lame duck
The transcription factor Twist initiates Drosophila mesoderm development, resulting in the formation of heart, somatic muscle, and other cell types. Using a Drosophila embryo sorter, enough homozygous twist mutant embryos were isolated to perform DNA microarray experiments. Transcription profiles of twist loss-of-function embryos, embryos with ubiquitous twist expression, and wild-type embryos were compared at different developmental stages. The results implicate hundreds of genes, many with vertebrate homologs, in stage-specific processes in mesoderm development. One such gene, gleeful/lame duck, related to the vertebrate Gli genes, is essential for somatic muscle development and sufficient to cause neural cells to express a muscle marker (Furlong, 2001).
Formation of muscles during embryonic development is a complex process that requires coordinate actions of many genes. Somatic, visceral, and heart muscle are all derived from mesoderm progenitor cells. The Drosophila twistgene, which encodes a bHLH transcription factor, is essential for multiple steps of mesoderm development: invagination of mesoderm precursors during gastrulation, segmentation, and specification of muscle types. The role of twist in mesoderm development has been conserved during evolution, perhaps because it controls conserved regulatory mesoderm genes. For example, tinman and dMef2 are regulated by Twist in flies and are highly conserved in sequence and function in vertebrates (Furlong, 2001).
In Drosophila, somatic muscle forms from progenitor cells that divide to become muscle founder cells. Founder cells acquire unique identities controlled by transcription factors including Krüppel, S59, vestigial, and apterous. Each of the 30 body wall muscles in an abdominal hemisegment is initiated by a single founder cell and has unique attachments and innervations. To further clarify mechanisms underlying founder cell specification, myoblast fusion, and muscle patterning, Drosophila mutants together with microarrays of cDNA clones were used (Furlong, 2001).
twist mutant embryos develop no mesoderm. The population of mRNA species isolated from twist homozygous embryos were compared with that of stage-matched wild-type embryos. Drosophila lethal mutations are maintained as heterozygotes, in trans to balancer chromosomes. A twist mutation was established in trans to a balancer chromosome carrying a transgene encoding green fluorescent protein (GFP). Embryos were collected from wild-type and twist/GFP-balancer fly stocks at specific developmental stages. The twist/GFP-balancer collections contain a mixed population of embryos: one-quarter twist homozygotes lacking GFP; half heterozygotes with one copy of GFP, and one-quarter homozygous for the balancer chromosome with two copies of GFP. Homozygous twist mutant embryos were separated from their siblings using an embryo sorter. Putative homozygous twist embryos were assessed by immunostaining with an antibody to dMef2. More than 99% of the selected embryos had the twist phenotype (Furlong, 2001).
Three different periods of mesoderm development were analyzed: stages 9-10, 11, and 11-12. During stage 9-10, the earliest time GFP is detectable in the balancer embryos, mesoderm cells migrate dorsally and become specified as somatic, visceral, cardiac, and fat body mesoderm. twist and its direct targets tinman and dMef2 are expressed throughout stage 9-10 mesoderm. The middle period contains stage 11 embryos and is a transition between the first period (stage 9-10) and the third period (late stage 11-12). During late stage 11 and stage 12, myoblast fusion begins and twist expression remains prominent in only a subset of the somatic muscle cells (Furlong, 2001).
For each developmental period, three independent embryo collections, embryo sortings, and microarray hybridizations were conducted. The microarrays used for the analysis contained over 8500 cDNAs corresponding to 5081 unique genes plus a variety of controls. Each embryonic RNA sample was compared with a reference sample, which contains RNA made from all stages of the Drosophila life cycle and allows direct comparisons among all the experiments (Furlong, 2001).
To determine how transcription was affected by the twist mutation, SAM (significance analysis of microarrays) analysis was used. Genes that are normally highly expressed in mesoderm should have lower transcript levels in twist homozygotes. Genes in other tissues whose expression depends on signals from the mesoderm might also have reduced expression. Transcripts of 130 genes, the 'Twist-low' group, were significantly lower in twist mutants than in wild type. Conversely, cells that would have formed mesoderm may take on other fates in the absence of twist, such as neuroectoderm; therefore, many transcript levels could increase in twist mutants. Genes whose transcription is repressed by signals from the mesoderm would also be enriched in twist mutants. One hundred fifty genes, called the 'Twist-high' group, have increased levels of RNA in twist mutant embryos (Furlong, 2001).
