Lmd is a tissue-specific modulator of Mef2 activity, acting as both a transcriptional activator and repressor, which has important implications for myogenesis. More generally, this study demonstrates considerable flexibility in the regulatory output of two factors, leading to additive, cooperative, and repressive modes of co-regulation (Cunha, 2010).
Genes that are co-regulated by the same two (or more) transcription factors are generally expected to have very similar spatio-temporal expression profiles. In fact, this assumption has been used by many studies to computationally predict the location of enhancer elements by searching for common TF binding motifs in the vicinity of clusters of co-expressed genes (or synexpression groups). It was therefore surprising when a comparison of experimentally-identified enhancer regions bound by the same two transcription factors uncovered a diverse range of regulatory responses. The 59 genes with enhancer elements co-bound by Lmd and Mef2 at the same stages of development are regulated either in a cooperative, additive or repressive manner depending on the individual enhancers. These data suggest that enhancer regions integrate regulatory inputs more flexibly than previously anticipated. By focusing on individual enhancer elements, how Lmd and Mef2 influence regulatory activity in different contexts was evaluated both in vivo and in vitro. Combining a number of complementary approaches allowed identification of three different modes of TF integration at developmental enhancers leading to additive, cooperative or repressive regulation (Cunha, 2010).
Mef2 and Lmd provide an additive positive input to the regulation of the Act57B locus. Ectopic Mef2 expression in the ectoderm is sufficient to induce Act57B expression, while providing Lmd alone is not. Conversely, enhancer-reporter gene expression is completely lost in lmd mutant embryos and only slightly reduced in Mef2 loss-of-function mutant embryos. Together, these data reveal a role for both transcription factors at this enhancer. Previous studies demonstrated that the initiation of Act57B expression at stage 11 requires Mef2 for its activation. Yet, artificially increasing Mef2 levels at this stage does not lead to premature activation of this locus. The current findings offer an explanation for this result: at this stage of development, combined input from Lmd and Mef2 is required to drive gene expression, while the presence of Mef2 alone is not sufficient to activate transcription. At later stages, when lmd expression is lost, Mef2 concentration has increased sufficiently to maintain Act57B expression. Conversely, the CG14687 locus can be activated by ectopic Lmd in the ectoderm, but not by Mef2 alone and requires lmd, but not Mef2, for its expression in the somatic muscle. Combined ectopic expression of the two TFs, in contrast, leads to a marked increase of reporter signal, again indicating combinatorial positive regulation by both TFs. These findings are supported by the ability of both Lmd and Mef2 to separately activate reporter gene expression in vitro and to yield additive reporter activity in combination (Cunha, 2010).
The blow enhancer shows a different mode of regulation and is synergistically activated by both factors. While neither Mef2 nor Lmd alone are sufficient to activate ectopic gene expression in vivo, supplying both factors simultaneously leads to robust target gene expression. Assaying for reporter gene activation in the two mutant backgrounds yields a complementary result; Mef2 and Lmd activity is required to activate transcription in the somatic mesoderm via the blow enhancer. Moreover, the in vitro reporter assay reveals a positive interaction between the two proteins, indicating that the blow enhancer functions as a cooperative switch (Cunha, 2010).
Analysis of the CG9416 enhancer revealed an antagonistic interaction between Lmd and Mef2. While ectopic expression of Mef2 leads to enhancer activation, simultaneous expression of Lmd markedly attenuates the transcriptional output from this locus. This effect can be reproduced in vitro: while providing Mef2 alone leads to robust activation of the CG9416 enhancer, Lmd is not able to activate gene expression. Instead, Lmd antagonizes the activating input of Mef2 in a concentration-dependent manner. This is the first example of direct negative regulation by Lmd. To identify additional examples of a repressive role for Lmd, the expression profiles of lmd and Mef2 mutant embryos was re-examined. CG9416 is markedly upregulated in lmd mutants, but shows reduced expression in embryos lacking Mef2. Another direct target gene with similar expression changes was selected in these genetic backgrounds, CG30035, and after determining the limits of the ChIP-enriched region its ability to drive reporter gene expression in vitro was assayed. Similar to the CG9416 enhancer, the CG30035 enhancer is robustly activated by Mef2, and this activation is inhibited by Lmd in a dose-dependent manner. This provides a second, independent example for Lmd-mediated repression of gene expression (Cunha, 2010).
In summary, starting from a genomic perspective, a large cohort of genes co-regulated by a pair of tissue-specific transcription factors was identified. Lmd modulates the activity of Mef2 at different enhancers in a context-dependent fashion, allowing for additive, cooperative or antagonistic interactions in the same cells. In this way, the timing and expression levels of Mef2 target genes can be further refined, as exemplified by the Act57B locus, which may owe its early activation during embryonic development to the combined activity of both proteins. Lmd shows homology with the Gli superfamily of transcription factors, which can act both as transcriptional activators and repressors, depending on proteolytic cleavage regulated by the hedgehog signaling pathway. To date, there is no evidence for proteolytic cleavage of Lmd and an irreversible conversion of Lmd from a transcriptional activator to an inhibitor is difficult to reconcile with the observation that Lmd can perform both roles at different loci at the same time, in the same tissue. For the same reason, it is also considered unlikely that Lmd interferes with transcriptional activation simply by binding to Mef2 and sequestering the protein in the cytoplasm. Instead, it is proposed that Lmd exerts a dominant inhibitory influence over a transcriptional activator, either by locally quenching Mef2's activity or through direct repression of the locus, similar to transcriptional repressors described in other developmental networks. These results provide a molecular understanding for the genetic observation that restoring Mef2 activity in lmd mutant embryos is not sufficient to rescue muscle differentiation. Both transcription factors are required to provide different regulatory inputs to a large number of co-regulated target genes during myogenesis. Their associated enhancers have revealed considerable flexibility in integrating regulatory inputs from these two TFs at individual cis-regulatory regions (Cunha, 2010).
