Interactive Fly, Drosophila


REGULATION

Targets of Activity

Achaete and Scute bind to the consensus E box sequence CANNTG, activating transcription in Enhancer of split, m7 and m8 of the Enhancer of split complex and in Bearded and scabrous as well (Singson, 1994). Achaete, Scute, and Lethal of scute, together with VND, act synergistically to specify the neuroectodermal expression of Enhancer of split complex genes. Autoregulatory interactions of E(spl)-C genes contribute to this regulation (Kramatschek, 1994).

Bearded is activated by the proneural genes. Several genes are direct downstream targets of achaete-scute activation, as judged by the following criteria: the genes are expressed in the proneural clusters (PNCs) of the wing imaginal disc in an ac-sc-dependent manner; (2) the proximal promoter regions of all of these genes contain one or two high-affinity ac-sc binding sites, which define the novel consensus GCAGGTG(T/G)NNNYY, and (3) where tested, these binding sites are required in vivo for PNC expression of promoter-reporter fusion genes. Interestingly, these ac-sc target genes, including , Enhancer of split m7, Enhancer of split m8, and scabrous, are all known or believed to function in the selection of a single SOP from each PNC, a process mediated by inhibitory cell-cell interactions. Thus, one of the earliest steps in adult peripheral neurogenesis is the direct activation by proneural proteins of genes involved in restricting the expression of the SOP cell fate. Brd bristle phenotypes are dependent on ac/sc function, and Brd transcript accumulation within wing disc proneural clusters likewise requires ac/sc activity. Brd promoter, containing the novel sequence described above. is directly activated in proneural clusters by bHLH protein complexes that include ac and sc. However, in contrast to ac and sc, there is generally no clear elevation of Brd transcript in presumptive SOPs (Leviten, 1997).

It is now clear that E(spl)-C gene expression is totally dependent on lateral inhibition and the Notch pathway acting through Suppressor of Hairless. If this is true, then the role of E-boxes in the transcriptional activation of E(spl)-C genes is currently unclear. Perhaps VND activates proneural genes which in turn activate E(spl)-C genes through the Notch pathway. Achaete and Scute upregulate E(spl)m7 and Enhancer of split in a wing disc pattern very similar to that achaete and scute expression. This is surprising since the wild function of E(spl)-C genes is to antagonize the SOP cell fate within the proneural cluster. It is thought that other mechanisms (Notch signaling for example) normally operate to regulate the SOP expression or activity of E(spl)-C genes (Singson, 1994). In fact it has been shown that HLH-M5 and Enhancer of split are capable of binding as homo-and heterodimers to a sequence in the promoters of the Enhancer of split and achaete genes, called the N-box, which differs slightly from the consensus binding site (the E-box) for other bHLH proteins. In transient expression assays, both proteins were found to attenuate the transcriptional activation mediated by proneural bHLH proteins Lethal of Scute and Daughterless at the Enhancer of split promoter (Oellers, 1994).

delta transcription is regulated by AS-C genes. A region in the Delta promoter drives Delta expression in clusters of neurectodermal cells preceding and during neuroblast segregation (Haenlin, 1994).

Achaete and Scute inhibit Delta transcription. Like mutant Notch cells, cells mutant for either E(spl)-C bHLH-encoding genes or groucho inhibit neighbouring wild-type cells, causing them to adopt the epidermal fate. This inhibition requires the genes of the achaete-scute complex (AS-C) which must therefore regulate the signal Delta. Thus there is a regulatory loop between Notch and Delta that is under the transcriptional control of the AS-C genes (Heitzler, 1996).

Four genes (ming, even-skipped, unplugged and achaete) are expressed in specific neuroblast sublineages. These neuroblasts can be identified in embryos lacking both neuroblast cytokinesis and cell cycle progression (string mutants) and in embryos lacking only neuroblast cytokinesis (pebble mutants). The unplugged and achaete genes are expressed normally in string and pebble mutant embryos, indicating that temporal control is independent of neuroblast cytokinesis or counting cell cycles. In contrast, neuroblasts require cytokinesis to activate sublineage ming expression, while a single identified neuroblast requires cell cycle progression to activate even-skipped expression. This suggests that neuroblasts have an intrinsic gene regulatory hierarchy controlling unplugged and achaete expression, but that cell-cycle or cytokinesis-dependent mechanisms are required for ming and eve CNS expression (Cui, 1995).

Bearded is activated by the proneural genes. Several genes are direct downstream targets of achaete-scute activation, as judged by the following criteria: the genes are expressed in the proneural clusters (PNCs) of the wing imaginal disc in an ac-sc-dependent manner; (2) the proximal promoter regions of all of these genes contain one or two high-affinity ac-sc binding sites, which define the novel consensus GCAGGTG(T/G)NNNYY, and (3) where tested, these binding sites are required in vivo for PNC expression of promoter-reporter fusion genes. Interestingly, these ac-sc target genes, including , Enhancer of split m7, Enhancer of split m8, and scabrous, are all known or believed to function in the selection of a single SOP from each PNC, a process mediated by inhibitory cell-cell interactions. Thus, one of the earliest steps in adult peripheral neurogenesis is the direct activation by proneural proteins of genes involved in restricting the expression of the SOP cell fate. Brd bristle phenotypes are dependent on ac/sc function, and Brd transcript accumulation within wing disc proneural clusters likewise requires ac/sc activity. Brd promoter, containing the novel sequence described above. is directly activated in proneural clusters by bHLH protein complexes that include ac and sc. However, in contrast to ac and sc, there is generally no clear elevation of Brd transcript in presumptive SOPs (Leviten, 1997).