In total, 280 of ~5000 genes had significant changes in transcript levels, with 10 false positives. The genes on the array include 15 previously characterized mesoderm-specific genes, all of which were significantly reduced in twist mutant embryos. The arrays also contain genes known to be
transcribed in both mesoderm and other cell types. Significant changes in expression were detected for many of these genes (Furlong, 2001).
To ectopically express twist, a dominant gain-of-function mutation of the maternal gene Toll (Toll10B) was used. Activated Toll induces the expression of twist and snail in early embryos and of immune response genes in older embryos. Thus, the effects of Toll10B on gene expression reflect the activities of Twist as well as Snail and Dorsal, or their combined actions. Toll10B embryos are essentially bags of mesoderm; epidermal structures are absent or greatly reduced, and they have been used successfully in subtractive hybridization screens to identify mesoderm genes. The gene transcription profile of Toll10B embryos was compared with that of wild-type embryos during four periods of development, using the reference sample to normalize experiments. The earliest period, stage 5, is when twist is initially expressed in presumptive mesoderm. The other three periods analyzed were those used in the twist mutant analysis: stages 9-10, 11, and 11-12 (Furlong, 2001).
Data from loss- and gain-of-function experiments, combined with careful staging, yield a useful picture of genes that are likely to be required for mesoderm specification and muscle differentiation. Of 360 identified mesoderm genes, 273 have not been the focus of developmental studies. The predicted proteins encode transcription factors, signal transduction molecules, kinases, and pioneer proteins. The stage at which each gene is active is one criterion for assigning possible functions. Another key criterion will be finding a mutant phenotype. As a pilot, this additional step was undertaken for the gene CG4677 (LD47926). Changes in CG4677 transcript levels were also observed in a Toll10B subtractive hybridization screen (Furlong, 2001).
CG4677 is transcribed in the visceral mesoderm at stages 10-13 and the somatic mesoderm during stages 11-13. This gene encodes a C2H2 zinc finger transcription factor with high sequence similarity to vertebrate Gli proteins, the gene has been named gleeful (gfl). Mammalian Gli proteins act downstream of Hedgehog signaling proteins to control target gene transcription (Furlong, 2001).
The role of gfl in mesoderm development was assessed by disrupting its function using RNA interference. Injection of a double-stranded RNA (dsRNA) control sequence had no effect on mesoderm development. In contrast, gfl dsRNA injection causes severe loss and disorganization of somatic muscle cells, whereas heart and visceral muscle were unaffected. A similar phenotype was seen in Df(3R)hh homozygous embryos: the deficiency removes gfl but not the nearby hedgehog gene (Furlong, 2001).
To determine whether gfl can induce muscle cell development, a UAS-gfl transgenic fly strain was generated. Ectopic expression of gfl using an en-GAL4 driver results in lethality and induction of ectopic dMEF2 expression in the ventral nerve cord. Remarkably, Gfl is sufficient to induce expression of a muscle gene in neuronal cells. Previous studies have shown an essential role for Sonic hedgehog signaling in the formation of slow muscle in avian and zebrafish embryos. gfl may be performing a similar role in Drosophila somatic muscle development (Furlong, 2001).
lame duck expression was examined in wg and N mutant embryos to determine the relative position of lmd within the genetic hierarchy that controls somatic muscle specification. In wgcx4 mutant embryos, lmd RNA expression is not detectable in dorsolateral and lateral somatic mesodermal cells although there is residual expression in cells located in the ventral region. Thus, activation of lmd expression is mediated via wg-dependent and wg-independent pathways. Significantly, lmd expression in the somatic mesoderm is completely abolished in N5419 mutant embryos, indicating that activation of lmd expression in presumed fusion-competent myoblasts requires active Notch signaling. By contrast, founder cell formation is promoted in the absence of Notch function (Duan, 2001).