To assess lmd expression during embryogenesis, embryos were hybridized with a digoxigenin-labeled lmd probe. lmd RNA transcripts are first detectable at late stage 11 in repeating patches of visceral mesoderm, corresponding to Bap-positive cells. Prominent expression is then observed in somatic and visceral mesodermal cells throughout stage 12. During stage 13, lower levels of lmd expression persist in repeating groups of somatic mesodermal cells, whereas expression in the visceral mesoderm is no longer detectable. lmd expression is abolished in somatic mesodermal cells before cell fusion and is never detectable in muscle fibers. Its expression is also never detected in heart progenitors. The Lmd protein expression pattern, obtained with an antibody against the N-terminal portion of the protein, is identical to its RNA profile (Duan, 2001).
Confocal microscopy was used to determine precisely the cell type within the somatic mesoderm in which Lmd is expressed. Embryos derived from the rP298-lacZ line were triple-stained with antibodies against Lmd, Mef2 and ß-gal. rP298 drives lacZ expression in all founder cells. There is extensive co-expression of Lmd and Mef2, but only within lacZ-negative fusion-competent myoblasts, whereas Mef2-positive/lacZ-positive founder cells are Lmd negative or express Lmd at extremely low levels. These results indicate that Lmd is expressed highly in fusion-competent myoblasts and at barely detectable, or undetectable, levels in founder cells (Duan, 2001).
Given that Lmd is a Gli-related protein, a detailed examination was made of the subcellular distribution of Lmd protein expression. Wild-type late stage 12 embryos were triple-stained with antibodies against Lmd, Mef2 and nuclear lamin. Lmd expression is detected in both the nucleus and cytoplasm of a large number of myoblasts whereas Mef2 expression is restricted to the nucleus of these same cells. However, the majority of these myoblasts appear to have elevated levels of Lmd in their nuclei when compared with their cytoplasm. Interestingly, exclusively cytoplasmic Lmd expression is observed in some myoblasts and these do not express Mef2. An apparent absence of Lmd expression is also seen in some Mef2-positive myoblasts which are presumably founder cells. Furthermore, myoblasts from each of these different categories are found in stereotyped positions within each segment, suggesting that both the intracellular localization and expression of Lmd may correlate the distinct specification and differentiation state of a particular cell. Taken together, the subcellular localization data and results from a parallel study indicate that Mef2 activation in fusion-competent myoblasts requires nuclear-localized Lmd (Duan, 2001).
lame duck, termed myoblasts incompetent (minc) in this study, is essential for normal myogenesis and myoblast fusion in Drosophila. myoblasts incompetent is expressed in immature somatic and visceral myoblasts.
Expression is predominantly in fusion-competent myoblasts and a loss-of-function mutation in myoblasts incompetent
leads to a failure in the normal differentiation of these cells and a complete lack of myoblast fusion. In the mutant
embryos, founder myoblasts differentiate normally and form mononucleate muscles, but genes that are specifically expressed in fusion-competent
cells are not activated and the normal downregulation of twist expression in these cells fails to occur. In addition, fusion-competent myoblasts fail to express proteins characteristic of the general pathway of myogenesis such as myosin and Dmef2. Thus myoblasts incompetent appears to function specifically in the general pathway of myogenesis to control the differentiation of fusion-competent myoblasts (Ruiz-Gomez, 2002).
In minc[A388] mutants there is a complete lack of myoblast fusion and all muscles are mononucleated. To show whether founder cells are specified normally in the mutant embryos, antibodies to a variety of transcription factors (e.g. Kr) were used: these are expressed by subsets of founder myoblasts in normal embryos. In all cases, these expression patterns in founder cells were normal. To characterize the phenotype in more detail, anti-myosin antibody was used to visualize the process of myogenesis in wild-type and mutant embryos. Myosin staining shows that some mesodermal derivatives, including the heart, develop normally, but that multinucleate somatic muscles fail to form. Fusion also fails to occur in the muscles of the pharynx. Founder myoblasts appear to differentiate normally, developing at appropriate positions, expressing myosin, elongating and attaching to the epidermis at their correct insertion sites. However, with myosin staining, fusion-competent myoblasts could not be detected at any stage and this is in striking contrast to other non fusion mutants in which unfused myoblasts express myosin at high levels (Ruiz-Gomez, 2002).
The failure to detect fusion-competent myoblasts with myosin staining in the mutant embryos could reflect either the complete absence of these cells or, alternatively, it could be that the cells are present but have failed to differentiate. Because founder cells form normally in minc embryos, it is assumed that the segregation process that leads to the separation of a population of founders and fusion-competent cells has probably taken place in these embryos. Thus it seemed likely that the fusion-competent cells would be present but in some undifferentiated state. To explore this possibility further, an antibody to Dmef2, a gene that is expressed and required for normal differentiation in all myogenic cells, was used. Staining with this antibody has revealed once again a normal pattern of founder cells, but an absence of expression in fusion-competent cells. This again is in marked contrast to other non-fusion mutants such as myoblast city (mbc) (Ruiz-Gomez, 2002).
Because staining with an antibody to Dmef2 did not resolve the issue of the fate of the fusion-competent cells in mutant embryos, an antibody to twist, which is a general marker for early undifferentiated mesodermal cells, was used. In normal embryos, twist expression is lost from fusion-competent myoblasts during stages 11 and 12. In the mutant embryos, there is a striking persistence of twist expression in a population of cells whose arrangement is similar to the normal distribution of fusion-competent cells. However there are fewer such twist-expressing cells in a minc mutant embryo than those detected by Dmef2 expression in a non fusion mutant such as mbc. Interestingly therefore, it appears that in minc mutant embryos, twist expression persists in only a subset of the putative fusion-competent myoblasts. This expression is maintained throughout the normal period when fusion would be expected to occur. Thus, while wild-type embryo founder cells are surrounded by fusion-competent myoblasts, with which they fuse, in minc embryos, normally differentiating founder cells are surrounded by an abnormal population of apparently undifferentiated mesodermal cells expressing twist (Ruiz-Gomez, 2002).
