Myocyte enhancer factor 2


REGULATION

Promoter Structure

Mef2 is a MADS-box transcription factor required for muscle development in Drosophila. The bHLH transcription factor Twist directly regulates Mef2 expression in adult somatic muscle precursor cells via a 175-bp enhancer located 2245 bp upstream of the transcriptional start site. Within this element, a single evolutionarily conserved E box is essential for enhancer activity. Twist protein can bind to this E box to activate Mef2 transcription. Ectopic expression of twist results in ectopic activation of the wild-type 175-bp enhancer. Twist activation of Mef2 transcription via this enhancer is required for normal adult muscle development; reduction in Twist function results in phenotypes similar to those observed in Mef2 mutant adults. The requirement of Twist for adult muscle development is seen in defective development of dorsal longitudinal indirect flight muscles (DLMs). When Twist function is reduced during the larval stage, Mef2 is not expressed in the adult muscle precursor cells, resulting in abnormal patterning of the adult somatic muscles, most strikingly in the DLMs. Hypomorphic Mef2 mutant adults show very similar defects, indicating that this phenotype, resulting from loss of twist expression, likely occurs through a requirement to maintain normal Mef2 levels. The 175-bp enhancer is also active in the embryonic mesoderm, indicating that this enhancer functions at multiple times during development, and that its function is dependent on the same conserved E box. In embryos, a reduction in Twist function also strongly reduces Mef2 expression. Since there is only weak expression from the 175-bp enhancer early in embryogenesis, Twist alone cannot be responsible for activating Mef2 early on. It is likely that the genomic region governing the earliest expression of Mef2 is either outside this enhancer or overlapping it. The activity of the 175-bp enhancer increases during embryogenesis until stage 12, where it is expressed in segmentally repeating groups of cells corresponding to the unfused and undifferentiated myoblasts of the larval somatic muscles. At this stage, twist and Mef2 are coexpressed in these cells. These findings define a novel transcriptional pathway required for skeletal muscle development and identify Twist as an essential and direct regulator of Mef2 expression in the somatic mesoderm (Cripps, 1997).

The MADS-box transcription factor MEF2 is expressed specifically in developing cardiac, somatic, and visceral muscle cell lineages during Drosophila embryogenesis and is required for myoblast differentiation and muscle morphogenesis. To define the mechanisms that regulate Mef2 transcription, the Mef2 upstream region was analyzed for sequences sufficient to recapitulate the expression pattern of the gene in Drosophila embryos. Described here is a complex enhancer located 5.8 kb upstream of the Drosophila Mef2 gene that controls transcription in cardial cells of the dorsal vessel, a subset of somatic muscle founder cells, and the visceral muscle cells. The 237-bp cardial enhancer is located between -5907 to -5670 upstream of the Mef2 gene. The core of this enhancer contains two evolutionarily conserved binding sites for the homeodomain protein Tinman (Tin), expressed in developing cardiac, somatic, and visceral muscle lineages. Both Tin binding sites are required for enhancer activity in all three muscle cell lineages. Whereas the 285-bp enhancer core alone is sufficient for expression in cardiac cells, expression in somatic founder cells and visceral muscle is dependent on the core enhancer plus unique flanking sequences that include an evolutionarily conserved E box. These results reveal an essential role for Tin in the activation of Mef2 transcription in multiple myogenic lineages and demonstrate that transcriptional activity of Tin is dependent on combinatorial interactions with other factors unique to different muscle cell types (Cripps, 1999).

mef2 is expressed in a limited number of non-muscle cells types during development, including Kenyon cells present in the mushroom bodies of the Drosophila brain. This finding suggests a role for D-mef2 in neuron differentiation. To investigate mef2 expression in muscle and Kenyon cells, 26 kb of mef2 5'-flanking and intragenic DNA was examined for regulatory sequences controlling the expression of the gene. Separable enhancer sequences direct mef2 gene expression in the myogenic and neuronal cell lineages. The identification of these regulatory DNAs provides a starting point for the analysis of transcriptional regulators controlling the cell-specific expression of mef2, as well as a means to address the function of mef2 in Kenyon cell differentiation (Schulz, 1996).

Genetic analyses indicate that tinman and D-mef2 act at early and late steps, respectively, in the cardiac lineage. D-mef2 expression in the developing heart requires a novel upstream enhancer containing two Tinman binding sites, both of which are essential for enhancer function in cardiac muscle cells. The upstream enhancer is located 5.4 kb upstream of the structural gene for D-mef2. Transcriptional activity of this cardiac enhancer is dependent on tinman function, and ectopic Tinman expression activates the enhancer outside of the cardiac lineage. These results define the only known in vivo target for transcriptional activation by Tinman and demonstrate that D-mef2 lies directly downstream of tinman in the genetic cascade controlling heart formation in Drosophila. Higher up in the cascade, both DPP and Wingless expression in the ectoderm are required for tinman expression in the dorsal mesoderm (Gajewski, 1997).

The zinc finger proteins Pannier and GATA4 function as cardiogenic factors in Drosophila

The Drosophila mef2 gene encodes a MADS domain transcription factor required for the differentiation of cardiac, somatic, and visceral muscles during embryogenesis and the patterning of adult indirect flight muscles assembled during metamorphosis. A prerequisite for Mef-2 function in myogenesis is its precise expression in multiple cell types. Novel enhancers for Mef-2 transcription in cardiac and adult muscle precursor cells have been identified and their regulation by the Tinman and Twist myogenic factors have been demonstrated. However, these results suggest the existence of additional regulators and provide limited information on the specification of progenitor cells for different muscle lineages. The heart enhancer has been further characterized and shown to be part of a complex regulatory region controlling the activation and repression of Mef-2 transcription in several cell types. The presence of two Tinman binding sites is necessary but not sufficient for enhancer function; additional sequences are required for cardial cell expression. The mutation of a GATA sequence in the enhancer changes its specificity from cardial to pericardial cells. Also, the addition of flanking sequences to the heart enhancer results in the expression of Mef-2 in a new cell type: the founder cells for a subset of body wall muscles. Since tinman function is required for Mef-2 expression in both the cardial and founder cells, these results define a shared regulatory DNA that functions in distinct lineages due to the combinatorial activity of Tinman and other factors that work through adjacent sequences. The forced mesodermal expression of Twist causes a repression of the enhancer element in founder cells while allowing normal function in cardial cells. The analysis of Mef-2-lacZ fusion genes in mutant embryos reveals that the specification of the muscle precursor cells involves the wingless gene. Wg is required both in the formation of specific founder cells and in the specification of the progenitors of the cardial cells. Ectodermal cells must have a ventral identity for the formation of founder cells. These results demonstrate that the cell fate status of ectodermal cells adjacent to the domain of ventral founder cell specification is crucial for the proper formation of these cells. Mesodermal cell fate also depends on the activation of a receptor tyrosine kinase signaling pathway. Ectopic expression of an activated form of Ras1 throughout the mesoderm results in a substantial overproduction of the ventral founder cells as compared to control embryos. This signal may be transduced through the mesodermally-active EGF or FGF receptor tyrosine kinases (Gajewski, 1998).