Smooth muscle plays a prominent role in many fundamental processes and diseases, yet understanding of the transcriptional network regulating its development is very limited. The FoxF transcription factors are essential for visceral smooth muscle development in diverse species, although their direct regulatory role remains elusive. A transcriptional map of Biniou (a FoxF transcription factor) and Bagpipe (an Nkx factor) activity is presented as a first step to deciphering the developmental program regulating Drosophila visceral muscle development. A time course of chromatin immunoprecipitatation followed by microarray analysis (ChIP-on-chip) experiments and expression profiling of mutant embryos reveal a dynamic map of in vivo bound enhancers and direct target genes. While Biniou is broadly expressed, it regulates enhancers driving temporally and spatially restricted expression. In vivo reporter assays indicate that the timing of Biniou binding is a key trigger for the time span of enhancer activity. Although bagpipe and biniou mutants phenocopy each other, their regulatory potential is quite different. This network architecture was not apparent from genetic studies, and highlights Biniou as a universal regulator in all visceral muscle, regardless of its developmental origin or subsequent function. The regulatory connection of a number of Biniou target genes is conserved in mice, suggesting an ancient wiring of this developmental program (Jakobsen, 2007; full text of article).
The dynamic enhancer binding of Biniou suggested that the timing of Biniou occupancy is important for the timing of enhancer activity. To assess this in vivo, a number of regions from each of the three temporal clusters were linked to a GFP reporter. The timing of enhancer activity was assayed in vivo by in situ hybridization in transgenic embryos, to avoid time delays due to GFP protein folding and protein perdurance. All regions examined drive expression in a subset of Biniou-expressing cells and recapitulate all or part of the target genes' expression. This study focused on their temporal activity (Jakobsen, 2007).
The initiation of enhancer activity closely matches the first time point of Biniou binding for >90% of enhancers examined (10 of 11 CRMs). The early-bound enhancers (ttk, fd64a-e, lame duck (lmd), bap3) drive expression at stages 10-11, reflecting the binding of Biniou at these stages of development. Similarly, all four continuous-bound enhancers (HLH54F, otk, mib2, bap-FH) initiate expression at the first time period when Biniou binds. The two late-bound enhancers, in contrast, do not initiate expression at stages 10 or 11 of development, matching the lack of Biniou binding during these stages. Instead, the expression of the fd64a late enhancer initiates at stage 13, while the ken enhancer initiates VM expression at stage 14. This shift in the initiation of activity mirrors Biniou binding to these enhancers at stages 12-13 and 13-14, respectively. The only exception is the CG2330 enhancer, which initiates expression at stage 11, while Biniou enhancer binding was first detected at stage 13-14). As the expression of endogenous CG2330 does not initiate until stage 13, the apparent discrepancy in enhancer activity may simply reflect the exclusion of some regulatory motifs within the limits of the cloned region (Jakobsen, 2007).
Remarkably, the duration of enhancer activity is also tightly correlated with the time span of Biniou binding in 10 out of 11 CRMs examined. This is particularly striking in the early-bound enhancers: When Biniou ceases to bind to these CRMs (lmd, ttk, fd64a early, and bap3), their ability to regulate expression is lost. The converse is also true. Continuous Biniou binding correlates with continuous enhancer activity, specifically for bap-FH, HLH54F, and otk. The exception is the mib2 enhancer. In the context of this module Biniou binding it is not sufficient to maintain enhancer activity in the VM at late developmental time points (Jakobsen, 2007).
Taken together, these data indicate that the timing of Biniou enhancer binding is predictive for temporal enhancer activity in the large majority of cases (Jakobsen, 2007).
Multiple enhancers mediate regulated Mef2 expression during embryogenesis. Among them is the enhancer I-E, which drives Mef2 expression in fusion-competent myoblasts. The phenotype of lame duck (lmd) mutant embryos suggests that lmd may be activating Mef2 in fusion-competent myoblasts via enhancer I-E. Wild-type and lmd mutant embryos, carrying the enhancer I-E construct, were double-labeled for Mef2 and lacZ expression. In the wild-type background, lacZ expression is detected in a large number of Mef2-positive somatic myoblasts. By contrast, there is a complete absence of lacZ expression in lmd mutant background. Activation of two other somatic muscle enhancers, II-E and III-F, which drive Mef2 expression in founder cells and muscle fibers, respectively, is not affected in mutant embryos (Duan, 2001).