To examine the extent to which these twist-expressing cells have been specified, the expression of two further genes, hairy (h) and sticks and stones (sns), whose products are characteristic of fusion-competent cells in the mesoderm of normal embryos, were examined. sns, in particular, is an early marker for this population and a critical determinant of the function of these cells in fusion. In both cases, no expression was detected in the putative fusion-competent cells surrounding the founder myoblasts in mutant embryos. sns is also expressed in a second population of fusion-competent cells, that will later contribute to the visceral muscles of the midgut. However, these cells do not lose sns expression in minc mutant embryos. Nonetheless, minc mutant embryos fail to form syncytial visceral muscles (Ruiz-Gomez, 2002).
It seems, therefore, that the process of segregation that generates two populations of somatic myoblasts, founders and fusion-competent cells, in normal embryos, occurs in the mutant, but while founders develop normally, there is a complete failure of the fusion-competent cells to differentiate. The putative fusion-competent cells remain as an undifferentiated population that continues to express twist and does not express any of the normal markers for the differentiation of this class of myoblasts. It appears that in minc embryos an essential step in the specification of fusion-competent cells has failed to occur, and that these cells therefore fail to differentiate (Ruiz-Gomez, 2002).
The earliest expression of minc is in cells of the visceral mesoderm -- initially at stage 10 in a small patch of cells at the posterior tip of the embryo, that probably corresponds to the primordium of the caudal visceral mesoderm and then in segmentally repeated clusters of cells that correspond to the bagpipe (bap)-expressing progenitors of the trunk visceral mesoderm. These patches are joined ventrally by expression in the mesodermal cross bridges. Expression in the visceral mesoderm includes both founders and fusion-competent myoblasts. By stage 11, expression starts in cells of the somatic mesoderm and begins to decline in cells of the visceral mesoderm. Expression is predominantly in cells that do not express the rP298 marker for founder cells. There is probably residual expression of minc in rP298-expressing cells but it is clearly at a lower level than in the adjacent cells with which they will fuse. There is strong expression in the somatic mesoderm until stage 13. Expression begins to decline in stage 14 and, apart from residual expression in a few cells, has disappeared by late stage 15. At this stage, however, minc is detectable in mesodermal cells of the gonad (Ruiz-Gomez, 2002).
Mutations in twist, which eliminate all mesodermal derivatives also completely lack expression of minc, thereby confirming its exclusively mesodermal pattern of expression. Previous work has shown that founder cells segregate from the somatic mesoderm by a process of lateral inhibition that is mediated by the neurogenic genes and the activation of the Notch signaling pathway in neighboring cells, which are thereby prevented from becoming founders themselves. In Notch mutant embryos, there is an overproduction of founder cells at the expense of other adjacent cells. It seems likely that the cells that are inhibited from becoming founders are the cells that will enter the other myoblast class, namely the fusion-competent cells. This view is reinforced by the finding that sns expression, which is characteristic of these cells, is reduced in Notch mutant embryos. If this is so, and if minc is involved in the specification of fusion-competent cells, then it would be expected that its expression too would be reduced in neurogenic mutant embryos. Accordingly, the expression of minc was examined in mutants for Notch and Delta. In both cases there is a striking reduction in the expression of minc. There is some persistent minc expression in these embryos which is likely to be in cells of the visceral mesoderm (Ruiz-Gomez, 2002).
This study showS that cell fate decisions in the dorsal and lateral mesoderm of Drosophila depend on the antagonistic action of the Gli-like transcription factor Lame duck (Lmd) and the zinc finger homeodomain factor Zfh1. Lmd expression leads to the reduction of Zfh1 positive cell types, thereby restricting the number of Odd-skipped (Odd) positive and Tinman (Tin) positive pericardial cells in the dorsal mesoderm. In more lateral regions, ectopic activation of Zfh1 or loss of Lmd leads to an excess of adult muscle precursor (AMP) like cells. It was also observed that Lmd is co-expressed with Tin in the early dorsal mesoderm and leads to a reduction of Tin expression in cells destined to become dorsal fusion competent myoblasts (FCMs). In the absence of Lmd function, these cells remain Tin positive and develop as Tin positive pericardial cells although they do not express Zfh1. Further, it was shown that Tin repression and pericardial restriction in the dorsal mesoderm facilitated by Lmd is instructed by a late Decapentaplegic (Dpp) signal that is abolished in embryos carrying the disk region mutation dppd6 (Sellin, 2009).
Loss of Lame duck (Lmd) leads to an increase of pericardial cells and adult muscle precursor like cells: In embryos lacking Lmd function, staining for zinc finger homeodomain factor 1 (Zfh1) expression reveals a pericardial hyperplasia phenotype and a general excess of Zfh1 positive mesodermal cells. In wild type embryos, three types of pericardial cells (PCs) have been described: Tin positive (TPCs), Odd positive (OPCs) and Eve positive (EPCs) pericardial cells, all of which express Zfh1 and the handC- GFP reporter. Closer inspection of the pericardial cells in lmd mutant embryos revealed that the number of TPCs and OPCs is dramatically increased, while the number of EPCs is normal. All OPCs co-express the handC- GFP reporter and Zfh1 in wild type and lmd mutant embryos. In contrast, a considerable number of ectopic Tin positive cells, though positive for handC- GFP, do not express Zfh1 in lmd mutant embryos. The absence of β3Tubulin expression in these cells is consistent with earlier reports in which a normal set of cardioblasts was described in lmd mutant embryos. To decide whether the Zfh1 negative/Tin positive cells are atypical pericardial cells or dorsal mesodermal cells that fail to differentiate, a triple staining waa conducted for Tin, Zfh1 and Pericardin (Prc), a collagen that is secreted by differentiated pericardial cells. Prc protein was observed surrounding all Tin positive/Zfh1 negative cells, suggesting that they are ectopic pericardial cells. However, due to the fact that Prc is a secreted protein the possibility cannot be ruled out that there might be occasional Tin positive/Zfh1 negative cells in lmd mutant embryos which do not express Prc themselves, but remain in an uncommitted, dorsal mesodermal state (Sellin, 2009).