The regulation of cardiac gene expression by GATA zinc finger transcription factors is well documented in vertebrates. However, genetic studies in mice have failed to demonstrate a function for these proteins in cardiomyocyte specification. In Drosophila, the existence of a cardiogenic GATA factor has been implicated through the analysis of a cardial cell enhancer of the muscle differentiation gene Mef2. The GATA gene pannier is expressed in the dorsal mesoderm and required for cardial cell formation while repressing a pericardial cell fate. Ectopic expression of Pannier results in cardial cell overproduction, while co-expression of Pannier and the homeodomain protein Tinman synergistically activate cardiac gene expression and induce cardial cells. The related GATA4 protein of mice likewise functions as a cardiogenic factor in Drosophila, demonstrating an evolutionarily conserved function between Pannier and GATA4 in heart development (Gajewski, 1999).

tinman gene function is required for heart development in Drosophila. The initial programming of the cardiac lineage occurs at a time when tin is broadly expressed in the dorsal mesoderm. A subset of the tin-expressing cells will become heart precursors, appearing in 11 clusters along the dorsalmost part of the mesoderm. The Mef2 enhancer-lacZ fusion gene marks heart progenitors at stage 11 and will eventually be expressed in four pairs of cardial cells per segment of the dorsal vessel. Thus, the tin expression domain is significantly larger than the territory of heart precursor specification, suggesting the involvement of additional factors in the formation of these cells. The Mef2 heart enhancer requires the presence of at least three elements for its activity, including two Tin binding sites and one GATA sequence. The GATA gene pnr is expressed in cells of the dorsal ectoderm around the time of heart cell specification. However, there is no report of pnr transcription in the mesoderm. To investigate this possibility, embryos were stained for PNR mRNA and embryo cross-sections were examined. At late stage 10, gene expression is observed in the dorsal ectoderm of the germband-extended embryo. PNR mRNA was detected in four clusters of cells located in the dorsalmost part of the mesoderm that corresponds to the cardiogenic region. Additionally, a pnr mesodermal enhancer has been identified that directs lacZ expression in the heart-forming region, but not in the overlying ectoderm. Therefore, pnr is expressed in the cardiogenic mesoderm where it could function in cardial cell specification and the regulation of Mef2 transcription (Gajewski, 1999).

The Mef2 IIA341 enhancer is active in both cardial and ventral muscle founder cells and a GATA site is needed for the cardial cell expression. To determine if pnr function is important for enhancer activity in either of these cell types, the expression of the enhancer-lacZ fusion was examined in pnr mutant embryos. A strong reduction of reporter gene expression is observed in the dorsal mesoderm of the mutants, while normal lacZ expression is detected in the ventral muscle precursors. These results suggest Pnr is a transcriptional regulator of the Mef2 heart enhancer, consistent with the observation that the protein can bind the essential GATA sequence in an electrophoretic mobility shift assay. Alternatively, or in addition, these results could be indicative of a requirement of pnr function for the formation of the Mef2-expressing cardial cells (Gajewski, 1999).

To determine if pnr function is essential for the specification of cardial cells, wild-type and mutant embryos were stained for Mef2 protein that serves as a marker for these cells. A distinct row of cardial cells is observed in a lateral view of normal embryos at stage 13 as they migrate dorsally along the overlying ectoderm during the process of dorsal vessel formation. In contrast, these cells are greatly diminished or completely absent from the dorsal mesoderm of mutant embryos. To assess the formation of the pericardial cells in the same genetic background, embryos were stained for Eve protein, which is a marker for a subset of these cells. Eleven clusters of Eve-positive cells, each comprising three or four cells, are detected in wild-type embryos at stage 12. In contrast, an overabundance of Eve-expressing pericardial cells is observed in the pnr embryos. These results suggest that pnr function is vital to the formation of cardial cells, while simultaneously playing an important role in controlling the production of at least one pericardial cell type. Thus, forced mesodermal expression of Pnr leads to an overproduction of cardial cells and the generation of supernumerary cardial cells occurs at the expense of Eve pericardial cells (Gajewski, 1999).

Certain NK-2 class homeodomain and GATA family proteins have been shown to physically interact in their cooperative activation of gene expression in cell culture systems. To test the possibility that Tin and GATA factors could functionally interact in an embryological context, the tin, pnr and mGATA4 genes were expressed independently or in combination in Drosophila embryos. When tin, pnr or mGATA4 are expressed alone in the twi enhancer-expressing cells, the Mef2 heart enhancer is activated ectopically in the cephalic (tin) or dorsal (pnr and mGATA4) mesoderm. Since Tin is a known regulator of the Mef2 enhancer, it could be activating the Mef2 sequence in the head region through its fortuitous interaction with a co-factor normally expressed in these cells. The results are striking when both Tin and either of the GATA factors are co-expressed under the control of the twi-Gal4 driver. A cardial cell marker is now activated in both the cephalic region and throughout the dorsal and ventral trunk mesoderm. Likewise, a strong ectopic expression of the Mef2 heart enhancer is detected in ventral midline cells of the developing CNS. The data point to a combinatorial interaction of Tin and the two GATA factors in the de novo activation of the cardial cell marker in both mesodermal and non-mesodermal cells. They also suggest these genetic combinations are inducing a cardial cell fate along the ventral midline of the CNS (Gajewski, 1999).

In summary, the discovery of early heart phenotypes in pnr mutant embryos, coupled with the demonstration of uniquely conserved cardiogenic abilities of Pnr and GATA4, provide novel evidence for the function of GATA family members in the specification of a heart cell type. In an embryological context, these proteins can work with the Tin homeodomain factor to program cells into an apparent cardial fate in both mesodermal and non-mesodermal cell types. This genetic combination appears to be essential, but not necessarily sufficient, for cellular commitment to the cardiac lineage as other factors may contribute to the specification process. Additional studies using the Drosophila cardiogenic assay should prove instrumental in revealing other key members of this genetic program (Gajewski, 1999).

Drosophila mef2 expression during mesoderm development is controlled by a complex array of cis-acting regulatory modules

The function of the Drosophila mef2 gene, a member of the MADS box supergene family of transcription factors, is critical for terminal differentiation of the three major muscle cell types: somatic, visceral, and cardiac. During embryogenesis, mef2 undergoes multiple phases of expression, characterized by an initial broad mesodermal expression, followed by restricted expression in the dorsal mesoderm, specific expression in muscle progenitors, and sustained expression in the differentiated musculatures. Evidence is presented that temporally and spatially specific mef2 expression is controlled by a complex array of cis-acting regulatory modules that are responsive to different genetic signals. Functional testing of approximately 12 kb of the 5' flanking region of the mef2 gene shows that the initial widespread mesodermal expression is achieved through a 280-bp twist-dependent enhancer. Subsequent dorsal mesoderm-restricted mef2 expression is mediated through a 460-bp dpp-responsive regulatory module, which involves the function of the Smad4 homolog Medea and contains several binding sites for Medea and Mad. Regulated mef2 expression in the caudal and trunk visceral mesoderm, which give rise to longitudinal and circular gut musculatures, respectively, is under the control of distinct enhancer elements. In addition, mef2 expression in the cardioblasts of the heart is dependent on at least two distinct enhancers, which are active at different periods during embryogenesis. Mef2 expressing cells are coincident with those expressing Tinman. Notably, both Mef2 and Tinman expression are in four of six cardioblasts that are present per hemisegment. The complete overlap between the two expression patterns suggests that the activity of this enhancer element could be dependent on tinman function or under similar regulatory controls as is tinman. The cardiac enhancer that functions at later stages also drives mef2 expression in the caudal visceral mesoderm as well as in the somatic mesoderm. Moreover, multiple regulatory elements are differentially activated for specific expression in presumptive muscle founders, prefusion myoblasts, and differentiated muscle fibers. Taken together, the presented data suggest that specific expression of the mef2 gene in myogenic lineages in the Drosophila embryo is the result of multiple genetic inputs that act in an additive manner on distinct enhancers in the 5' flanking region (Nguyen, 1999).