Cell proliferation in the excretory organs of Drosophila, the Malpighian tubules (MT), is under the control of a neural tip cell. This unique cell is singled out from equivalent MT primordial cells in response to Notch signalling. Kruppel (Kr), best known for its segmentation function in the early embryo, is under the control of the Notch-dependent signalling process. Lack-of-function and gain-of-function experiments demonstrate that Kr activity determines the neural fate of tip cells by acting as a direct downstream target of proneural basic helix-loop-helix (bHLH) proteins that are restricted in response to Notch signalling. A unique cis-acting element has been identified that mediates all spatial and temporal aspects of Kr gene expression during MT development. This element contains functional binding sites for the restricted proneural bHLH factors and Fork head protein which is expressed in all MT cells. These results suggest a mechanism in which these transcription factors cooperate to set up a unique cell fate within an equivalence group of cells by restricting the activity of the developmental switch gene Kr in response to Notch signalling (Hoch, 1998).

In Drosophila, genes of the Enhancer of split Complex [E(spl)-C] are important components of the Notch (N) cell-cell signaling pathway, which is utilized in imaginal discs to effect a series of cell fate decisions during adult peripheral nervous system development. Seven genes in the complex encode basic helix-loop-helix (bHLH) transcriptional repressors, while 4 others encode members of the Bearded family of small proteins. A striking diversity is observed in the imaginal disc expression patterns of the various E(spl)-C genes, suggestive of a diversity of function, but the mechanistic basis of this variety has not been elucidated. Strong evidence is presented from promoter-reporter transgene experiments that regulation at the transcriptional level is primarily responsible. Certain E(spl)-C genes are direct targets of transcriptional activation both by the N-signal-dependent activator Suppressor of Hairless [Su(H)] and by the proneural bHLH proteins Achaete and Scute. An extensive sequence analysis of the promoter-proximal upstream regions of 12 transcription units in the E(spl)-C reveals that such dual transcriptional activation is likely to be the rule for at least 10 of the 12 genes. The very different wing imaginal disc expression patterns of E(spl)m4 and E(spl)mgamma are a property of small (200-300 bp), evolutionarily conserved transcriptional enhancer elements that can confer these distinct patterns on a heterologous promoter despite their considerable structural similarity [each having three Su(H) and two proneural protein binding sites]. The characteristic inactivity of the E(spl)mgamma enhancer in the notum and margin territories of the wing disc can be overcome by elevated activity of the N receptor. It is concluded that the distinctive expression patterns of E(spl)-C genes in imaginal tissues depend to a significant degree on the capacity of their transcriptional cis-regulatory apparatus to respond selectively to direct proneural- and Su(H)-mediated activation, often in only a subset of the territories and cells in which these modes of regulation are operative (Nellesen, 1999).

Lyra/Senseless is expressed in some cells of proneural clusters and SOPs, when and where proneural genes are expressed. Whether Sens expression is dependent on proneural activity was determined by staining embryos that lack daughterless (da) or atonal or the genes of the AS-C (Df(1)scB57, a deficiency of ac, sc, l'sc, and ase). Embryos that lack da exhibit a loss of all PNS cells, except the SOPIs. The Daughterless protein has been shown to form heterodimers with many proneural proteins, and this dimerization is essential for neuronal determination or differentiation of many SOP lineages. Embryos homozygous for a deficiency that removes da (Df(2L)J27) and da1 fail to express Sens protein or mRNA. Similarly, embryos that lack genes of the AS-C fail to express Sens in all the PNS cells that are affected by loss of the AS-C. Finally, homozygous atonal (ato1) mutant embryos fail to express Sens in chordotonal SOPs except in those derived from P cells. Interestingly, the P cell is an SOP that gives rise to the only embryonic chordotonal organ that is not dependent on the activity of the atonal gene (Nolo, 2000).

To determine whether proneural gene expression is required for Sens expression in imaginal discs, eye-antennal discs of atonal mutants were stained for Sens protein. Eye-antennal imaginal discs of ato1 are devoid of Sens expression, and in the absence of sens, photoreceptor development is aberrant. Similarly, wing discs of achaete mutants [In(1)y3PC sc8R] lack most SOPs and Sens expression. In summary, Sens expression is essentially confined to cells of the PNS and is dependent on proneural gene expression. No Sens expression is observed in the CNS of embryos or larvae (Nolo, 2000).

Snail, a zinc-finger transcriptional repressor, is a pan-neural protein, based on its extensive expression in neuroblasts. Previous results have demonstrated that Snail and related proteins, Worniu and Escargot, have redundant and essential functions in the nervous system. The Snail family of proteins control central nervous system development by regulating genes involved in asymmetry and cell division of neuroblasts. Whether the neuroblast expression of snail and worniu is regulated by proneural genes was examined. Such a result would place the snail family in the well established genetic hierarchy that controls early neuroblast differentiation. The scuteB57 deletion mutant uncovers the three pro-neural genes: achaete, scute and lethal of scute. In this mutant, the expression of worniu in neuroblasts is significantly reduced. Only a few neuroblasts within each segment exhibit staining, and the expression level is substantially lower than in the wild type. The expression of worniu is also regulated by vnd and ind, such that in these mutant embryos the whole ventral and intermediate columns of staining are missing. In the mshDelta68 mutant, no abnormal expression of worniu was detected. Previous results have shown that the neuroblast expression of snail is slightly affected in achaete-scute and vnd mutants but is not affected in a daughterless mutant. In ind and msh mutants, Snail protein expression was observed in many neuroblasts but the spatial pattern was rather disorganized. In summary, most of the proneural genes tested have profound effects on the expression of worniu, and have detectable but lesser effects on that of snail. The predominant expression of snail and worniu in neuroblasts and their regulation by proneural genes suggests that the snail family genes may have important functions within neuroblasts (Ashraf, 2001).