For further analysis of the ectopic pericardial cells, the number of OPCs in stage 16-17 embryos was counted. An average of 206.3 OPCs was observed in lmd mutant embryos as compared to 97.8 in wild type embryos, thereby representing a ~2-fold increase. It has been reported that the Odd subgroup of pericardial cells (OPCs) originates from two different lineages: a symmetric lineage (two OPCs from one precursor) and an asymmetric lineage (two OPCs from two precursors), adding up to a total of four OPCs per hemisegment. Of note, the siblings of the asymmetrically derived OPCs, the Seven-up (Svp) positive cardioblasts, are normal in lmd mutants, thus suggesting that the asymmetrically derived OPCs do not contribute to the lmd phenotype. Since the two different types of OPCs can not be distinguished directly because the anti-Svp antibody stains the precursor cells and the cardioblast siblings, but not the final PCs at later stages, their abundance was measured in lmd mutants indirectly. The fact was utilized that in inscutable (insc) mutants, asymmetric cell division fails, and all siblings of the asymmetric OPC lineage become Svp positive cardioblasts. The difference in OPC number between insc; lmd and lmd mutant embryos therefore corresponds to the number of asymmetrically derived OPCs in lmd mutant embryos. A loss of ~45 OPCs was observed in insc; lmd double mutant embryos as compared to lmd mutant embryos. This number is reasonably close to the number of ~38 OPCs that are lost in insc mutant embryos when compared to wild type embryos. In addition, the number of Svp positive precursors, which give rise to the asymmetric Odd lineage, is normal in lmd mutant embryos at early stage 13. Altogether, these data strongly support the initial hypothesis that there is the normal amount of asymmetrically derived OPCs in lmd mutant embryos and the phenotype is not caused by a failure of asymmetric cell division (Sellin, 2009).
An excess of Zfh1 positive cells was also observed in the lateral mesoderm of lmd mutant embryos, where it is normally expressed in the adult muscle precursor cells (AMPs). These imaginal myogenic cells retain Twist (Twi) expression, but do not express any other myogenic genes in the embryo. Instead, they are maintained in a less differentiated state during embryogenesis and are dormant until metamorphosis, when they start to differentiate and give rise to the adult musculature of the fly. In the embryo, they are arranged as groups of cells in the thoracic segments, while six solitary cells (one dorsal, two dorsolateral, two lateral and one ventral) are present in the abdominal hemisegments. It was reported earlier that too many Twi positive cells persist in the lateral mesoderm of lmd mutant embryos. Together with the fact that both Zfh1 and Twi are present in AMPs in the wild type, it appeared likely that both factors are also co-localized in embryos mutant for lmd. Indeed, double staining for Zfh1 and Twi showed a complete overlap in the lateral mesoderm and confirmed that both populations of ectopic cells are identical. They also express the gene holes in muscles (him) which is another marker specific for AMPs. For further characterization, the expression patterns were analyzed of several myogenic markers in lmd mutant embryos. No expression was detected of the muscle specific genes myocyte enhancing factor 2 (Mef2), β3 Tubulin or the reporter rP298 (Duf-lacZ) in Twi/Zfh1/Him positive cells (Sellin, 2009).
Twist expression is normally present during early stages of somatic muscle development in myoblasts that are not yet differentiated. Zfh1, which has been implicated in the repression of mef2, might help in keeping AMPs in the undifferentiated state until metamorphosis. The gene him, which is also expressed in AMPs, was recently reported to be involved in maintaining cells in an undifferentiated state by inhibiting the myogenic signal provided by Mef2 function. Consequently, the ectopic Zfh1/Twist/Him positive cells in the lmd mutant embryos are likely to be cells with myogenic potential, as are the endogenous AMPs, and hence can be considered to be ectopic AMP like cells. To assess if enhanced proliferation is also involved in generating an increased amount of cells in lmd mutant embryos, staining was oerfirned for phosphorylated Histone 3 (pH3), which specifically marks dividing cells. Over-proliferation in the dorsal and lateral mesoderm was not observed in lmd mutant embryos when compared to wild type embryos. Although there is a considerable number of the additional, AMP like cells that persist until the end of embryogenesis, their number is reduced between stage 13 and 16/17. Staining with Nile Blue A revealed a general excess of dying cells during these stages in lmd mutant embryos as compared to wild type, suggesting that not all ectopic cells survive until the end of embryogenesis (Sellin, 2009).
The supernumerary PCs and AMPs originate from the population of fusion competent myoblasts: While no general myogenic genes are expressed in the ectopic AMP like cells, it was however possible to show co-localization of Zfh1 and lmd mRNA in the somatic mesoderm of lmd mutant embryos, which is not observed in wild type embryos. In the wild type, lmd is expressed in fusion competent myoblasts (FCMs), which fail to differentiate in the absence of Lmd function. lmd mRNA is transcribed in a normal pattern in lmd mutant embryos. In situ hybridization with a lmd specific riboprobe therefore allowed visualization of the population of cells destined to become FCMs, although they do not express any other FCM specific genes in lmd mutant embryos. Since the ectopic Zfh1 positive cells co-express lmd mRNA, it is concluded that the ectopic AMP like cells in lmd mutant embryos originate from the FCM population and adopt AMP like characteristics instead. They are therefore generated by cell fate conversions, which is consistent with the observation that there are no additional cell divisions in lmd mutant embryos (Sellin, 2009).
In the dorsal mesoderm of lmd mutant embryos, the additional Zfh1 positive cells express Tin or Odd and Prc, indicating differentiation as pericardial cells. Pericardial cells usually develop from the dorsal cardiac mesoderm specified by Tin expression, while the somatic musculature is situated more laterally and is characterized by prolonged Twi expression. To address the question of whether a conversion of FCMs into PCs could also account for the pericardial hyperplasia phenotype in lmd mutant embryos in an analogous fashion to the ectopic AMP like cells, staining was carried out for Tin and lmd mRNA. It was reasoned that the ectopic Tin cells should also express lmd mRNA if they originate from the pool of mis-specified FCMs. Indeed, there is co-expression of lmd mRNA and Tin in ectopic pericardial cells in stage 13 lmd mutant embryos, indicating that cell fate conversions from FCM to ectopic PC fate are responsible for the observed pericardial hyperplasia phenotype (Sellin, 2009).