Pannier is a transcriptional target and partner of Tinman during Drosophila cardiogenesis

The D-mef2 gene is a direct transcriptional target of Tinman and Pannier in cardioblasts. A defined heart enhancer for the gene contains a pair of essential Tin binding sites and a required GATA element located in close proximity to one of the Tin recognition sequences. Coexpression of the two factors in CNS midline cells results in the ectopic activation of the D-mef2 enhancer normally expressed only in cardial cells. This result is compatible with the nuclear colocalization and physical interaction of Tin and Pnr in cultured cells and provides an embryological assay for identifying regions of the proteins that are essential for their functional synergism. Nine deleted or point mutant versions of Tin were tested in the synergism assay. Tin(N351Q) has a single amino acid change in the homeodomain and is unable to bind DNA. Coexpression of this mutant with wild-type Pnr fails to activate the D-mef2 enhancer. While a competent homeodomain must be present in Tin for synergism with Pnr, this region by itself is not sufficient as it fails in the coactivation assay. The TN domain is a highly conserved 12 amino acid region found in Tin and most other NK-2 class proteins. A 10-amino acid deletion was made within this domain to generate the Tin(1-35, 46-416) mutant, but this altered protein is still able to function combinatorially with Pnr. Thus, the TN domain is dispensable in the synergism assay (Gajewski, 2001).

A transcriptional activation domain has been mapped to the N-terminal 114 amino acids of Tin by using a cell transfection strategy. To determine whether this region is required for functional interaction with Pnr, the Tin(111-416) deletion was generated and tested. This truncated protein remained competent to synergize with Pnr in the activation of the D-mef2 enhancer, showing that the Tin transactivation domain is not required. However, larger N-terminal deletions result in Tin proteins that are functionally inactive. Specifically, removal of an additional 41 amino acids in Tin(152-416) has identified residues 111 to 151 as essential for Tin synergism with Pnr. The Tin(1-109, 192-416) variant that contains the transactivation domain and homeodomain, but lacks internal sequences including the required 41-amino acid region, is likewise nonfunctional in the D-mef2 enhancer coactivation assay. Therefore, these studies identify two distinct regions of Tin needed for its combinatorial function with Pnr, an internal segment of 41 amino acids adjacent to the transactivation domain and the conserved homeodomain (Gajewski, 2001).

The ectopic activation assay was used to determine those regions of Pnr that are essential for its functional synergism with Tin. Six deleted or point mutant forms were tested for enhancer activation in CNS midline cells. Pnr(1-457) represents a C-terminal truncation of the GATA factor that maintains zinc fingers 1 and 2, but deletes two putative amphipathic a helices. This C-terminal region has been shown to contain a transcriptional activation domain, and the inability of the truncated protein to synergize with Tin demonstrates an essential requirement of this Pnr sequence. Pnr(E168K) and Pnr(C190S) contain single amino acid changes in the N-terminal zinc finger that correspond to mutations found in dominant alleles pnr. These mutations may affect the formation of the first zinc finger and result in proteins that heterodimerize poorly with the Ush antagonist. However, two different dominant mutant Pnr proteins are able to synergize with Tin and direct D-mef2 expression in the CNS. In contrast, the mutation of a conserved cysteine residue in zinc finger 2 in Pnr(C247S) inactivates the protein in the synergism assay. This amino acid change is likely to influence the formation of the C-terminal zinc finger and identifies this region as an essential functional domain of Pnr in the coactivation of D-mef2. It is important to note that, although Pnr(1-457) and Pnr(C247S) fail to synergize with Tin, they are competent to bind the homeodomain protein in the GST pull-down assay. In combination, these results substantiate that intrinsic functional properties of Pannier are perturbed in the two mutant forms of the GATA factor (Gajewski, 2001).

An unexpected finding of this work is that, while the C-terminal transactivation domain of Pnr is required in the combinatorial assay, the N-terminal transactivation domain of Tin is not. One could envision a mechanism wherein the presence of the single domain provided by Pnr is sufficient for the activation properties of the heterodimeric complex. Additionally, it can not be ruled out that a second transactivation domain exists in Tin that was not revealed previously in cell transfection studies. Also of note is the nonrequirement of a proposed cardiogenic domain of Tin that maps to the N-terminus of the protein. Specifically, Tin(111- 416) is competent to work with Pnr in the cooperative activation of the D-mef2 heart enhancer, despite the absence of residues 1 through 42. Instead, an internal 41-amino acid region between the Tin transactivation domain and homeodomain has emerged as a vital sequence for functional interaction with Pnr. A repressor activity of Tin has been ascribed to residues 111 through 188, and it is plausible that, based on the biological assay being used, multiple functional characteristics may be uncovered within this region (Gajewski, 2001).

In the context of Tin's synergistic interaction with Pnr in regulating a defined cardiac enhancer, association of the two through this domain may prevent Pnr from interacting with other proteins such as Ush. At the same time, because Tin has the potential to act as a transcriptional repressor that recruits Groucho via this domain, the interaction of Tin and Pnr through the essential 111 to 151 subregion may be beneficial to Tin in its role as a transcriptional activator by eliminating its possible association with inhibitory cofactors. Preliminary results suggest the molecular interaction of Tin and Pnr may be due in part to the presence of this domain (Gajewski, 2001).

Drosophila Lame duck, a novel member of the Gli superfamily, acts as a key regulator of myogenesis by controlling fusion-competent myoblast development

Multiple enhancers mediate regulated Mef2 expression during embryogenesis. Among them is the enhancer I-E, which drives Mef2 expression in fusion-competent myoblasts. The phenotype of lame duck (lmd) mutant embryos suggests that lmd may be activating Mef2 in fusion-competent myoblasts via enhancer I-E. Wild-type and lmd mutant embryos, carrying the enhancer I-E construct, were double-labeled for Mef2 and lacZ expression. In the wild-type background, lacZ expression is detected in a large number of Mef2-positive somatic myoblasts. By contrast, there is a complete absence of lacZ expression in lmd mutant background. Activation of two other somatic muscle enhancers, II-E and III-F, which drive Mef2 expression in founder cells and muscle fibers, respectively, is not affected in mutant embryos (Duan, 2001).

Functional dissection of enhancer I-E has also identified a 170 bp subfragment, I-ED5, which is still active in somatic myoblasts. Further analysis with deletion reporter gene constructs, each of which contain a small internal deletion within enhancer I-ED5, has defined the essential [C/D]* region. Notably, robust lacZ expression levels are obtained with I-ED5, while a nearly complete absence of lacZ expression is observed with I-ED5-DelD. lacZ expression is slightly reduced with the overlapping I-ED5-DelC construct. Moreover, a multimerized construct consisting of five copies of the [C/D]* region can direct lacZ expression comparably to I-ED5. Thus, the sequences within [C/D]* are both necessary and sufficient to direct expression in fusion-competent myoblasts (Duan, 2001).

To identify factors that bind specifically to [C/D]*, a yeast one-hybrid screen was indertaken, using the multimerized [C/D]* region as target. From this molecular screen, 37 His-positive/lacZ-positive cDNA fusion clones were obtained that encode proteins which bind the [C/D]* region. Twelve of the 37 clones encode truncated versions of the Lmd protein. These can be grouped into four classes based upon the position of their N-terminal end. The encoded polypeptides in all 12 clones include the Zn-finger domain. To ascertain that the Zn-finger domain is responsible for specific target recognition, constructs that encode defined portions of the protein were tested in yeast cells. Indeed, constructs that include the Zn-finger domain are capable of activating robust levels of His and lacZ expression whereas those that span the N- or C-terminal region of Lmd, flanking the Zn-finger domain, are not able to activate His expression (Duan, 2001).

