|
Gene name - deadpan Synonyms -dpn Cytological map position - 44C Function - transcription factor Keyword(s) - pan-neural, central and peripheral nervous systems |
Symbol - dpn FlyBase ID:FBgn0010109 Genetic map position - 2-[58] Classification - bHLH Cellular location - nuclear |
EvoprintHD of dpn
Developmental regulators and cell cycle regulators have to interface in order to ensure appropriate cell proliferation during organogenesis. An analysis of the roles of the pan-neural genes deadpan and asense defines critical roles for these genes in regulation of mitotic activities in the larval optic lobes. Loss of deadpan results in reduced cell proliferation, while ectopic deadpan expression causes over-proliferation. In contrast, loss of asense results in increased proliferation, while ectopic asense expression causes reduced proliferation. Consistent with these observations endogenous Deadpan is expressed in mitotic areas of the optic lobes, and endogenous Asense is expressed in cells that will become quiescent. Altered Deadpan or Asense expression results in altered expression of the cyclin dependent kinase inhibitor gene dacapo. Thus, regulation of mitotic activity during optic lobe development may, at least in part, involve deadpan and asense mediated regulation of the cyclin dependent kinase inhibitor gene dacapo (Wallace, 2000).
Optic lobes begin development during embryogenesis between stages 11 and 12 when a group of 30-40 epidermal cells delaminates and moves from the surface of each brain hemisphere. Once delaminated, these cells remain inactive until the embryo hatches as a first instar larva. This inactive state of the cells is partially mediated by the glycoprotein Anachronism, secreted by glia surrounding the developing optic lobe (Ebens, 1993). In the first instar larva the cells begin to divide, a process requiring the function of the trol gene. These first divisions appear to be synchronous and continue through the beginning of pupal development. A total of approximately 3,000 cells are produced in the mitotically active areas of the optic lobe. During second instar some of the cells of the developing lamina and medulla begin to differentiate into neurons and glia. This differentiation is accompanied by the innervation of the first and second optic lobes by photoreceptor axons. Their arrival and the release of Hedgehog protein in the developing optic lobes begins the differentiation of the lamina cells into neurons and glia. The outer proliferation center (OPC) represents one of the major areas of mitotic activity in the optic lobe. The OPC becomes a distinct structure at late second instar and the cells in the OPC and the inner proliferating center (IPC) continue to divide until all of the photoreceptor axons have innervated the optic lobe and initiated differentiation of the lamina precursors. The lamina furrow spreads outward in a semicircle and passes through the OPC where the cells for the developing lamina originate. As the lamina furrow advances outward, the cells in the passing furrow arrest in G1 phase (Wallace, 2000 and references therein).
The IPC, which is the second major area of mitotic activity in the optic lobe, forms in a crescent shape at a more interior position of the brain with respect to the OPC. The IPC represents a pool of cells that produces the cells for the medulla and the lobula. The IPC cells, however, do not divide and differentiate in as synchronous an order as the OPC (Wallace, 2000).
To determine the functional properties of Dpn during larval development the pUAST/Gal4 system was used to test the effects of ectopic dpn expression. The 71B Gal4 driver line was used in this analysis, since it drives the expression of pUAST constructs in most cells of the second and third instar larval optic lobes. In addition, this line also drives strong expression in the wing discs. Bromodeoxyuridine (BrdU) incorporation and histone H1 RNA expression were used as S phase specific markers to detect changes in mitotic activity (Wallace, 2000).
In the larval central nervous system, ectopic Dpn expression results in a striking increase in the size of the brain lobes as compared to wild-type brains. In brains with ectopic Dpn expression, an increase in the number of mitotically active cells is apparent across the entire surface of the enlarged brain. In addition, a breakdown of the mitotic domain pattern that is present in wild-type third instar optic lobes is also evident. The over-proliferation phenotype that is associated with ectopic Dpn expression is fully penetrant. It can range from >10 times to two- to four-fold the size of a normal wild-type brain lobe, and appears sensitive to the accumulation modifiers in the genome (Wallace, 2000).