Cell proliferation in the developing renal tubules of Drosophila is strikingly patterned, occurring in two phases to generate a consistent number of tubule cells. The later phase of cell division is promoted by EGF receptor signaling from a specialized subset of tubule cells, the tip cells, which express the protease Rhomboid and are thus able to secrete the EGF ligand, Spitz. The response to EGF signaling, and in consequence cell division, is patterned by the specification of a second cell type in the tubules. These cells are primed to respond to EGF signaling by the transcription of two pathway effectors, PointedP2, which is phosphorylated on pathway activation, and Seven up. While expression of pointedP2 is induced by Wingless signaling, seven up is initiated in a subset of the PointedP2 cells through the activity of the proneural genes. Both signaling and responsive cells are set aside in each tubule primordium from a proneural gene-expressing cluster of cells, in a two-step process: (1) a proneural cluster develops within the domain of Wingless-activated, pointedP2-expressing cells to initiate the co-expression of seven up; (2) lateral inhibition, mediated by the neurogenic genes, acts within this cluster of cells to segregate the tip cell precursor, in which proneural gene expression strengthens to initiate rhomboid expression. As a consequence, when the precursor cell divides, both daughters secrete Spitz and become signaling cells. Establishing domains of cells competent to transduce the EGF signal and divide ensures a rapid and reliable response to mitogenic signaling in the tubules and also imposes a limit on the extent of cell division, thus preventing tubule hyperplasia (Sudarsan, 2002).

To understand how the proneural and neurogenic genes pattern the response to EGFR activation, the expression of genes involved in transduction of the pathway was analyzed. The orphan nuclear-receptor svp functions downstream of the EGF receptor to promote cell divisions in the tubules. In the absence of Svp function, cycE and stg transcription is abolished, with a consequent reduction in EGFR-driven cell divisions. These late divisions in the tubules of stage 12 wild-type embryos were followed and it was found that BrdU incorporation (and hence, cell division) is confined within the svp-lacZ domain. These results define the svp domain of expression as including those cells which will divide in response to Egfr activation. However, the expression of svp-lacZ is initiated in a group of cells surrounding the tip mother cell, before the birth of the TC. This early onset of svp expression occurs before the late divisions start (cycle 17 onwards), when neither Svp function nor Egfr activation is required for cell proliferation. The pattern of gene expression observed suggests that the Svp-positive cells surrounding the tip mother cell derive from the proneural cluster (Sudarsan, 2002).

To test this hypothesis, the expression of svp-lacZ in embryos lacking proneural gene function was examined. Indeed, in AS-C-/- embryos, the expression of svp is not initiated in the tubules. Conversely, in N mutants, where all cells in the cluster adopt the primary tip cell (TC) fate, the expression of svp is confined to the transformed cells. After the initiation of Spi signaling from the TC/SC, svp expression depends on Egf receptor activation. However that the early expression of svp is not dependent on Egfr function is shown in topCO mutants, where svp-lacZ expression is still initiated normally, but is not maintained. In AS-C–/– embryos expressing lambdatop in the tubules, svp expression is not detected. Together these data suggest that the initiation of svp depends on the proneural genes but is independent of Egf receptor signaling, which acts only from cycle 17 to maintain svp expression (Sudarsan, 2002).

These results show that the expression of proneural genes in the tubules not only confers tip cell potential but also initiates the expression of an effector of the Egf pathway, svp. It is suggested that this primes cells to divide in response to EGF receptor activation. Proneural genes are therefore required to specify two cell fates in the tubule proneural clusters (PNCs); the tip mother cell and cells competent to respond to Egfr activation (Sudarsan, 2002).

phyllopod is a target gene of proneural proteins in Drosophila external sensory organ development

Proneural basic helix-loop-helix (bHLH) proteins initiate neurogenesis in both vertebrates and invertebrates. The Drosophila Achaete (Ac) and Scute (Sc) proteins are among the first identified members of the large bHLH proneural protein family. phyllopod (phyl), encoding an ubiquitin ligase adaptor, is required for ac- and sc-dependent external sensory (ES) organ development. Expression of phyl is directly activated by Ac and Sc. Forced expression of phyl rescues ES organ formation in ac and sc double mutants. phyl and senseless, encoding a Zn-finger transcriptional factor, depend on each other in ES organ development. These results provide the first example that bHLH proneural proteins promote neurogenesis through regulation of protein degradation (Pi, 2004).

In phyl2-null mutant clones, adult ES organs are absent, and this defect is caused by a failure in SOP specification. In phyl2/phyl4 hypomorphic mutants, most ES organs are also absent, and expression of two SOP markers, ase-lacZ and the A101 enhancer trap line, are strongly compromised. However, Sens is expressed in single, selected SOPs at 12-14 h after puparium formation (APF), suggesting a defect in SOP differentiation, but not in SOP selection in phyl hypomorphic mutants (Pi, 2004).