Of note, there is a distinct overlap of lmd mRNA and Tin expression in the dorsal mesoderm of stage 12 embryos, both in wild type and lmd mutant background. This observation is consistent with the observed cell fate switch from FCM to PC fate and indicates that in wild type embryos, dorsal FCMs are specified in the dorsal, Tin positive mesoderm rather than the Twi positive somatic mesoderm. Indeed, dorsal muscle phenotypes can be observed in embryos mutant for tin, consistent with the conclusion that dorsal muscle cell types (i.e., FCMs) develop from the early dorsal mesoderm specified by Tin expression: If this domain is not specified, it can not generate dorsal FCMs (or other dorsal mesodermal derivatives, like heart or visceral mesoderm) (Sellin, 2009).
Co-expression of Tin and lmd mRNA is no longer detectable after germ band retraction (stage 13) in wild type embryos, but persists in lmd mutant embryos until the lmd mRNA signal fades (at about stage 14-15). Thus, it seems that repression of Tin in the dorsal mesoderm depends on the presence of Lmd protein. To substantiate this observation, Lmd was overexpressed in the whole mesoderm with the twi-Gal4 driver to assess its influence on Tin expression. Indeed, a reduction was observed of Tin expression in stage 12 embryos overexpressing Lmd compared to wild type, further confirming a negative influence of Lmd on Tin expression in the dorsal mesoderm. At later stages, the number of TPCs (and OPCs) remains reduced, while the cardioblasts are not affected. A model is therefore proposed in which the initial dorsal mesoderm specified by Tin expression is subdivided by Lmd into cardiac mesoderm and dorsal musculature by repression of Tin in lateral regions and induction of a myogenic differentiation program instead. During this process, Tin expression is maintained only in the cells that are destined to become pericardial cells (or cardioblasts), while Tin is repressed by Lmd in the dorsally localized FCMs. Loss of Lmd function consistently leads to an increased amount of Tin positive cells in the dorsal mesoderm from stage 13 onwards, which then can differentiate as ectopic pericardial cells as indicated by the expression of Prc. Taken altogether, these data suggest that, in the absence of Lmd function, the pool of unspecified FCMs can develop as ectopic PCs in the Tin-positive dorsal mesoderm and as AMP-like cells in the lateral and ventral mesoderm. However, increased cell death, and the possibility that a small number of ectopic Tin positive cells might exist without Prc/Zfh1 expression as mentioned earlier, suggest the possibility that not all cells of the FCM population follow alternative cell fates. Instead, some cells might remain in an uncommitted mesodermal state in lmd mutant embryos (Sellin, 2009).
Normally, instructive Dpp signals from the ectoderm are responsible for the specification of cardiac cell types by maintaining Tin expression solely in the dorsal mesoderm, while Twist activity in the lateral and ventral mesoderm leads to the development of the somatic musculature. To test if reduced Dpp signaling has a similar effect on PC number as overexpression of Lmd, by reducing the size of the Tin domain, embryos carrying the mutation mad1-2 were examined. mad1-2 is a weak hypomorphic allele of the Dpp effector Mad and causes larval lethality, thereby allowing observation of late stages of embryogenesis. Indeed, a decreased number of OPCs and TPCs was observed in mad1-2 mutant embryos, without any effect on cardioblast number, as is the case when overexpressing Lmd. Of note, the number of OPCs is decreased to a similar extent in mad1-2; lmd double, as compared to lmd single mutant embryos. Therefore, it is concluded that in the presence of the hypomorphic mad1-2 mutation, the dorsal mesoderm that is specified by Dpp-dependent Tin expression is reduced, resulting in a reduction of PCs in a Lmd independent manner. However, Lmd further restricts the number of PCs in the mad1-2 mutant background, as revealed by an increased number of PCs and the presence of TPCs without Zfh1 expression in mad1-2; lmd double mutants when compared to mad1-2 single mutants (Sellin, 2009).
Pericardial cells share their developmental origin with the myogenic cardioblasts in a similar fashion as AMPs with founder cells in the somatic musculature. During lateral inhibition, Notch activation promotes myogenic FCM fate as opposed to the progenitors of founder cells in the lateral mesoderm or cardiogenic progenitors in the dorsal mesoderm. Subsequently, during the process of asymmetric cell division, Notch activation renders the daughter cell always non-myogenic (PC or AMP fate). Although the AMPs have the potential to develop into muscle cells during metamorphosis, they are considered non-myogenic in this context because they do not yet express any myogenic genes, such as mef2, lmd or muscle structural genes in the embryo. In the case of pericardial cells, there is surprisingly little data available about their physiological role. While it is known that the OPCs contribute to the population of nephrocytes in postembryonic stages, TPCs and EPCs are not correlated with any function at all, and their developmental fate after embryogenesis is still unknown. A recent study described the development of adult muscular structures, the so called wing hearts, from a specialized subset of EPCs. This is the first hint that some pericardial cells might be considered as imaginal myogenic cells in an analogous fashion to AMPs, and it highlights the necessity to further characterize pericardial cells (Sellin, 2009).