Standard DNA-binding assays were performed to confirm that Lmd can bind specifically to enhancer I-ED5. In the presence of in vitro-translated Lmd protein, a slower-migrating protein-DNA complex is observed with the gamma32P-labeled I-ED5 fragment. Formation of this complex is specifically competed by an excess amount of cold I-ED5 DNA fragment but not by cold III-F7, an unrelated DNA fragment of similar length (Duan, 2001).

Sequence analysis of enhancer I-ED5 did not reveal any sequence elements that conform to the canonical binding site for Ci/Gli proteins, indicating that Lmd recognizes a novel DNA sequence motif. To attempt to define the binding site, four other mutated I-ED5 derivatives (I-ED5-mt1, I-ED5-mt2, I-ED5-mt3, I-ED5-mt4), each of which contains a 10 bp block of substitutions were tested in vivo. Normal levels of activation of reporter gene expression in somatic myoblasts are observed with I-ED5-mt3 and I-ED5-mt4. By contrast, dramatically reduced levels of reporter gene expression are observed with I-ED5-mt1 and I-ED5-mt2. These results, together with additional in vitro binding and competition data, indicate that the functional binding site of Lmd is within the sequence TTACCTACGCAGCGTTTACA (Duan, 2001).

Transcription of Myocyte enhancer factor-2 in adult Drosophila myoblasts is induced by the steroid hormone ecdysone

The steroid hormone 20-hydroxyecdysone (ecdysone) activates a relatively small number of immediate-early genes during Drosophila pupal development, yet is able to orchestrate distinct differentiation events in a wide variety of tissues. This study demonstrates that expression of the muscle differentiation gene Myocyte enhancer factor-2 (Mef2) is normally delayed in twist-expressing adult myoblasts until the end of the third larval instar. The late up-regulation of Mef2 transcription in larval myoblasts is an ecdysone-dependent event that acts upon an identified Mef2 enhancer, and enhancer sequences have been identified required for up-regulation. Evidence is presented that the ecdysone-induced Broad Complex of zinc finger transcription factor genes is required for full activation of the myogenic program in these cells. Since forced early expression of Mef2 in adult myoblasts leads to premature muscle differentiation, these results explain how and why the adult muscle differentiation program is attenuated prior to pupal development. A mechanism is proposed for the initiation of adult myogenesis whereby twist expression in myoblasts provides a cellular context upon which an extrinsic signal builds to control muscle-specific differentiation events, and the general relevance of this model for gene regulation in animals is discussed (Lovato, 2005).

Since a 175-bp Mef2 enhancer recapitulates the pattern of gene expression seen for Mef2 during larval development, attempts were made to identify the factors that might be interacting with this sequence. No consensus binding sites for the ecdysone receptor were found, nor for the transcription factors encoded by the immediate-early gene E74. Therefore, to identify cis-acting elements involved in enhancer activation, deletion analysis of the 175-bp enhancer was performed. Deletion of 20 bp from the 5′ end of the enhancer to generate a 156-bp Mef2 enhancer has a dramatic impact upon transgene expression in adult myoblasts. Lines carrying the wild-type enhancer showed strong β-galactosidase activity in the adult myoblasts, whereas the 156-bp enhancer was barely active in all lines tested. This result indicates that the 5′ portion of the enhancer is essential for its activity in adult myoblasts and identifies this region as a possible target for ecdysone-dependent gene regulation (Lovato, 2005).

The 175-bp enhancer is also active at the embryonic stage in skeletal muscle precursors; therefore, the embryonic activities of the 175-bp and 156-bp enhancers were compared. Interestingly, both enhancers are strongly active in embryos, although there was a slightly reduced activity of the 5′ deleted enhancer compared to the full-length. This observation suggested that the 20 bp deleted from the 175-bp enhancer to generate the 156-bp construct contains specific response elements for activation of Mef2 in adult myoblasts, rather than a general factor necessary for enhancer activation in all contexts (Lovato, 2005).

Within the 20 bp of DNA deleted in the above experiment were sequences that weakly resembled the binding sites for the zinc finger transcription factors of the BR-C. Since the BR-C has been shown to mediate gene activation in response to ecdysone, the BR-C gene products were considered to be excellent candidates for direct regulation of Mef2. Therefore, the accumulation of MEF2 was studied in the imaginal discs of control wild-type siblings and brnpr-3 mutants which lack BR-C function. There was a significant, but not complete, reduction in the level of MEF2 in mutants. However, there were no effects upon Mef2 expression of mutations affecting any of the Z1, Z2, or Z3 BR-C isoforms individually, perhaps due to the documented functional redundancy between many of these products (Lovato, 2005).

These results indicate that although the 5′ enhancer sequence is required for enhancer activity in myoblasts, it is not likely to be a direct target of proteins of the BR-C. This is because removal of the 5′ sequence ablates enhancer activity almost completely, whereas removal of BR-C function has an incomplete effect upon Mef2 expression. In further support of this conclusion, although antibody stains have indicated that isoforms Z1, Z2, and Z4 are detected in myoblasts of larvae and young pupae, it has not been possible to demonstrate binding of any of these three factors to the Mef2 enhancer sequence using in vitro DNA binding assays. It is therefore concluded that while the BR-C influences ecdysone-dependent Mef2 expression, it does so indirectly and not through direct binding to the 175-bp enhancer (Lovato, 2005).

The steroid hormone ecdysone functions broadly in Drosophila to control molting and metamorphosis during the life cycle, and much research has concentrated upon the mechanisms of its action. Ecdysone is known to induce a number of immediate-early genes, which mediate transcriptional responses to hormone levels. However, since ecdysone is a systemic signal, and since many of the immediate-early genes are expressed in multiple tissues, a central challenge in the field has been to understand how widespread activation of immediate-early genes can have specific effects in different target tissues. This study shows that temporal expression of Mef2 in adult myoblasts occurs as a result of the ecdysone pathway. The finding that Mef2 expression in adult myoblasts is low prior to the onset of pupariation is consistent with the known role of Mef2 in muscle differentiation. Since the adult myoblasts do not initiate differentiation until after puparium formation, this might account for why Mef2 expression is absent in young myoblasts. In fact, early expression of Mef2 in adult myoblasts causes premature differentiation of these cells. While the possibility cannot be excluded that this premature differentiation results from the demonstrated ability of high levels of Drosophila Mef2 to inappropriately induce myogenesis, this seems unlikely given the profound myogenesis which was observed in the imaginal discs (Lovato, 2005).

Sustained expression of twist in the adult myoblasts prevents normal muscle differentiation, and Twist levels must decline during the pupal stage for normal adult muscle development to occur. Forced expression of Mef2 in the discs can induce muscle differentiation; however, it is not known if such Mef2 expression attenuates Twist levels, or if the myogenesis observed occurs concurrently with twist expression (Lovato, 2005).

Since the BR-C is expressed in many tissues late during larval development, the myoblast-specific activation of Mef2 must also depend upon an additional factor(s). This factor is likely to be the myoblast marker Twist, which is expressed in the adult myoblasts throughout the larval stage and which has been shown to be an essential activator of Mef2 transcription. Furthermore, the temporal and tissue-specific signals are integrated at the genome level via the 175-bp Mef2 enhancer (Lovato, 2005).