Functional dissection of enhancer I-E has also identified a 170 bp subfragment, I-ED5, which is still active in somatic myoblasts. Further analysis with deletion reporter gene constructs, each of which contain a small internal deletion within enhancer I-ED5, has defined the essential [C/D]* region. Notably, robust lacZ expression levels are obtained with I-ED5, while a nearly complete absence of lacZ expression is observed with I-ED5-DelD. lacZ expression is slightly reduced with the overlapping I-ED5-DelC construct. Moreover, a multimerized construct consisting of five copies of the [C/D]* region can direct lacZ expression comparably to I-ED5. Thus, the sequences within [C/D]* are both necessary and sufficient to direct expression in fusion-competent myoblasts (Duan, 2001).
To identify factors that bind specifically to [C/D]*, a yeast one-hybrid screen was indertaken, using the multimerized [C/D]* region as target. From this molecular screen, 37 His-positive/lacZ-positive cDNA fusion clones were obtained that encode proteins which bind the [C/D]* region. Twelve of the 37 clones encode truncated versions of the Lmd protein. These can be grouped into four classes based upon the position of their N-terminal end. The encoded polypeptides in all 12 clones include the Zn-finger domain. To ascertain that the Zn-finger domain is responsible for specific target recognition, constructs that encode defined portions of the protein were tested in yeast cells. Indeed, constructs that include the Zn-finger domain are capable of activating robust levels of His and lacZ expression whereas those that span the N- or C-terminal region of Lmd, flanking the Zn-finger domain, are not able to activate His expression (Duan, 2001).
Standard DNA-binding assays were performed to confirm that Lmd can bind specifically to enhancer I-ED5. In the presence of in vitro-translated Lmd protein, a slower-migrating protein-DNA complex is observed with the gamma32P-labeled I-ED5 fragment. Formation of this complex is specifically competed by an excess amount of cold I-ED5 DNA fragment but not by cold III-F7, an unrelated DNA fragment of similar length (Duan, 2001).
Sequence analysis of enhancer I-ED5 did not reveal any sequence elements that conform to the canonical binding site for Ci/Gli proteins, indicating that Lmd recognizes a novel DNA sequence motif. To attempt to define the binding site, four other mutated I-ED5 derivatives (I-ED5-mt1, I-ED5-mt2, I-ED5-mt3, I-ED5-mt4), each of which contains a 10 bp block of substitutions were tested in vivo. Normal levels of activation of reporter gene expression in somatic myoblasts are observed with I-ED5-mt3 and I-ED5-mt4. By contrast, dramatically reduced levels of reporter gene expression are observed with I-ED5-mt1 and I-ED5-mt2. These results, together with additional in vitro binding and competition data, indicate that the functional binding site of Lmd is within the sequence TTACCTACGCAGCGTTTACA (Duan, 2001).
Skeletal muscle formation in Drosophila melanogaster requires two types of myoblasts, muscle founders and fusion-competent myoblasts. Lame duck (Lmd), a member of the Gli superfamily of transcription factors, is essential for the specification and differentiation of fusion-competent myoblasts. Appropriate levels of active Lmd protein are attained by a combination of posttranscriptional mechanisms. Evidence is provided that two different regions of the Lmd protein are critical for modulating the balance between its nuclear translocation and its retention within the cytoplasm. Activation of the Lmd protein is also tempered by posttranslational modifications of the protein that do not detectably change its subcellular localization. Overexpression of Lmd protein derivatives that are constitutively nuclear or hyperactive results in severe muscle defects. These findings underscore the importance of regulated Lmd protein activity in maintaining proper activation of downstream target genes, such as Mef2, within fusion-competent myoblasts (Duan, 2006).