Ac expression, which is initially in proneural clusters and restricted in SOPs at 12-14 APF in wild type, was examined. However, in phyl2/phyl4 mutants, Ac expression is not only detected in SOPs, but also weakly in SOP-neighboring cells. Ac expression in SOP-neighboring cells is later diminished at 16-18 APF. This result suggests that lateral inhibition is partially affected. To test this, E(spl)m8-lacZ was used as a reporter to monitor Notch signaling. Although E(spl)m8-lacZ is strongly expressed in a proneural pattern in wild type, the expression is abolished in phyl2/phyl4 mutants, suggesting that activation of the Notch pathway in the SOP-neighboring cells is compromised in phyl mutants (Pi, 2004).

In wild-type ES organ development, Sens staining appears in two SOP-daughter cells at 16-18 h APF and in four daughter cells at 24-28 h APF. In phyl2/phyl4 mutants, Sens is still maintained mostly in single cells even at 24-28 h APF. In wild-type animals, SOPs express elevated levels of the cell-cycle regulator Cyclin E (CycE). In phyl2/phyl4 mutants, SOPs fail to express a higher level of CycE, suggesting a failure in cell cycle progression. The SOPs and SOP daughter cells of ES organs express cut, a selector gene in the determination of ES organ identity. In phyl2/phyl4 mutants when SOP differentiation has been arrested, Cut expression is absent. Taken together, these data indicate that Phyl is required for gene expression in SOP differentiation and lateral inhibition, for SOP cell cycle progression and for ES organ identity (Pi, 2004).

Ac and Sc are bHLH transcriptional activators, and Ac/Da and Sc/Da heterodimers bind specifically to the E boxes CAG(G/C)TG with high affinity and CACGTG with low affinity. Within the 4.1-kb phyl promoter region, there are four such E boxes (E1-E3, CAGCTG; E4, CACGTG). Three phyl reporter genes were constructed by fusing 4.1-, 3.4-, and 2.2-kb promoter regions of phyl to GFP, and all three reporters show similar expression patterns with difference in the GFP signal intensities (the 4.1-kb promoter being the strongest and 2.2-kb being the weakest). For example, the 3.4-kb region is sufficient to drive GFP expression in embryonic SOPs, SOPs of the late third-instar larval wing and leg discs, and SOPs in early pupal nota. These phyl-GFP reporter genes are also expressed in the proneural clusters at earlier stages in both wing discs and pupal nota (Pi, 2004).

To test whether these promoter regions are sufficient for phyl in vivo function, phyl4.1-ORF and phyl3.4-ORF rescue constructs were made by fusing the 4.1- and 3.4-kb promoter regions, respectively, to the phyl ORF. The phyl1/phyl2 mutants die at late embryonic or first-instar larval stages. However, both phyl4.1-ORF and phyl3.4-ORF are sufficient to rescue the viability of phyl1/phyl2 animals to the adult stage, with well developed ES organs on the notum. The inabilities to fully rescue the viability and ES organ number of phyl1/phyl2 are caused by insufficient expression levels of the transgenes, as suggested by the fact that two copies of phyl3.4-ORF further improve the viability of the phyl1/phyl2 mutants to 77% and increase the bristle number to 110 ± 7. Hypomorphic phyl4/phyl2245 mutants, which display a greatly reduced number of ES organs on the notum, are completely rescued by two copies of phyl3.4-ORF. Therefore, all of these results show that both 4.1- and 3.4-kb regions of the phyl promoter contain sufficient temporal and spatial information in regulating phyl expression (Pi, 2004).

Whether activity of the 3.4-kb promoter region is regulated by ac and sc was tested. sc10-1 is a compound mutation in which both ac and sc are inactivated. Expressions of phyl3.4-GFP in sc10-1 wing discs and pupal nota are abolished. In contrast, when sc is misexpressed by dpp-GAL4 at the anterior/posterior boundary of the wing disc, phyl3.4-GFP is strongly activated in this region. Similar results are also observed for phyl4.1-GFP. Therefore, these results clearly show that proneural genes ac and sc are necessary and sufficient to activate phyl promoter activity (Pi, 2004).

To test whether Ac and Sc directly regulate phyl expression, all four E boxes in the 3.4-kb promoter region were mutated to make the phyl3.4DeltaE-GFP. The expression of phyl3.4DeltaE-GFP in the SOPs of ES organs in late third-instar wing and leg discs and in pupal nota is strongly reduced when compared to the expression of phyl3.4-GFP. When the GFP intensity was quantified in the anterior wing margin SOPs, E box mutations in the 3.4-kb promoter region contribute to a 50% reduction. In contrast, the expression level of phyl3.4Delta E-GFP in the SOPs of chordotonal (CH) organs promoted by the proneural gene ato is comparable to that of phyl3.4-GFP. These results indicate that the phyl promoter is activated by Ac and Sc through these four E boxes. To test the in vivo significance of the four E boxes, the rescue abilities were compared between phyl3.4-ORF and phyl3.4DeltaE-ORF. Although phyl3.4-ORF can rescue phyl1/phyl2 to the adult stage, phyl3.4DeltaE-ORF-rescued animals only survive to the third-instar larval stage. The abilities of phyl3.4DeltaE-ORF to rescue the viability and the notal ES organ of phyl4/phyl2245 mutants are strongly reduced to 36 ± 11% and 67 ± 12, respectively. Many of the rescued ES organs show abnormal configuration such as double hair/double socket, which is a phenotype frequently observed in hypomorphic phyl mutants. Therefore, these results suggest that these four E boxes are required for full phyl promoter activity in SOPs (Pi, 2004).