It is currently known that PCs and AMPs have in common a dependency on active Notch signaling although they stem from different cell lineages and mesodermal primordia (Tin vs. Twi domain). FCMs, which adopt AMP or PC like characteristics in lmd mutant embryos, also need active Notch signaling. In fact, Lmd is a downstream target of N signaling and induces the FCM differentiation program. The observed lmd phenotype could be explained if, in the absence of Lmd, Notch activity always promoted AMP or PC (non-myogenic) fate, but not FCM fate, independently of the original pathway that is involved (lateral inhibition or asymmetric cell division). To assess this hypothesis, double mutants for lmd and genes involved in the Notch pathway were established. For this analysis kuzbanian and mastermind alleles were chosen because loss of either gene causes lethality only late in embryogenesis due to a maternal component, thereby allowing the analysis of later events in heart and muscle development. Both genes have also been well studied with respect to their molecular function and developmental implications. Kuzbanian (Kuz) is an ADAM metalloprotease that is known to process the Notch receptor following ligand binding. Zygotic loss of function mutations lead to defects in both lateral inhibition and asymmetric cell division in heart and muscle development, although the phenotype is far weaker than in embryos carrying N loss of function alleles. mastermind (mam) is involved in transducing the Notch signal and displays a stronger heart phenotype than kuz and a mild Notch-like muscle phenotype. Staining was perfomed for expression of Krüppel (Kr) and him mRNA, which are specific for a subset of muscle founders and AMPs/ PCs, respectively, and an increase of Notch negative cell types, corresponding to founders, was observed in the somatic mesoderm of kuz mutant embryos. This is accompanied by a reduction of AMPs, confirming the expected function of Kuz in facilitating N function in muscle cell differentiation. Furthermore, the number of FCMs as marked by Lmd expression is strongly reduced in kuz mutants, although the effect is not as complete as in N loss of function alleles (Sellin, 2009).
In kuz; lmd double mutant embryos, the increase of AMPs is milder than in lmd mutant embryos, which is consistent with a failure in lateral inhibition and a concomitant reduction of FCMs that are available for conversion to AMPs. The number of Kr-positive founder cells is increased to comparable levels in kuz and kuz; lmd mutant embryos, suggesting that Notch inactive cell fates (muscle founders and cardioblasts) are not influenced by the absence of Lmd, and that Notch acts as a permissive signal to allow the cell fate switch in lmd mutant embryos. mam; lmd double mutant embryos display a similar phenotype. Altogether, these findings suggest that in the double mutants, a general reduction of cell types with Notch activity (i.e. FCMs) occurs, followed by the conversion of the remaining potential FCMs to AMP or PC fate under the influence of N signaling in the absence of Lmd. Lame duck is present in stages 12-14, which is later than the period during which Notch activity is involved in facilitating cell fate decisions within the musculature. Hence, it appears that Notch can promote AMP or PC fate at a relatively late time point in the absence of Lmd (Sellin, 2009).
It was of interest to know if the endogenous set of AMPs, which develop through asymmetric cell divisions of muscle progenitors, is specified correctly in lmd mutant embryos. For example, the lateral AMPs are the siblings of the segment border muscle founder (SBM), and share with the latter the expression of the identity factor Ladybird early (Lbe). To discern ectopic cells and endogenous AMPs in lmd mutant embryos, co-staining was performed for Lbe and Twi expression. Indeed, the normal number of lateral AMPs, as marked by Lbe expression, is present in lmd mutant embryos, while far too many Twi-positive cells was observed in general. The latter are the ectopic AMP like cells that are presumed to be recruited from the FCM population. This observation further confirms that individual mesodermal lineages, such as the asymmetrically derived OPCs or individual AMPs, are not influenced by the loss of Lmd function (Sellin, 2009).
The proposed model of cell fate switches from myogenic FCM fate to non-myogenic AMP like or PC fate, but not myogenic fates (cardioblasts or founder cells), is consistent with the observation that Notch signaling is often employed to delay or inhibit the differentiation of stem cells or progenitor cells, especially in myogenesis. In vertebrates, Notch signaling prevents satellite cells (muscle stem cells) from entering a myogenic differentiation program in cell culture as well as in vivo, and impaired upregulation of its ligand Delta-like 1 in satellite cells has been correlated with a decreased capacity of aging muscle tissue to regenerate. While the data are consistent with the general function of Notch in preventing cells to enter the myogenic differentiation program by promoting the AMP or PC fate, they also highlight the special and unusual properties of Lmd - as a target of Notch signaling - in Drosophila muscle development. Although it is activated by Notch, it has the ability to induce myogenic differentiation. The data strongly suggest that the AMP or PC fate is the default consequence of Notch signaling in Drosophila myogenesis and that Lmd function overrules this signal to induce the FCM differentiation program in lateral or dorsal competence domains. It was shown that N has a biphasic function in heart differentiation analogous to the situation in the somatic mesoderm. At an early phase, N activity restricts the number of the sum of CBs and PCs, reflecting a function in the definition of early cardiac progenitors, likely by lateral inhibition. Subsequently, N activity is needed to promote pericardial cell fates in asymmetric cell division of the early progenitors. Although the last division step is in many cases a symmetric division seem to indicate that the majority of cardiac cell types is generated by asymmetric cell divisions segregating cardiac and pericardial fates. This might occur in some cases at one of the earlier division steps of the progenitor(s). Since these data indicate the generation of FCMs from the dorsal mesoderm, as reflected by co-expression of Tin and Lmd in stage 12 embyos, it might be suggested that dorsal FCMs originate from dorsal competence domains which also give rise to the above mentioned cardiac progenitors. These progenitors divide asymmetrically to generate CBs and PCs analogous to FC/AMP sibling pairs from more lateral competence fields, while it ia proposes that all or some of the remaining cells of the competence domains begin to express Lmd and generate FCMs under instructive influence of N signaling. In the absence of Lmd function (either in wild type in the N active daughter cells of the progenitors, or in lmd mutant embryos in all N active cells of the competence domains), the N signal promotes non-myogenic cell fates according to the mesodermal context (i.e., dorsal vs. lateral mesoderm). This would then result in the differentiation of the non-segregating population (normally developing as FCMs) as PCs in the Tin domain and AMPs in the somatic mesoderm (Sellin, 2009).