It is therefore proposed that systemic signals such as ecdysone and immediate-early gene activation have specific effects in distinct tissues via interpretation of the systemic signals by a tissue-specific factor: Twist in the case of the adult myoblasts. These findings are analogous to the activation of Fbp1 in fat body cells at the late third larval instar. Fbp1 activation results from the combined effects of ecdysone/EcR complex and the tissue-specific factor dGATAb. The current findings support this model of the specificity of hormone action and extend them to apply to the formation of the adult musculature. The interpretation of systemic hormone signals by cell-autonomous factors is a powerful mechanism to control gene expression. It has recently been shown that gut epithelial cell-specific response to the nuclear hormone receptor PPAR-gamma requires the tissue-specific co-activator Hic-1 (Lovato, 2005).

The data also provide a novel mechanism for regulating Mef2 expression in the animal. This is the first demonstration that Mef2 levels in vivo can be regulated by hormone action, and this may be a broadly relevant paradigm. Indeed, it has been shown that in cultured mammalian myotubes, mef2 mRNAs are induced by treatment with nonapeptide Arg-8 vasopressin. This mechanism is also similar to that demonstrated in vertebrates where Mef2 and thyroid hormone receptor interact with each other and synergistically activate the alpha cardiac myosin heavy-chain gene. These results, and the the results presented in this study, support an important role for hormones in impacting muscle development and underline the utility of the Drosophila system for defining these important mechanisms (Lovato, 2005).

To date, it has not been possible to identify how the effects of ecdysone are directly mediated on the Mef2 gene. There is a requirement for the function of the BR-C, and involvement of this gene complex is attractive given both the expression of BR-C isoforms in the developing adult muscles and a demonstrated role of the Z1 and Z4 isoforms in controlling indirect flight muscle development. Several studies have identified complex cross-regulatory interactions among ecdysone immediate-early genes. This complexity may explain the partial requirement of the BR-C for Mef2 activation and suggests that the direct regulation of Mef2 in adult myoblasts might be complex. Nevertheless, these studies define how the onset of adult myogenesis is orchestrated and also define the Mef2 enhancer as an ecdysone-responsive element. Identification of the factors that interact with the Mef2 enhancer will ultimately provide important insight into the mechanisms of hormone-induced gene regulation and differentiation (Lovato, 2005).

Transcriptional Regulation

Expression of Mef2 is dependent on the mesodermal determinants twist and snail but independent of the homeobox-containing gene tinman, required for visceral muscle and heart development. Mef2 expression precedes that of nautilus, the MyoD homolog, and in contrast to nautilus, Mef2 appears to be expressed in all somatic and visceral muscle cell precursors. Its temporal and spatial expression patterns suggest that Mef2 may play an important role in commitment of mesoderm to myogenic lineages (Lilly, 1994).

Mef-2 is a downstream target for twist its early expression pattern modulates as the mesoderm organizes into cell groupings with distinct fates. DMef2 is also expressed in both the segregating primordia and the differentiated cells of the somatic, visceral and heart musculature. It is the only known gene expressed throughout differentiation in these three main types of muscle (Taylor, 1995).

Drosophila zfh-1 is downregulated in embryos prior to myogenesis. Embryos with zfh-1 loss-of-function mutation show alterations in the number and position of embryonic somatic muscles, suggesting that zfh-1 could have a regulatory role in myogenesis. Zfh-1 is a transcription factor that binds E box sequences and acts as an active transcriptional repressor. When zfh-1 expression is maintained in the embryo beyond its normal temporal pattern of downregulation, the differentiation of somatic but not visceral muscle is blocked. One potential target of zfh-1 in somatic myogenesis could be the myogenic factor mef2. mef2 is known to be regulated by the transcription factor twist, and Zfh-1 is shown to bind to sites in the mef2 upstream regulatory region and inhibit twist transcriptional activation. Even though there is little sequence similarity in the repressor domains of vertebrate ZEB and zfh-1, evidence is presented that Zfh-1 is the functional homolog of ZEB and that the role of these proteins in myogenesis is conserved from Drosophila to mammals (Postigo, 1999).

Among all zfh family members, Zfh-1 and ZEB share the most sequence similarity in the zinc fingers and homeodomain. The zinc fingers of ZEB bind to a subset of E boxes (and E box-like sequences), with highest affinity for the CACCTG site. The similarity in the zinc fingers of ZEB and Zfh-1 suggests that these motifs in Zfh-1 might also be DNA binding domains. Therefore, whether Zfh-1 can bind to the CACCTG site was tested. Both the N- and C-terminal zinc fingers of recombinant Zfh-1 bind to the site in gel retardation assays. This binding is abolished when the site is mutated. Furthermore, as observed for ZEB, Zfh-1 binds to only a subset of E box sequences; it fails to bind the CATTTG E box sequence. Interestingly, the Zfh-1 binding site also matches the high-affinity site recognized by the zinc finger protein Snail, and Zfh-1 binds quite efficiently to various Snail binding sites in the single-minded gene (Zfh-1 binds better than Snail to Sna5ab, the highest-affinity site). These results demonstrate for the first time that Zfh-1 is a DNA binding protein and that it shows DNA binding specificity similar to that of ZEB and Snail (Postigo, 1999).

Both ZEB and snail are transcriptional repressors. To determine whether Zfh-1 has transcriptional activity, a reporter containing the CACCTG binding site 30 bp upstream of an enhancer was transfected in Drosophila Schneider L2 cells. These cells do not express endogenous Zfh-1 or Snail, and thus the presence of the E box site had no effect on promoter activity. However, cotransfection of a Zfh-1 or Snail expression vector results in repression. A similar level of repression by Zfh-1 was observed when the CACCTG sequence was moved 300 bp upstream of the enhancer, demonstrating that Zfh-1 (and ZEB) can repress at long range. In contrast, Snail failed to repress transcription at this long range. Expression of DNA-binding Zfh-1 (DB-Zfh-1), containing only the DNA binding domain of Zfh-1 but not the repression domain, did not repress, suggesting that the protein has separate DNA binding and repressor domains. These results demonstrate that Zfh-1, like Snail and ZEB, functions as an active transcriptional repressor when it binds to E box sequences (Postigo, 1999).

Because of the overlap in DNA binding specificity, Zfh-1 could target the same genes as Snail. One such Snail-regulated gene is single-minded, which is normally restricted to midline cells and a subset of somatic muscle precursor cells. Snail functions to block ectopic expression of single-minded and other nonmesodermal genes in the mesoderm. Zfh-1 not only binds to the Snail sites on the single-minded promoter but also represses the activity of the single-minded promoter in transfection assays in Schneider cells even more efficiently than Snail, consistent with the finding that sites from the single-minded promoter bind to Zfh-1 more efficiently than Snail (Postigo, 1999).

However, Snail also binds other sequences that are not shared with Zfh-1. In the rhomboid promoter, Snail sites are important to block the expression of rhomboid in the ventral regions during embryogenesis. Contrary to what was found for the Snail sites in the single-minded promoter, Zfh-1 showed little or no binding to the four Snail sites of the rhomboid promoter. And, accordingly, Zfh-1 fails to repress the transcriptional activity of the rhomboid promoter. These results demonstrate that Zfh-1 can interact with only a subset of Snail sites (Postigo, 1999).

It is important to point out that Snail is required for zfh-1 expression and that Zfh-1 persists after Snail diminishes. Thus, the two proteins appear to be temporally distinguishable in the developing embryo. This suggests that the two proteins may regulate separate or perhaps partially overlapping sets of genes, albeit at distinct developmental stages or in distinct tissues (Postigo, 1999).