In sc10-1 flies, phyl expression is diminished and ES organ development is disrupted. It was asked whether forced expression of phyl can functionally substitute for the absence of ac and sc activities. Misexpression of phyl by Eq-GAL4 in sc10-1 flies efficiently rescues ES organ formation, to a level similar to that rescued by misexpression of the proneural gene sc. The rescued ES organs by phyl are arranged in a pattern similar to that of the wild-type flies; the ES organs are aligned in rows and well separated. SOP-specific expressions of neu-LacZ (A101), ase-LacZ, Sens, and Cut, as well as expression of E(spl)m8-LacZ, are restored. As a comparison, sens, whose expression also depends on ac and sc was misexpressed by Eq-GAL4; sens poorly rescues sc10-1 in ES organ formation, although sens is more effective than phyl and sc in inducing ES organs in wild-type background. Therefore, these results suggest that phyl is able to execute the developmental program of ES organs in the absence of proneural genes ac and sc.

Ac and Sc activate the bHLH gene ase in SOPs to promote SOP differentiation. Misexpression of ase or another bHLH gene lethal of scute (l'sc) is capable of generating ES organs independent of ac and sc. Whether phyl can rescue ES organ formation in the absence of all four bHLH genes, ac, sc, ase, and l'sc, in scB57 mutant clones, was tested. Although, in a control experiment, misexpression of sc can rescue the ES organ formation in scB57 mutant clones, misexpression of phyl fails to rescue. From this result, it is inferred that phyl requires ase (and/or l'sc) in inducing ES organ formation (Pi, 2004).

The promoter analysis suggests that phyl expression in SOPs might be activated by factors other than Ac and Sc. Within the 4.1-kb promoter region, eight putative Sens-binding sites (AAATCA, S box) were identified, with three sites distributed within the 3.4-kb proximal region and five sites in a cluster located in a very distal region. Whether Sens plays a role in phyl activation in SOPs was tested, using phyl4.1-GFP as a reporter. At 10-12 h APF, phyl4.1-GFP is expressed in dorsoventral stripes along the notum in a pattern analogous to early Ac and Sc expression patterns. At 15 h APF, phyl4.1-GFP expression is restricted in SOPs. In sensE2-null clones, phyl4.1-GFP is expressed in dorsoventral stripes, and this expression is quickly restricted to single SOPs at 16 h APF, identical to that in wild-type tissue. At 20 h APF, when wild-type SOPs have divided to two daughter cells, phyl4.1-GFP expression in sensE2 clones is still maintained in single SOPs, and mostly in two cells at 23 h APF when wild-type cells are in GFP-positive clusters containing three or four cells. Therefore, these results suggest that, in the absence of sens activity, SOP development is delayed, but phyl4.1-GFP expression is minimally affected (Pi, 2004).

To determine the contribution of Sens binding sites to phyl expression, the 3.4-kb phyl promoter region (whose expression pattern is analogous to the 4.1-kb promoter in both wild-type and sens mutant background) was tested. The phyl3.4DeltaS-GFP reporter with all three S boxes mutated expresses little difference in the GFP pattern and intensity when compared to phyl3.4-GFP. However, the reporter with mutations in all four E boxes and three S boxes (phyl3.4DeltaES-GFP) enhances GFP intensity by 20% when compared to phyl3.4DeltaE-GFP with mutations only in four E boxes. This 20% increase in GFP intensity reflects an increase in the phyl activity in vivo because phyl3.4DeltaES-ORF shows stronger abilities than phyl3.4E-ORF in rescuing both the viability and the ES organ number of phyl4/phyl2245 flies. Therefore, these data suggest that these S boxes play a negative role in regulation of phyl activity (Pi, 2004).

To test whether phyl regulates sens expression, Sens protein expression was examined in phyl mutants. In phyl2-null clones, Sens expression was almost diminished in all stages examined, including the single-SOP stage, the two-cell stage and the four-cell stage, suggesting that phyl is required for Sens expression in ES organ development (Pi, 2004).

To analyze the functional relationship between phyl and sens further, rescue experiments were performed. Misexpression of sens by Eq-GAL4 fails to induce ES organ formation in phyl2 mutant clones. Similarly, ES organ formation induced by phyl misexpression is blocked in sensE2 mutant clones. This result suggests that although Sens expression depends on phyl activity, Sens and Phyl function in parallel to promote ES organ development (Pi, 2004).

It is concluded that phyl is a non-bHLH gene that can functionally substitute for proneural bHLH genes to execute neural developmental program. This ability of phyl is also manifested from the analysis of phyl loss-of-function phenotypes: sens and ase, required for SOP differentiation, are inactivated, and in addition, neuralized (A101 insertion locus), implicated in the activation and E(spl)-m8 in the transduction of the Notch pathway, is not expressed. Furthermore, SOP cell division, a prerequisite step to generate distinct daughter cells for constructing a complete ES organ, is blocked in phyl mutants. This defect likely reflects a role for phyl in controlling cell cycle progression, because CycE expression in SOPs maintains at a basal level. Therefore, although SOPs have been selected from proneural clusters in phyl hypomorphs, they are associated with several defects as described (Pi, 2004).