Lame duck and Zfh1 act antagonistically in mesodermal cell fate decisions: While loss of Lmd function results in an increased number of Zfh1-positive cell types, overexpression of Lmd leads to the opposite phenotype. The pan-mesodermally active twi-Gal4 driver line was used to induce Lmd expression in the whole mesoderm, and a reduction of OPCs, TPCs and AMPs was observed. To assess whether pericardial cell reduction might be a secondary effect of the early Tin repression caused by ectopic Lmd activity, the later and cardiac specific handCA-Gal4 driver, which is active in the heart from stage 12 onwards, was used. At this time point, the OPC precursors are already specified and are no longer expressing Tin. Since hand>Lmd overexpression severely reduces the number of all pericardial cells, it is concluded that their reduction is not only a secondary effect of the narrower Tin domain in embryos overexpressing Lmd. To further confirm this conclusion, the phenotype of zfh1 mutant embryos was compared with that of embryos overexpressing Lmd. The number of OPCs and TPCs is also reduced in zfh1 mutant embryos quite similarly to embryos overexpressing Lmd, although the early Tin expression pattern is normal in the absence of Zfh1 function. It is therefore unlikely that Lmd acts negatively on Zfh1 expression only by reducing Tin expression, but rather also independently of Tin function (Sellin, 2009).
There are however important differences in the phenotypes of twi > Lmd and zfh1 mutant embryos. Zfh1 appears to be involved in maintaining, but not in specification of OPCs, because it has been observed that loss of Zfh1 does not affect the number of OPC precursors at stage 13, but rather leads to a decrease of OPCs at later stages. This is in contrast to a reduced number of OPC precursors in stage 13 embryos overexpressing Lmd. Therefore, Zfh1 repression alone can not account for the loss of PCs in embryos ectopically expressing Lmd. Instead, it might be that the reduction of the dorsal Tin domain by ectopic Lmd expression results in the specification of fewer OPC precursor cells, followed by further reduction of the remaining OPCs by the negative effect of ectopic Lmd on Zfh1 expression. Consistently, a much stronger reduction of OPCs was observed after ectopic expression of Lmd as compared to the loss of OPCs in zfh1 mutant embryos. The observation that loss of Lmd function leads to the appearance of TPCs that do not express Zfh1, but Prc as a marker of pericardial differentiation, is another hint that both effects occur independently of each other and that pericardial differentiation can be accomplished in the absence of Zfh1 in lmd mutant embryos (Sellin, 2009).
Taken altogether, it does not seem likely that Tin and Zfh1 act in an epistatic hierarchy in dorsal mesodermal cell fate decisions. Instead, the data support the conclusion that Lmd regulates OPC and TPC number by two independent mechanisms: (1) Initially, Lmd restricts the cardiac field in general through repression of Tin, which leads to the reduction of early OPC precursors and the elimination of Tin expression in cells that do not express Zfh1 (which can differentiate as TPCs, as indicated by Prc expression, in the absence of Lmd function). (2) Later, it represses Zfh1, thereby reducing further the number of OPCs and TPCs. This is consistent with previous findings which described Zfh1-dependent and Zfh1-independent mechanisms for the regulation of OPC and TPC number (Sellin, 2009).
Of note, it was previously shown that Zfh1 overexpression leads to an increase in pericardial cell number (both OPCs and TPCs) and a concomitant loss of dorsal somatic muscle cells, indicating that overexpression of Zfh1 phenocopies the pericardial hyperplasia in lmd mutant embryos. It was shown further that overexpression of Zfh1 with the twist-Gal4 or 24B-Gal4 driver leads to an increased number of AMP like cells in the dorsal mesoderm although the effect is rather weak when compared to lmd mutant embryos. Zfh1 overexpression does not however alter the pattern of Lmd expression, indicating that Zfh1 does not antagonize Lmd function at the transcriptional level. To verify whether Zfh1 has an influence on Lmd at the posttranscriptional level, the intracellular distribution of Lmd was analyzed in embryos overexpressing Zfh1, because Lmd function has been shown to be modulated by its subcellular localization in wild type embryos. In embryos overexpressing Zfh1, the subcellular localization of Lmd does not appear to be altered, suggesting that Zfh1 does not influence the subcellular distribution of the Lmd protein (Sellin, 2009).
Taken together, these data indicate that Lmd and Zfh1 have generally opposite effects on dorsal mesoderm differentiation: Lmd loss-of-function or Zfh1 gain-of-function leads to increased AMPs or PCs, whereas Lmd gain-of-function and Zfh1 loss-of-function reduce these cell types. Consequently, Lmd and Zfh1 can be considered to be functional antagonists, although their repression is not mutual. One possible explanation for the antagonistic effect of Zfh1 overexpression might be due to its direct negative influence on mef2 expression, thereby counteracting the mef2 activating function of Lmd. The vertebrate functional orthologue of Zfh1, ZEB2 (or Sip1), also inhibits myotube development in culture and represses a number of myogenic genes, and is able to rescue Zfh1 function in Drosophila (Sellin, 2009).