ZEB can also repress transcription in Drosophila cells. Whether Zfh-1 can repress transcription in mammalian cells was investigated. A reporter construct containing a CACCTG binding site upstream of an enhancer was used. Coexpression of DB-Zfh-1 (or DB-ZEB) does not repress the activity of the enhancer. However, transfection of an expression vector for either full-length Zfh-1 (or full-length ZEB) or DB-Zfh-1-RD-ZEB (RD-ZEB refers to the repressive domain of ZEB) does repress transcription through the binding site. Together, these results suggest that Zfh-1 also recognizes E box binding sites in mammalian cells and represses transcription when bound to these sites (Postigo, 1999).

To determine whether Zfh-1 contains an independent repressor domain that can function when fused to a heterologous DNA binding domain, a construct was created where the region of Zfh-1 between the zinc finger domains (corresponding to the repressor domain in ZEB) was fused to the DNA binding domain of the yeast protein Gal4. Gal4-zfh-1 was tested in transfection assays with reporter plasmids containing Gal4 binding sites cloned upstream of various enhancers. Gal4-zfh-1 efficiently represses the SV40 enhancer and thymidine kinase (TK) promoter, indicating that Zfh-1 indeed contains an independent repressor domain located between the zinc finger regions (Postigo, 1999).

The overall sequence similarity between Zfh-1 and ZEB in their repressor domains is very low. Nevertheless, when the ability of Zfh-1 to repress the activity of a number of transcription factors was tested, it was found that Zfh-1 and ZEB have similar transcription factor specificities in transfection assays. Zfh-1 is expressed in other tissues in addition to muscle (heart, gonadal cells, central nervous system), and the ability of Zfh-1 to repress various transcription factors may have a role in the regulation of gene expression in these tissues. These results indicate that Zfh-1 is an active transcriptional repressor and that the repressor domains in Zfh-1 and ZEB may be functionally similar (Postigo, 1999).

Given the similarity between ZEB and Zfh-1 in DNA binding specificity and repressor activity, whether Zfh-1 could substitute for ZEB and block muscle differentiation in mammalian cells was tested. Transfection of myoD is sufficient to drive cells down a myogenic pathway by inducing a cascade of transcription factors including members of the myocyte enhancer family (e.g., mef2) that collaborate with myoD to amplify the muscle differentiation program. Overexpression of ZEB blocks this myogenic conversion. A construct encoding full-length Zfh-1 also efficiently blocks myogenic differentiation. As with ZEB, DB-Zfh-1 alone does not affect myogenic differentiation, even though DB-Zfh-1 binds DNA more efficiently than the full-length protein and efficiently displaces wild-type ZEB from the promoter. Therefore, Zfh-1 and ZEB do not block myogenic differentiation simply by displacing MRF proteins from the promoter; instead, their repressor domains are required for this activity. Accordingly, fusion proteins containing DB-Zfh-1 fused to RD-ZEB, DB-ZEB fused to RD-Zfh-1, or DB-Zfh-1 fused to RD-Zfh-1 also block myotube formation. These results indicate that the RD-Zfh-1 can block myogenesis in mammalian cells, suggesting that the function of zfh-1 and ZEB may be conserved from Drosophila to mammals (Postigo, 1999).

The transfection assays in Drosophila and mammalian cells have suggested that Zfh-1 might play a negative role during muscle development in the Drosophila embryo. Loss of Zfh-1 function does not cause drastic alterations to muscle development. In zfh-1 mutant embryos, somatic and visceral muscles form and differentiate, but there are subtle defects such as loss, misplacement, and disorganization of some muscles. These results demonstrate that Zfh-1 is not required for muscle differentiation per se, but they are consistent with a regulatory role for Zfh-1 in the process. From these studies, there was no indication about its mechanism of action and whether Zfh-1 might act as a positive or negative regulator of myogenesis. Moreover, studies on the role of ZEB in muscle differentiation had been confined to in vitro assays. Therefore, the role of Zfh-1 during myogenesis in vivo was investigated (Postigo, 1999).

Zfh-1 is downregulated prior to somatic muscle differentiation, raising the possibility that this downregulation is essential for the onset of myogenesis. While the loss-of-function phenotype appeared mild in muscle, it was of interest to see whether maintenance of Zfh-1 expression beyond the time that endogenous Zfh-1 diminishes might have a more drastic phenotype (e.g., a blocking of myogenesis as occurs in cultured cells (Postigo, 1999).

Zfh-1 is initially expressed throughout the mesoderm, but after gastrulation it is downregulated in muscle precursors as well as most other mesodermal derivatives. Expression of Zfh-1 was maintained throughout embryogenesis by expressing the protein under control of the heat shock protein 70 promoter; muscle development was assayed by following MHC expression. First, the embryos were heat shocked at stage 9-10, which corresponds to the time that Zfh-1 is normally downregulated and is prior to MHC expression in muscle. Zfh-1 expression following heat shock was confirmed by immunohistochemistry. At stage 14, a loss of MHC expression in somatic muscles was observed; however, surprisingly MHC expression in visceral muscle appeared relatively normal. In embryos that completed embryogenesis, milder but still clear defects in MHC expression were observed in somatic muscles (Postigo, 1999).

The embryos were also heat shocked to induce Zfh-1 expression after the onset of MHC expression (stage 12-13). In this case, little, if any, defect in MHC expression was observed in somatic muscles, indicating that once the muscles cells begin to express MHC, they are refractory to the negative effects of Zfh-1 expression. Taken together, these results are consistent with a model in which extinction of Zfh-1 expression in embryonic muscle precursors is necessary to allow muscle differentiation to proceed (Postigo, 1999).

It was noticed that maintaining Zfh-1 expression results in a muscle differentiation phenotype similar to that seen with the loss of Mef2 (where there is a block in MHC expression in somatic muscle with less effect on visceral muscle). This phenotype is also similar to that observed when the transcriptional activator Twist is disrupted after gastrulation via a temperature-sensitive mutant. Twist is required for activation of the mef2 gene in somatic muscle, and these observations raised the possibility that Zfh-1 may act to inhibit somatic myogenesis by blocking the expression of mef2 (Postigo, 1999).

The pattern of mef2 expression is complex and dynamic in the embryo, but mef2 expression increases in muscle precursors as they appear in the embryo. mef2 is first evident at the late cellular blastoderm stage in mesoderm primordia and continues to be expressed throughout the mesoderm during mesoderm invagination. At mid-germband extension, mef2 expression is reduced in the ventrolateral mesoderm but maintained in the dorsal region. During germband retraction, expression increases in visceral mesoderm and in somatic muscle precursors. This is around the time when Zfh-1 is downregulated. mef2 expression then increases dramatically in all somatic mesoderm, and throughout germband retraction expression continues to be high in somatic muscles (Postigo, 1999).

Zfh-1 is also expressed in a dynamic fashion in the mesoderm, and it is downregulated in muscle precursors as they began to appear. When embryos were double immunostained for Mef2 and Zfh-1, it was found that the expression of Zfh-1 and that of Mef2 were mutually exclusive (Postigo, 1999).