Studies of proneural genes have shown that ac and sc promote ES organ identity, whereas ato promotes CH organ identity. cut is the selector gene to specify the ES organ identity; in its absence ES organs are transformed into CH organs and misexpression of cut transforms CH organs into ES organs. The absence of Cut expression in phyl mutants suggests that specification of ES organ identity may be through a regulation of cut expression by Phyl. Although phyl is expressed in SOPs for both ES and CH organs, it was found that, in phyl2/phyl4 and phyl1/phyl4 mutants, A101 expression in leg CH organ precursors remained normal. Also, misexpression of phyl fails to rescue ato mutants in CH organ formation. These results suggest that phyl mediates functions of ac and sc only in ES organ development (Pi, 2004).

One well characterized function of Phyl is to bring the Ttk protein to the ubiquitin-protein ligase Sina for degradation. During SOP development, phyl is expressed in SOPs, and Ttk is expressed ubiquitously except in the SOPs and the proneural clusters. Genetic studies among phyl, sina, and ttk suggest that phyl and sina promote ES organ development by antagonizing ttk activity. Ttk contains a BTB/POZ domain and functions as a transcriptional repressor. Therefore, degradation of Ttk can lead to the derepression of SOP-specific genes. These studies suggest that degradation of a general transcriptional repressor plays a crucial role in regulating gene expression in different aspects of neural precursor differentiation (Pi, 2004).

Genetic programs activated by proneural proteins in the developing Drosophila PNS

Neurogenesis depends on a family of proneural transcriptional activator proteins, but the 'proneural' function of these factors is poorly understood, in part because the ensemble of genes they activate, directly or indirectly, has not been identified systematically. A direct approach to this problem has been undertaken in Drosophila. Fluorescence-activated cell sorting was used to recover a purified population of the cells that comprise the 'proneural clusters' from which sensory organ precursors of the peripheral nervous system (PNS) arise. Whole-genome microarray analysis and in situ hybridization was then used to identify and verify a set of genes that are preferentially expressed in proneural cluster cells. Genes in this set encode proteins with a diverse array of implied functions, and loss-of-function analysis of two candidate genes shows that they are indeed required for normal PNS development. Bioinformatic and reporter gene studies further illuminate the cis-regulatory codes that direct expression in proneural clusters (Reeves, 2005).

The PNC cells that express the proneural genes achaete (ac) and scute (sc) comprise only a small fraction of the wing imaginal disc of the late third-instar Drosophila larva. It is anticipated that this might frustrate attempts to characterize PNC-specific gene expression in unfractionated wing discs (e.g., by comparison of wild-type and ac-sc mutant tissue). Accordingly, PNC cells were purified by using fluorescence-activated cell sorting (FACS). As a PNC-specific marker, a GFP reporter was chosen representing the Bearded family gene E(spl)m4. m4 is strongly and specifically expressed in PNCs, and a cis-regulatory module has been identified sufficient to recapitulate this activity. Wing imaginal discs were dissected from late third-instar larvae carrying the m4-GFP transgene and dissociated in trypsin-EDTA; cells with fluorescence greater than that of w1118 control cells (GFP-positive cells) and cells with fluorescence comparable to the control (GFP-negative cells) were recovered separately by FACS (Reeves, 2005).

Transcripts from several genes known to be expressed in domains of the wing disc outside of PNCs (en, hh, and twi) were found to be greatly depleted in the GFP-positive cell population. These negative controls provide further evidence of successful separation of PNC cells from other disc cells (Reeves, 2005).

Since the microarray data clearly associates expression of known genes preferentially with the expected cell populations, 43 candidates not known to be expressed in wing imaginal discs were chosen for further analysis. Candidate genes for which cDNA clones were available from the Drosophila Gene Collection were favored. The selected genes exhibit a wide variety of GFP+/GFP- expression ratios in the microarray data, and their products have a broad spectrum of predicted functions (Reeves, 2005).

In situ hybridization was employed as a secondary screening method, both to verify that candidate genes selected from these microarray data are expressed in wing imaginal discs, and to determine their specific patterns of transcript accumulation. The wing disc expression patterns observed can be sorted into three major classes: PNC patterns, SOP patterns, and overlapping patterns. Five of the 43 selected candidate genes exhibit a complete PNC pattern of expression, while 3 other candidates are expressed in subsets of PNCs; phyl is expressed in the SOP and in a subset of non-SOP cells in each PNC. An unexpected 18 candidates are expressed in the presumptive SOP cells of the wing disc. Fourteen of these SOP genes are expressed in a complete pattern of SOPs, whereas the remaining four are expressed either late in SOP development or in subsets of SOPs. The existence of the latter group suggests that the cell sorting strategy made it possible to identify genes that are expressed preferentially in just a few cells of the wing disc. Overall, 27 (63%) of the tested candidates were found to display PNC- or SOP-specific expression patterns. This is likely to be an underestimate of the true success rate of the microarray analysis, since 23 genes known to be expressed in these patterns are not included in the statistic, though they were reidentified in the screen (Reeves, 2005).

In addition to those expressed specifically in PNCs and SOPs, a small group of candidate genes was found that is expressed in patterns that overlap PNCs but appears to be distinct from them. Detection of this class of genes is an important confirmation of the efficacy and unbiased nature of the experimental approach (Reeves, 2005).