This study provides evidence that appropriate levels of active Lmd protein are regulated by at least two distinct mechanisms. First, Lmd activity is modulated by changes in nuclear translocation of the protein versus its retention in the cytoplasm. Indeed, protein localization studies showed that two separate regions (I and II) are critical for the cytoplasmic retention of the Lmd protein. The amino-terminal region I (~aa 1 to 141) is necessary but not sufficient, in any context, for effecting cytoplasmic retention, whereas region II (~aa 691 to 866) is necessary and sufficient when present in truncated Lmd proteins. It is noteworthy that region II is not sufficient within the context of the full-length protein (e.g., aa141-866 or aa183-866 protein) and that the inclusion of both regions in the wild-type protein does not make it exclusively cytoplasmic, thus suggesting the existence of a yet-to-be-defined regulatory component(s) that counteracts the action of the two regulatory regions. Based upon these data, it is proposed that some unknown factor binds in a signal-dependent manner to the region that spans ~aa 183 to 382 and abrogates the capability of region I and/or region II to mediate interactions (direct or indirect) with the microtubule network/cytoskeleton. Alternatively, interactions (direct or indirect) between regions I and II could be important for masking the NLS and the binding of this unknown factor may disrupt this masking. In general terms, these findings regarding the regulation of the subcellular distribution of Lmd are reminiscent of those associated with the Ci protein. For example, a recent study showed that the kinesin-like protein Costal2 (Cos2) interacts with two separate domains of Ci to inhibit its nuclear translocation . It was also reported that Cos2 relies on microtubule-dependent and microtubule-independent mechanisms to retain the Ci protein in the cytoplasm. Furthermore, it has been suggested that the formation of distinct protein complexes, consisting of Cos2, Fu, Su(fu), and Ci, is a mechanism by which Ci can be sequestered in the cytoplasm. Consequently, it will be important to characterize the components that recognize the different regulatory regions within the Lmd protein. By analogy to the Ci protein, it will also be interesting to determine whether there could exist in vivo distinct Lmd protein-containing complexes (Duan, 2006).
To assess lmd expression during embryogenesis, embryos were hybridized with a digoxigenin-labeled lmd probe. lmd RNA transcripts are first detectable at late stage 11 in repeating patches of visceral mesoderm, corresponding to Bap-positive cells. Prominent expression is then observed in somatic and visceral mesodermal cells throughout stage 12. During stage 13, lower levels of lmd expression persist in repeating groups of somatic mesodermal cells, whereas expression in the visceral mesoderm is no longer detectable. lmd expression is abolished in somatic mesodermal cells before cell fusion and is never detectable in muscle fibers. Its expression is also never detected in heart progenitors. The Lmd protein expression pattern, obtained with an antibody against the N-terminal portion of the protein, is identical to its RNA profile (Duan, 2001).
Confocal microscopy was used to determine precisely the cell type within the somatic mesoderm in which Lmd is expressed. Embryos derived from the rP298-lacZ line were triple-stained with antibodies against Lmd, Mef2 and ß-gal. rP298 drives lacZ expression in all founder cells. There is extensive co-expression of Lmd and Mef2, but only within lacZ-negative fusion-competent myoblasts, whereas Mef2-positive/lacZ-positive founder cells are Lmd negative or express Lmd at extremely low levels. These results indicate that Lmd is expressed highly in fusion-competent myoblasts and at barely detectable, or undetectable, levels in founder cells (Duan, 2001).
Given that Lmd is a Gli-related protein, a detailed examination was made of the subcellular distribution of Lmd protein expression. Wild-type late stage 12 embryos were triple-stained with antibodies against Lmd, Mef2 and nuclear lamin. Lmd expression is detected in both the nucleus and cytoplasm of a large number of myoblasts whereas Mef2 expression is restricted to the nucleus of these same cells. However, the majority of these myoblasts appear to have elevated levels of Lmd in their nuclei when compared with their cytoplasm. Interestingly, exclusively cytoplasmic Lmd expression is observed in some myoblasts and these do not express Mef2. An apparent absence of Lmd expression is also seen in some Mef2-positive myoblasts which are presumably founder cells. Furthermore, myoblasts from each of these different categories are found in stereotyped positions within each segment, suggesting that both the intracellular localization and expression of Lmd may correlate the distinct specification and differentiation state of a particular cell. Taken together, the subcellular localization data and results from a parallel study indicate that Mef2 activation in fusion-competent myoblasts requires nuclear-localized Lmd (Duan, 2001).
lame duck, termed myoblasts incompetent (minc) in this study, is essential for normal myogenesis and myoblast fusion in Drosophila. myoblasts incompetent is expressed in immature somatic and visceral myoblasts.