Taken together, the above results suggested that Zfh-1 might have some role in controlling the pattern of mef2 expression in muscle precursors. To test this possibility, the pattern of mef2 expression was analyzed in embryos where Zfh-1 expression is maintained by using the heat shock construct. Wild-type embryos exhibited a normal Mef2 pattern following heat shock at all stages examined. However, heat-shocked-expressing Zfh-1 embryos showed a range of defects. (1) In the most severe cases, mef2 was highly disrupted. These embryos failed to complete germband retraction and appear not to have developed far past this stage. (2) Other embryos showed a fairly normal morphology and completed embryogenesis. In these embryos, there was still clear disruption of mef2 in somatic muscle and a reduction in the number of Mef2-positive cells (stage 12). These results suggest that the downregulation of zfh-1, associated with the onset of somatic myogenesis, is required for expression of mef2 (Postigo, 1999).

mef2 expression has been shown to depend on the existence of an enhancer element 2.3 kb upstream of the mef2 gene that is directly activated by Twist. Examination of the mef2 promoter sequence has revealed multiple Zfh-1 sites throughout the sequence that bind Zfh-1 in gel retardation assays. Do the Zfh-1 sites in the mef2 promoter block transcriptional activation by Twist? In transfection assays, it has been shown that Zfh-1 blocks transcriptional activation by Twist, and it is proposed that Zfh-1 blocks twist-mediated activation of the mef2 gene in muscle precursors until Zfh-1 expression diminishes (Postigo, 1999).

U-shaped protein domains required for repression of cardiac gene expression in Drosophila

U-shaped is a zinc finger protein that functions predominantly as a negative transcriptional regulator of cell fate determination during Drosophila development. In the early stages of dorsal vessel formation, the protein acts to control cardioblast specification, working as a negative attenuator of the cardiogenic GATA factor Pannier. Pannier and the homeodomain protein Tinman normally work together to specify heart cells and activate cardioblast gene expression. One target of this positive regulation is a heart enhancer of the Drosophila mef2 gene and U-shaped has been shown to antagonize enhancer activation by Pannier and Tinman. Protein domains of U-shaped required for its repression of cardioblast gene expression were mapped. Such studies showed GATA factor interacting zinc fingers of U-shaped are required for enhancer repression, as well as three small motifs that are likely needed for co-factor binding and/or protein modification. These analyses have also allowed for the definition of a 253 amino acid interval of U-shaped that is essential for its nuclear localization. Together, these findings provide molecular insights into the function of U-shaped as a negative regulator of heart development in Drosophila (Tokusumi, 2007).

Through the use of an established assay to monitor Pannier-dependent cardioblast gene activity, and the generation and analysis of 20 different versions of the U-shaped protein, six U-shaped domains required for its repression of mef2 gene expression were identified. Three previously identified GATA-interacting zinc fingers of U-shaped are critical for this inhibitory property, which likely reflects the necessity of multiple zinc fingers forming a strong and stable interaction with the Pannier GATA factor. Whether Pannier-U-shaped complex formation interferes with the physical interaction of Pannier and Tinman in the synergistic activation of D-mef2 target sequences remains to be determined (Tokusumi, 2007).

U-shaped may also directly antagonize Pannier function as has been shown in the process of sensory bristle formation. Heterodimerization of U-shaped with Pannier converts the GATA transcriptional activator into a transcriptional repressor, an event that leads to the non-activation of target genes such as ac, sc, and wg in the dorsal notum of the wing disc. It is noteworthy that the results demonstrated the requirement of a binding site for the CtBP transcriptional co-repressor protein. In the context of the cardiogenic mesoderm, the combination of Pannier, U-shaped, and CtBP may prevent mesodermal cells from initiating gene expression programs needed for the specification of the cardioblast fate. In contrast, the combination of Pannier, Dorsocross, and Tinman is known to activate a regulatory network programming heart cell specification and cardioblast differentiation. Additional studies will be needed to elucidate the potential role of CtBP as an antagonist of cardiac gene expression and heart development. If U-shaped-CtBP interaction plays a crucial inhibitory role, then one would predict comparable dorsal vessel phenotypes for CtBP and U-shaped in loss- and gain-of-function genetic backgrounds (Tokusumi, 2007).

Finally, these studies have defined a 253 amino acid region required for nuclear localization of U-shaped. Within this interval, two highly basic amino acid sequences have been defined as being essential for U-shaped ability to inhibit Pannier-mediated cardiac gene expression. Perhaps, these motifs are required to facilitate the binding and stable interaction of co-repressor proteins with U-shaped. Another possibility is that these sequences serve as sites for post-translational modification, such as acetylation and/or methylation. Selective protein modification(s) may be a requisite for U-shaped to act as a negative modulator of Pannier transcription factor function during cardiogenesis in Drosophila (Tokusumi, 2007).

The Him gene reveals a balance of inputs controlling muscle differentiation in Drosophila

Tissue development requires the controlled regulation of cell-differentiation programs. In muscle, the Mef2 transcription factor binds to and activates the expression of many genes and has a major positive role in the orchestration of differentiation. However, little is known about how Mef2 activity is regulated in vivo during development. This study characterized a gene, Holes in muscle (Him; Flybase name meso18E), which is part of this control in Drosophila. Him expression rapidly declines as embryonic muscle differentiates, and consistent with this, Him overexpression inhibits muscle differentiation. This inhibitory effect is suppressed by mef2, implicating Him in the mef2 pathway. Him downregulates the transcriptional activity of Mef2 in both cell culture and in vivo. Furthermore, Him protein binds Groucho, a conserved, transcriptional corepressor, through a WRPW motif and requires this motif and groucho function to inhibit both muscle differentiation and Mef2 activity during development. Together, these results identify a mechanism that can inhibit muscle differentiation in vivo. It is concluded that a balance of positive and negative inputs, including Mef2, Him, and Groucho, controls muscle differentiation during Drosophila development and suggest that one outcome is to hold developing muscle cells in a state with differentiation genes poised to be expressed (Liotta, 2007).

Analysis of mef2 function during Drosophila muscle development has shown that a major aspect of its role is in the differentiation pathway downstream of the genes that specify muscle. However, Mef2 protein expression precedes muscle differentiation. It is first expressed in the mesoderm at gastrulation, approximately 3 hr after egg laying (AEL). This is approximately 7 hr before the activation at stage 13 (10 hr AEL) of the expression of many known Mef2 target genes, e.g., Mhc, Mlc1, and wupA. This delay implies that the activity of Mef2 is restrained and that other regulatory proteins operate in the control of muscle differentiation during this period. However, little is known about these other proteins nor about how the gene expression at stage 13 is coordinated. This study addresses these unanswered questions through an analysis of the Him gene in muscle differentiation. Him was described in a computational screen, and it was isolated separately in an expression screen, but its function has not been analyzed. This study shows that Him is an inhibitor of Mef2 activity and muscle differentiation, and on the basis of this phenotype, it was called Holes in muscle (Him) (Liotta, 2007).

Him has a striking, transient pattern of expression during Drosophila embryogenesis. It is first expressed broadly in the mesoderm during stage 9. This expression then refines, and at stage 12 it is specifically expressed in the precursors of the somatic musculature and of the heart. Him expression then rapidly declines in the somatic mesoderm, such that in 90 min it has disappeared from the differentiating somatic muscle (stage 13). However, it persists in the adult muscle precursors (AMPs), which are set aside in the somatic mesoderm and which remain undifferentiated at this stage, and also in the developing heart. Him protein expression closely resembles that of Him RNA. The disappearance of Him coincides with the expression of Myosin, a classic marker of muscle differentiation. Double labeling with a Him-GFP fusion gene demonstrates that Myosin is expressed only after Him disappears from the developing muscle. The expression of Him in the progenitors of the somatic muscle and its disappearance from differentiating muscle are consistent with a role for Him as an inhibitor of muscle differentiation (Liotta, 2007).