Patterned expression of the proneural genes ac and sc defines the PNCs for most external sensory bristles in adult Drosophila, and ac-sc function is required for PNC and SOP gene expression, as well as for specification of the SOP cell fate. Fifteen of the genes identified by the combined cell sorting/microarray approach also require proneural gene function for their expression. In an ac sc proneural mutant background, transcript accumulation from members of both the PNC (CG11798, CG32434/loner, edl, PFE) and SOP (CG3227, CG30492, CG32150, CG32392, Men, qua) classes is lost from PNCs that require ac-sc function. This result is further evidence that the approach has identified bona fide PNC genes, and it demonstrates that expression of these ten genes is, directly or indirectly, downstream of the bHLH activators encoded by ac and sc. The data further show that the PNC-specific imaginal disc expression of the previously studied genes mira, phyl, rho, Spn43Aa, and Traf1 is likewise downstream of proneural gene function (Reeves, 2005).

The identification of sets of genes comprising the genetic programs deployed in PNCs and SOPs by the action of proneural proteins offers a powerful opportunity to investigate the regulatory organization of these programs. Specifically, it was of interest to find out (1) which genes are directly activated by proneural regulators, and which indirectly, and (2) the nature of the cis-regulatory sequences and their cognate transcription factors that distinguish PNC- versus SOP-specific target gene expression. This analysis was initiated by examining potential regulatory sequences of several of the genes that have been identified for the presence of conserved, high-affinity proneural protein binding sites of the form RCAGSTG. The initial approach was to ask whether evolutionarily conserved clusters of these binding sites identify cis-regulatory modules of the appropriate specificity. To date, this strategy has proven very successful. Genomic DNA fragments bearing proneural protein binding site clusters associated with CG11798, edl, Traf1, CG32434/loner, and rho confer PNC-specific activity on a heterologous promoter, while similar modules from CG32150, mira, and PFE drive SOP-specific expression. In three cases, double labeling with the SOP marker anti-Hindsight (Hnt) reveals that PNC-specific expression of the reporter gene includes the SOP as well as the non-SOP cells. Mutation of the proneural protein binding sites in four of the enhancer-bearing fragments severely reduces (CG11798) or abolishes (CG32150, edl, Traf1) reporter gene expression in PNCs/SOPs. Such results indicate that these genes are indeed direct targets of activation by proneural proteins in vivo (Reeves, 2005).

Holometabolous insects like Drosophila carry out two major phases of PNS neurogenesis, one in embryogenesis to form the larval PNS, and a second in the late larval and early pupal stages to construct the adult PNS. Many known genes participate in both phases. Accordingly, it was of interest to determine whether genes identified as being expressed in imaginal disc PNCs or SOPs are also expressed in the developing larval PNS. In situ hybridization reveals that, among others, the PNC genes CG11798 and CG32434/loner and the SOP genes CG3227, CG32150, and CG32392 are indeed expressed in embryonic PNCs and SOPs, respectively (Reeves, 2005).

To determine whether this combined cell sorting/microarray/in situ hybridization approach had indeed identified gene functions required for proper PNS development, loss-of-function alleles of two loci, CG11798 and CG3227, were generated. These were chosen because (1) transcript accumulation from both genes was detected in the primordia of both the larval and adult PNSs; (2) both genes encode proteins with conserved domains; and (3) mobilizable P element transposon insertions were available adjacent to these genes (Reeves, 2005).

CG11798 is predicted to encode a probable transcription factor with four zinc finger domains. Loss-of-function alleles of the gene were generated by mobilizing KG03781, a P element located immediately downstream. A precise excision of the P transposon and two partial deletions of the CG11798 coding region were recovered and characterized by sequencing. Deletions 19E and 34E are both homozygous lethal during early larval stages, and both confer clear defects in the development of the larval PNS. 19E causes the loss or misplacement of sensory neurons marked by mAb 22C10 and sensory organ accessory cells marked by anti-Prospero (αPros). Deletion 34E confers an even more severe PNS phenotype and removes or misplaces many more 22C10-positive and Pros-positive sensory organ cells in each hemisegment. The difference in the severity of the 19E and 34E mutant phenotypes may be due to the fact that the latter deletes a larger portion of the CG11798 coding region, including the codons for the four zinc fingers. As a control genotype, use was made of the precise excision (PE) derivative of the KG03781 transposon insertion. No PNS mutant phenotype was detected in homozygous PE embryos, demonstrating that the defects observed in the 19E and 34E deletion homozygotes do not result from a second-site mutation on the original KG03781 chromosome. The results of complementation tests led to the conclusion that CG11798 corresponds to the previously described charlatan (chn) locus (Reeves, 2005).

To generate loss-of-function alleles of CG3227, the P element transposon KG07404, inserted just upstream of the gene, was mobilized. Imprecise excision created two deletions, 23B and 23I. Homozygosity for either results in nearly complete lethality before adulthood. Mosaic adult flies carrying FLP/FRT-generated mutant clones exhibit a severe PNS defect in which most mechanosensory bristles within the clonal territory not only lack shaft structures but also bear multiple socket structures, suggestive of shaft-to-socket cell fate transformations. The major defects observed in sensory structures in both the larval and adult PNSs prompted giving CG3227 the new name insensitive (insv) (Reeves, 2005).

insv is predicted to encode a protein containing a conserved C-terminal domain of unknown function called DUF1172. DUF1172 was first recognized in the vertebrate NAC1 proteins, transcription factors that also contain BTB/POZ protein-protein interaction domains. Alignment of arthropod and vertebrate DUF1172s reveals that the domain is large (approximately 125 amino acids) and contains a highly conserved central region of alternating polar/charged residues and nonpolar residues. This is the first described loss-of-function phenotype for a gene encoding a DUF1172 domain protein (Reeves, 2005).