Lmd is instructed to restrict Tin expression by a late, pro-myogenic Dpp signal: While in wild type embryos Tin expression is repressed in cells destined to become dorsal FCMs between stages 12 and 13, there is a prolonged co-localization of Tin and lmd mRNA in cells of the dorsal mesoderm in lmd mutant embryos. As a consequence, dorsal FCMs adopt pericardial cell fates in the absence of Lmd function. Of note, this effect can also be observed in embryos carrying the dppd6 disk region mutation. These embryos lack a late Dpp signal (beginning at about stage 12) that is involved in pericardial restriction. Early Dpp signaling does not seem to be affected since the dorsal mesoderm (characterized by Dpp-dependent Tin expression) is normal in dppd6 mutant embryos. Quite contrary to embryos with otherwise decreased Dpp signaling and a reduced pericardial field, such as mad1-2 embryos, the dppd6 mutant embryos display a pericardial hyperplasia phenotype that resembles in many aspects the phenotype observed in lmd mutant embryos. Too many OPCs, TPCs and atypical TPCs without Zfh1 expression are also detected, although the dppd6 mutant phenotype is milder than the lmd mutant phenotype. This resemblance in phenotypes suggested an epistatic relationship of Lmd and the late Dpp signal. In addition, the accumulation of phosphorylated Mad (pMad) has been traced in PCs and cells within the dorsal musculature that are not positive for founder specific Kr or Eve expression, and hence are likely to be FCMs. Altogether, these findings lead to the hypothesis that Lmd might be a target of the late Dpp signal in FCMs. However, Lmd is expressed in a normal pattern (both at the mRNA and protein levels) in dppd6 mutant embryos, indicating that Lmd expression is independent of Dpp signaling. Nevertheless, co-staining with anti-Tin antibody revealed a prolonged co-localization of Tin and lmd mRNA in dppd6 mutant embryos until stage 14/15, as observed in lmd mutant embryos, suggesting a requirement for late Dpp signaling in the process of pericardial restriction by Lmd. To assess if the restrictive influence of late Dpp signaling on Tin expression is indeed relayed by Lmd in the dorsal mesoderm, or if both negative effects are independent of each other, the late Dpp signal was enhanced in the lmd mutant background. For this purpose, the leading edge driver LE-Gal4 was used to overexpress Dpp, which was shown to reduce the number of OPCs and TPCs in the wild type background. It was reasoned that this effect would be lost in lmd mutant embryos if Lmd is responsible for the restricting effect on PC number. The number of OPCs was counted in LE > Dpp; lmd embryos in comparison to lmd mutant embryos. While overexpression of Dpp with the LE-Gal4 driver in the wild type background led to a reduction of OPCs by ~1.2-fold, no reduction of OPCs was observed in the lmd mutant background, indicating that Lmd is indeed necessary to interpret the late Dpp signal as pro-myogenic. Altogether, these data suggest that the pro-myogenic effect of the late Dpp signal is Lmd dependent, although not by inducing Lmd expression. Instead, the presence of Dpp activity seems to be a prerequisite for the negative influence of Lmd on Tin expression and might act as an instructive signal to modify Lmd activity to allow repression of Tin. If the late Dpp signal is lost -- as is the case in embryos carrying the hypomorphic allele dppd6 - repression of Tin fails even in the presence of Lmd protein, indicating that repressive activity of Lmd is dependent on Dpp signaling (Sellin, 2009).
A model is proposed in which the subdivision of the early Tin positive primordium into pericardial and dorsal muscle tissues is mediated via the antagonistic action of Lmd and Zfh1 under the instructive influence of late Dpp signals. While the early function of Dpp restricts Tin expression to the dorsal mesoderm, subsequent Dpp signaling provides pro-myogenic input to modulate the pericardial field in favor of the dorsal musculature. The present data show that the function of this late Dpp signal requires Lmd activity, strongly suggesting that Lmd is a target of Dpp for establishing the boundary between the dorsal musculature and pericardial field. Repression of Tin also appears to be dependent on Dpp signaling. The previous observation that pMad accumulation occurs in PCs and dorsal muscle cells, which are likely to be FCMs, is consistent with the finding that Lmd is needed to relay the pro-myogenic function of late Dpp signaling. These cells originate from the Tin-expressing dorsal mesoderm, and co-expression of Tin and lmd mRNA in wild type embryos at stage 12 can be observed. In the presence of Lmd protein, this co-expression is not maintained after stage 12 due to a repressive function of Lmd on Tin. Of note, it was previously shown that Lmd function depends on posttranscriptional mechanisms that modulate its specific subcellular localization and activity, and it might be speculated that Dpp signaling is involved in changing Lmd function into a repressive form. However, there is no evidence that the negative influence of Lmd on Tin expression is of a direct nature, or if there are other factors that are involved in the process. In this context, the following explanation for the antagonistic effect of Zfh1 overexpression without repression of Lmd could also be considered. Since the vertebrate homologue ZEB2 was shown to inhibit activation of target genes by Smads, an excess of Zfh1 might antagonize the late Dpp signal by repressing pMad-dependent interaction partners of Lmd, thereby preventing the repression of Tin (and/or other targets) in the dorsal mesoderm. Lmd expression and function would not be affected elsewhere which would be consistent with the observation that Zfh1 is not a general repressor of Lmd (Sellin, 2009).
Casal, J. and Leptin, M. (1996). Identification of novel genes in Drosophila reveals the complex regulation of early gene activity in the mesoderm. Proc. Natl.
Acad. Sci. 93: 10327-10332. PubMed ID: 8816799
Cunha, P. M., et al. (2010). Combinatorial binding leads to diverse regulatory responses: Lmd is a tissue-specific modulator of Mef2 activity. PLoS Genet. 6(7): e1001014. PubMed ID: 20617173
Duan, H., Skeath, J. B. and Nguyen, H. T. (2001). Drosophila Lame duck, a novel member of the Gli superfamily, acts as a key regulator of myogenesis by controlling fusion-competent myoblast development. Development 128: 4489-4500. PubMed ID: 11714674
Duan, H. and Nguyen. H. T. (2006). Distinct posttranscriptional mechanisms regulate the activity of the Zn finger transcription factor Lame duck during Drosophila myogenesis. Mol. Cell. Biol. 26(4): 1414-23. PubMed ID: 16449652
Furlong, E. E. M., Andersen, E. C., Null, B., White, K. P. and Scott, M. P. (2001). Patterns of gene expression during Drosophila mesoderm development.
Science 293: 1629-1633. PubMed ID: 11486054
Jakobsen, J. S., et al. (2007). Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral muscle transcriptional network.
Genes Dev. 21(19): 2448-60. PubMed ID: 17908931
Nishida. H. and Sawada, K. (2001). macho-1 encodes a localized mRNA in ascidian eggs that specifies muscle fate during embryogenesis. Nature 409(6821): 724-9. PubMed ID: 11217862
Ruiz-Gomez, M., et al. (2002). myoblasts incompetent encodes a zinc finger transcription factor required to specify fusion-competent myoblasts in Drosophila. Development 129: 133-141. PubMed ID: 11782407
Sellin, J., Drechsler M., Nguyen H. T. and Paululat, A. (2009). Antagonistic function of Lmd and Zfh1 fine tunes cell fate decisions in the Twi and Tin positive mesoderm of Drosophila melanogaster. Dev. Biol. 326: 444-455. PubMed ID: 19028484
date revised: 15 February 2011
Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.
The Interactive Fly resides on the
lame duck:
Biological Overview
| Regulation
| Developmental Biology
| Effects of Mutation
| References
Society for Developmental Biology's Web server.