To test whether Him is an inhibitor of muscle differentiation, it was overexpressed in the developing mesoderm by using the Gal4/UAS system. This induced a dramatic reduction in the number of Myosin-expressing cells and thereby produced large gaps or holes in the musculature. It was then asked when in muscle development Him has this effect. Up to stage 13 (10 hr AEL) muscle development proceeds similarly to that of the wild-type. At this stage, developing muscles are seen in the wild-type as small syncytia, which express founder cell markers, e.g., Kruppel, and Mef2, surrounded by Mef2-expressing myoblasts. When Him is overexpressed, the expression of these markers is similar. Subsequently, immunostaining for Mef2 reveals disrupted differentiation at stage 15, and there is increased cell death at stage 16. Together, these findings demonstrate that Him inhibits the differentiation phase, of muscle development, that occurs from stage 13 onward and that produces the morphologically distinct muscles of the functional musculature by the end of embryogenesis. To explore this function further, Him was knocked down by using RNAi from a splice-activated UAS hairpin vector. Although the musculature develops similarly to that of the wild-type, in the knockdown there is impaired muscle differentiation as revealed by disrupted muscle morphology (Liotta, 2007).

Overexpression of Him during muscle development phenocopies the mef2113 hypomorphic allele. Development of the musculature is inhibited similarly, and many of the residual muscles have a similar, abnormal morphology. This suggests that the two genes function in a common pathway. Consistent with this, Him and Mef2 are coexpressed in somatic muscle progenitors at stage 12, prior to the activation of muscle-differentiation markers such as Myosin. To test whether Him and mef2 genetically interact, both genes were overexpressed together. Strikingly, the inhibition of muscle differentiation caused by Him is rescued toward the wild-type by mef2. Furthermore, overexpression of Him alone induces lethality, and under the conditions of this experiment only 18% survive. This lethality is suppressed by mef2, and there are more than twice as many survivors. Together, the phenotypic analysis and genetic interaction findings indicate that Him functions in the Mef2 pathway that controls muscle differentiation (Liotta, 2007).

The Him protein sequence includes a putative bipartite nuclear localization signal (NLS). Consistent with this, colocalization with the transcription factor Twist in the AMP nuclei shows that Him is predominantly nuclear. The Him protein also has a WRPW motif at its C terminus. This tetrapeptide in this position is found in the Hairy group of transcriptional repressors and mediates their interaction with the corepressor Groucho (Gro). A pulldown assay was used to show that Him can also bind Gro. Moreover, this interaction requires the WRPW motif because Him with the WRPW motif deleted (HimΔWRPW) cannot bind Gro. To investigate the importance of the WRPW for Him function, HimΔWRPW was overexpressed in embryos and it was found that there was no dramatic loss of muscles, in contrast to the effect of full-length Him. Together, these results show that Him can bind Gro through its WRPW tetrapeptide and that this motif is required to inhibit muscle differentiation (Liotta, 2007).

The significance of the Him/Gro interaction in vivo during embryonic muscle development was investigated by overexpressing Him in a gro mutant background. Strikingly, the loss of gro function suppresses the inhibitory effect of Him, showing that Him requires gro to inhibit muscle differentiation. This result, together with the finding that mef2 can suppress the inhibitory effect of Him, indicates that Drosophila muscle differentiation in vivo is controlled by a balance between the activities of Him and Gro on the one hand and Mef2 on the other. The effect of overexpression of Him can be balanced by a reduction in Gro or by an increase in Mef2 (Liotta, 2007).

To further investigate the mechanism of action of Him, it was asked whether Him could inhibit Mef2 activity in cell culture in a direct Mef2-dependent gene-expression assay. When mef2 was transfected into S2 cells, it stimulated the expression of a Mef2-responsive luciferase reporter, and this effect was inhibited by cotransfection with Him. Then whether Him could also inhibit Mef2 activity was tested in the context of muscle development. The effect of Him overexpression on the expression of Mef2 and of β3-tubulin, which is a direct Mef2 target gene in somatic muscle, was analyzed. β3-tubulin expression is strongly reduced in the somatic mesoderm, whereas Mef2 protein expression is similar to that of the wild-type. This indicates that Him can downregulate Mef2 activity in vivo during embryonic development. It was further shown that Him with the Gro-interacting WRPW motif deleted does not affect β3-tubulin expression, nor does full-length Him in a groucho mutant background (Liotta, 2007).

Taken together, this combination of in vitro and in vivo assays reveals key features of Him's mechanism of action. They demonstrate that Him is found in the nucleus and requires its Gro-binding WRPW motif and gro function to inhibit both Mef2 activity and muscle differentiation during development. The previously characterized Drosophila proteins that have a C-terminal Gro-interacting WRPW motif are the Hairy group of HLH domain DNA-binding transcriptional repressors. However, Him is novel and does not have an HLH domain, suggesting that it does not bind DNA directly. Its mechanism of action may have parallels with Ripply1, which functions in vertebrate somitogenesis. Ripply1 also appears not to be an HLH protein and yet contains a functional Gro-interacting WRPW motif, although in this case near the N-terminus of the protein. Like Ripply1, Him may be part of a transcriptional-repressor protein complex. The precise mechanism by which Him targets Mef2 awaits analysis of this putative complex and the protein partners within it (Liotta, 2007).

Despite considerable progress, much remains to be learned about the regulation of muscle differentiation during animal development. Although studies in cell culture indicate that this control might include negative mechanisms, little is known about the identity and mode of action of specific molecules that inhibit muscle differentiation in vivo during development. This study identified and analyzed the targeting of Mef2 by Him. The inhibitory action of Him, coupled to its transient expression in developing muscle cells, is an explanation for the observation that Mef2 is present significantly before overt differentiation. It also offers an explanation for how a burst of expression of many Mef2 target genes at a specific phase (stage 13) of the differentiation program is coordinated. It is suggested that the rapid decrease in the expression of Him will lead to a concomitant increase in the activity of Mef2 and the ability to activate a cohort of these genes. Further studies will determine whether this will link reports that the ability of Mef2 to bind DNA is temporally regulated (Liotta, 2007).

The results also indicate that the inhibition of Mef2 activity by endogenous levels of Him is incomplete prior to stage 13. Thus, in normal muscle development, the Mef2 target gene β3-tubulin is expressed at stage 12, even though it was found that overexpression of Him can downregulate its expression then. This implies that in the wild-type embryo, there is some Mef2 activity at stage 12, and such activity is sufficient for β3-tubulin expression. This is consistent with other work that indicates that Mef2 regulates some gene expression at this stage and earlier and suggests that Him can provide one level of control of Mef2 activity during the muscle-differentiation program. Taken together, these results move the molecular analysis of muscle differentiation on from a simple model in which the key events are expression of pivotal positive regulators, for example Mef2. Rather they indicate that muscle differentiation in vivo is controlled by a balance of positive and negative regulators, including Him, Gro, and Mef2, that governs whether muscle precursors differentiate. In this model, one can think of Him and Gro as part of a mechanism holding the cells in a committed, but undifferentiated, state in which a cohort of muscle-differentiation genes is poised to be expressed. This might be a widespread strategy for coordinated gene expression in cell-differentiation programs. For example, it can be compared with melanocyte stem cell differentiation, where cells are primed to rapidly express terminal differentiation markers once Pax3/Groucho-mediated repression is relieved (Liotta, 2007).


Myocyte enhancer factor 2: Biological Overview | Evolutionary Homologs | Targets of Activity and Protein Interactions | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.