Expression is predominantly in fusion-competent myoblasts and a loss-of-function mutation in myoblasts incompetent
leads to a failure in the normal differentiation of these cells and a complete lack of myoblast fusion. In the mutant
embryos, founder myoblasts differentiate normally and form mononucleate muscles, but genes that are specifically expressed in fusion-competent
cells are not activated and the normal downregulation of twist expression in these cells fails to occur. In addition, fusion-competent myoblasts fail to express proteins characteristic of the general pathway of myogenesis such as myosin and Dmef2. Thus myoblasts incompetent appears to function specifically in the general pathway of myogenesis to control the differentiation of fusion-competent myoblasts (Ruiz-Gomez, 2002).
In minc[A388] mutants there is a complete lack of myoblast fusion and all muscles are mononucleated. To show whether founder cells are specified normally in the mutant embryos, antibodies to a variety of transcription factors (e.g. Kr) were used: these are expressed by subsets of founder myoblasts in normal embryos. In all cases, these expression patterns in founder cells were normal. To characterize the phenotype in more detail, anti-myosin antibody was used to visualize the process of myogenesis in wild-type and mutant embryos. Myosin staining shows that some mesodermal derivatives, including the heart, develop normally, but that multinucleate somatic muscles fail to form. Fusion also fails to occur in the muscles of the pharynx. Founder myoblasts appear to differentiate normally, developing at appropriate positions, expressing myosin, elongating and attaching to the epidermis at their correct insertion sites. However, with myosin staining, fusion-competent myoblasts could not be detected at any stage and this is in striking contrast to other non fusion mutants in which unfused myoblasts express myosin at high levels (Ruiz-Gomez, 2002).
The failure to detect fusion-competent myoblasts with myosin staining in the mutant embryos could reflect either the complete absence of these cells or, alternatively, it could be that the cells are present but have failed to differentiate. Because founder cells form normally in minc embryos, it is assumed that the segregation process that leads to the separation of a population of founders and fusion-competent cells has probably taken place in these embryos. Thus it seemed likely that the fusion-competent cells would be present but in some undifferentiated state. To explore this possibility further, an antibody to Dmef2, a gene that is expressed and required for normal differentiation in all myogenic cells, was used. Staining with this antibody has revealed once again a normal pattern of founder cells, but an absence of expression in fusion-competent cells. This again is in marked contrast to other non-fusion mutants such as myoblast city (mbc) (Ruiz-Gomez, 2002).
Because staining with an antibody to Dmef2 did not resolve the issue of the fate of the fusion-competent cells in mutant embryos, an antibody to twist, which is a general marker for early undifferentiated mesodermal cells, was used. In normal embryos, twist expression is lost from fusion-competent myoblasts during stages 11 and 12. In the mutant embryos, there is a striking persistence of twist expression in a population of cells whose arrangement is similar to the normal distribution of fusion-competent cells. However there are fewer such twist-expressing cells in a minc mutant embryo than those detected by Dmef2 expression in a non fusion mutant such as mbc. Interestingly therefore, it appears that in minc mutant embryos, twist expression persists in only a subset of the putative fusion-competent myoblasts. This expression is maintained throughout the normal period when fusion would be expected to occur. Thus, while wild-type embryo founder cells are surrounded by fusion-competent myoblasts, with which they fuse, in minc embryos, normally differentiating founder cells are surrounded by an abnormal population of apparently undifferentiated mesodermal cells expressing twist (Ruiz-Gomez, 2002).
To examine the extent to which these twist-expressing cells have been specified, the expression of two further genes, hairy (h) and sticks and stones (sns), whose products are characteristic of fusion-competent cells in the mesoderm of normal embryos, were examined. sns, in particular, is an early marker for this population and a critical determinant of the function of these cells in fusion. In both cases, no expression was detected in the putative fusion-competent cells surrounding the founder myoblasts in mutant embryos. sns is also expressed in a second population of fusion-competent cells, that will later contribute to the visceral muscles of the midgut. However, these cells do not lose sns expression in minc mutant embryos. Nonetheless, minc mutant embryos fail to form syncytial visceral muscles (Ruiz-Gomez, 2002).