Several known or potential components of signaling pathways were uncovered in this analysis as exhibiting either PNC- or SOP-specific expression. These include genes encoding a putative G protein-coupled receptor (CG31660), a receptor tyrosine kinase (Ror), a regulator of G protein signaling (loco), and a modulator of Ets protein activity (edl). Earlier studies have linked both G protein function and Ras/MAPK signaling to the development of Drosophila sensory bristles, but much remains to be learned about their roles in this process. These findings suggest functions in PNS development for both known and previously uncharacterized signaling pathway components (Reeves, 2005).

Perhaps surprisingly, the data indicate the PNS-specific expression in imaginal discs of several genes predicted to encode metabolic enzymes, including a uridine phosphorylase (CG6330), a maleylacetoacetate isomerase (CG9363), and a malate dehydrogenase (Men). Exceptional metabolic requirements or signaling activities in developing sensory organs may underlie these observations (Reeves, 2005).

Loss-of-function analysis of two genes identified by the cell sorting/microarray/in situ hybridization approach, one expressed in PNCs (CG11798/chn) and one in SOPs (CG3227), confirms that they are indeed required for normal PNS development in Drosophila. Deletion mutations of CG3227 (insensitive) cause severe defects in the specification and differentiation of sensory organ cells in the adult PNS, as assayed in mosaic clones. Particularly prevalent is an apparent transformation of the shaft cell to the fate of its sister, the socket cell; this is the same phenotype conferred by loss-of-function mutations in N pathway antagonists such as Hairless and numb. The definition of a loss-of-function phenotype for a DUF1172 gene should prove valuable in investigating the in vivo function of this uncharacterized protein domain (Reeves, 2005).

Certain SOP-specific genes, exemplified by sens and phyl, are required for the execution of the SOP fate itself. insv, by contrast, represents a distinct class of SOP gene, required not for the fate of this cell, but for the specification and/or differentiation of one or more of its progeny. Thus, SOP-specific (or, more generally, precursor-specific) gene expression can serve the same function as maternal gene expression -- providing gene products essential to the development of descendants. It is anticipated that a number of the SOP genes identified will prove to act similarly (Reeves, 2005).

The function of proneural bHLH proteins in Drosophila PNS development is complex, since they not only activate in SOPs genes that promote the neural precursor cell fate (e.g., ac and sc themselves, sens and phyl); they also activate in non-SOPs genes involved in inhibiting this fate (e.g., genes of the Enhancer of split Complex). The nature of the cis-regulatory 'codes' (combinations of transcription factor binding sites) that distinguish the PNC versus SOP expression specificities is of particular interest. One code has been identified for the expression of N-responsive genes in the non-SOP cells of the PNC that consists of binding sites for the proneural proteins plus sites for the N-activated transcription factor Suppressor of Hairless (Su(H)). Importantly, none of the PNC modules identified in this study includes a conserved high-affinity Su(H) site, yet at least three of them do mediate direct transcriptional activation by the proneural proteins. Moreover, the expression driven by these new PNC modules includes the SOP, whereas the 'Su(H) plus proneural' code directs expression that excludes it. These findings indicate the existence of at least one novel code for PNC expression, and of a heretofore hypothetical class of genes -- ones that are directly regulated by the proneural proteins in PNCs/SOPs but are evidently not activated in response to N-mediated lateral inhibitory signaling, perhaps because they are not involved in the inhibitory process (Reeves, 2005).

The proneural genes were first identified by their function in the ectoderm in specifying neural cell fates, and they have been studied almost exclusively in that context in both vertebrates and invertebrates. However, it has become clear that these genes function as well in the other two germ layers. The Drosophila proneural gene lethal of scute (l'sc) is required to specify the fates of muscle progenitor cells in the embryonic mesoderm, and the same gene (and probably also sc) is required for the adult midgut precursor (AMP) cell fate in the embryonic endoderm. In both of these nonectodermal settings, a striking parallel with neurogenesis is seen in the manner in which proneural genes function in close association with the N pathway to select individual precursor cells. In the mesoderm, l'sc is deployed in 'pro-muscle clusters' from which single muscle progenitors emerge by N-mediated 'lateral inhibition'; in the endoderm, where proneural gene expression is initially uniform, AMPs are spaced apart from each other by N signaling in a manner very reminiscent of the spacing of microchaete bristles on the adult thorax. The mouse proneural protein Atoh1 (Math1) has been shown to be required for the specification of nonneural secretory cell precursors in the intestinal epithelium. Thus, proneural transcription factors are not dedicated specifiers of neural cell fates; rather, they appear to be very effective in first conferring on a group of cells the potential to adopt a particular cell fate and then promoting the selection of an individual committed progenitor from within that group. This suggests the existence of a 'core' set of genes that function downstream of the proneural proteins in all such contexts, with other sets of genes contributing to context-dependent (e.g., germ layer-specific) programs. Further investigation of the genes identified in this study should permit a test of this intriguing hypothesis (Reeves, 2005).

Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).

The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).

In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).

Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).


achaete: Biological Overview | Evolutionary Homologs | Transcriptional regulation | Protein Interactions and Post-transcriptional Regulation | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1995, 1996 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.