It seems, therefore, that the process of segregation that generates two populations of somatic myoblasts, founders and fusion-competent cells, in normal embryos, occurs in the mutant, but while founders develop normally, there is a complete failure of the fusion-competent cells to differentiate. The putative fusion-competent cells remain as an undifferentiated population that continues to express twist and does not express any of the normal markers for the differentiation of this class of myoblasts. It appears that in minc embryos an essential step in the specification of fusion-competent cells has failed to occur, and that these cells therefore fail to differentiate (Ruiz-Gomez, 2002).
The earliest expression of minc is in cells of the visceral mesoderm -- initially at stage 10 in a small patch of cells at the posterior tip of the embryo, that probably corresponds to the primordium of the caudal visceral mesoderm and then in segmentally repeated clusters of cells that correspond to the bagpipe (bap)-expressing progenitors of the trunk visceral mesoderm. These patches are joined ventrally by expression in the mesodermal cross bridges. Expression in the visceral mesoderm includes both founders and fusion-competent myoblasts. By stage 11, expression starts in cells of the somatic mesoderm and begins to decline in cells of the visceral mesoderm. Expression is predominantly in cells that do not express the rP298 marker for founder cells. There is probably residual expression of minc in rP298-expressing cells but it is clearly at a lower level than in the adjacent cells with which they will fuse. There is strong expression in the somatic mesoderm until stage 13. Expression begins to decline in stage 14 and, apart from residual expression in a few cells, has disappeared by late stage 15. At this stage, however, minc is detectable in mesodermal cells of the gonad (Ruiz-Gomez, 2002).
Mutations in twist, which eliminate all mesodermal derivatives also completely lack expression of minc, thereby confirming its exclusively mesodermal pattern of expression. Previous work has shown that founder cells segregate from the somatic mesoderm by a process of lateral inhibition that is mediated by the neurogenic genes and the activation of the Notch signaling pathway in neighboring cells, which are thereby prevented from becoming founders themselves. In Notch mutant embryos, there is an overproduction of founder cells at the expense of other adjacent cells. It seems likely that the cells that are inhibited from becoming founders are the cells that will enter the other myoblast class, namely the fusion-competent cells. This view is reinforced by the finding that sns expression, which is characteristic of these cells, is reduced in Notch mutant embryos. If this is so, and if minc is involved in the specification of fusion-competent cells, then it would be expected that its expression too would be reduced in neurogenic mutant embryos. Accordingly, the expression of minc was examined in mutants for Notch and Delta. In both cases there is a striking reduction in the expression of minc. There is some persistent minc expression in these embryos which is likely to be in cells of the visceral mesoderm (Ruiz-Gomez, 2002).
Casal, J. and Leptin, M. (1996). Identification of novel genes in Drosophila reveals the complex regulation of early gene activity in the mesoderm. Proc. Natl.
Acad. Sci. 93: 10327-10332. 8816799
Duan, H., Skeath, J. B. and Nguyen, H. T. (2001). Drosophila Lame duck, a novel member of the Gli superfamily, acts as a key regulator of myogenesis by controlling fusion-competent myoblast development. Development 128: 4489-4500. 11714674
Duan, H. and Nguyen. H. T. (2006). Distinct posttranscriptional mechanisms regulate the activity of the Zn finger transcription factor Lame duck during Drosophila myogenesis. Mol. Cell. Biol. 26(4): 1414-23. 16449652
Furlong, E. E. M., Andersen, E. C., Null, B., White, K. P. and Scott, M. P. (2001). Patterns of gene expression during Drosophila mesoderm development.
Science 293: 1629-1633. 11486054
Jakobsen, J. S., et al. (2007). Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral muscle transcriptional network.
Genes Dev. 21(19): 2448-60. Medline abstract: 17908931
Nishida. H. and Sawada, K. (2001). macho-1 encodes a localized mRNA in ascidian eggs that specifies muscle fate during embryogenesis. Nature 409(6821): 724-9. 11217862
Ruiz-Gomez, M., et al. (2002). myoblasts incompetent encodes a zinc finger transcription factor required to specify fusion-competent myoblasts in Drosophila. Development 129: 133-141. 11782407
date revised: 20 November 2006
Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.
The Interactive Fly resides on the
lame duck:
Biological Overview
| Regulation
| Developmental Biology
| Effects of Mutation
| References
Society for Developmental Biology's Web server.