HES proteins can have opposite functions from proteins of the AS-C in neural development. ase, a member of the AS-C, has been reported to be expressed in the developing third instar optic lobes and loss of ase function results in disturbances of the adult optic lobe. It was asked whether the AS-C protein Ase can modulate mitotic activity. To this end, the effects of ectopic ase expression on mitotic activity in the developing larval optic lobe were investigated. As with Dpn, ectopic expression of Ase results in strong expression in most cells of the second and third larval optic lobes. This expression results in breaks in the normally continuous pattern of S phase positive cells in the OPC suggesting that increase and/or ectopic expression of the Ase protein decreases mitotic activity in the optic lobe (Wallace, 2000).
It was asked whether mitotic activity is altered in third instar larval optic lobes of dpn1 homozygous loss of function mutants. dpn1 is an apparent null allele of the dpn gene. In the OPC of dpn1 homozygous third instar larvae, sporadic breaks are evident in the normally continuous area of S phase positive cells. These breaks can vary in size and location in the OPC, but can be found in the OPC of nearly all homozygous dpn1 mutant larvae. In addition, S phase activity in the developing lamina appears compressed and disorganized (Wallace, 2000).
To better determine whether reduction in the amount of OPC neuroblasts in dpn1 mutants results in a significant loss of OPC neuroblast progenies, assays were performed for developing lamina cells that represent direct progeny of the OPC cells. If there is a reduction in the amount of cells in the OPC, a subsequent reduction in the amount of developing lamina cells could be expected. Anti-Dachshund antibodies were used to mark the cells of the developing lamina. In dpn1 homozygous mutant third instar larvae, a reduced number of Dachshund (Dac) positive cells is evident as compared to the wild type. Photoreceptor axons that innervate the lamina are responsible for initiating the differentiation of the cells into neurons and glia. It was necessary to determine whether the reduced number of cells is due to an aberrant projection of photoreceptor axons. Anti-HRP antibodies were used to mark the photoreceptor axons in dpn1 homozygous larvae. Overall size and morphology of the eye disc, as well as photoreceptor axon extension and innervation of the lamina in dpn1 larvae appears normal. One difference, however, is that the area of innervation is smaller than wild type. The reduced number of developing lamina cells in dpn1 loss of function larvae indeed may, therefore, be due to a reduced amount of OPC neuroblasts rather than aberrant axon projection (Wallace, 2000).
To analyze the possible involvement of ase gene function on mitotic activity in the larval optic lobes, the S phase activity in third instar larval brains was determined. In ase1/scb57 mutants, there is an expansion of S phase activity to include the normally mitotic quiescent cells between the OPC and the lamina precursor cells (LPCs), as well as scattered S phase activity in the lamina. ase1 is a deletion of the ase coding region and scB57 is a deletion of the entire AS-C as well as the proximal complementation group EC4 making the larva homozygous mutant for ase and heterozygous for the other members of the AS-C. In contrast, +/scB57 larval optic lobes show normal S phase activity. Thus, ase loss of function mutants show an increase in the S phase activity between the OPCs and the LPCs, and a random pattern of increased S phase activity in the lamina (Wallace, 2000).
If Dpn is involved in the positive regulation of mitotic activity, as indicated by the dpn loss of function and ectopic expression phenotypes, then Dpn would be expected to be expressed in mitotic active areas. Endogenous dpn protein expression was examined in the wild-type larval CNS; Dpn was found to be expressed in areas of active cell division in the optic lobes. Dpn is expressed in the OPC of the late third instar larva and stops at the edge of the OPC. After cells exit the OPC, S phase activity ceases and the cells subsequently arrest in G1 as they pass through the lamina furrow. Dpn is also expressed in the cells of the IPC. Thus, expression of Dpn in the larval optic lobes is in agreement with a possible role as one positive regulator of the cell cycle (Wallace, 2000).
If Ase is involved in the termination of mitotic activity in the larval optic lobes, then Ase expression would be expected in or near areas where the cell cycle is arresting. Ase protein expression was examined in the larval optic lobes; Ase was found to be present in a band at the posterior edge of the OPC that partially overlaps with Dpn expression. Ase is expressed just before the cells exit the OPC and cease S phase activity. These cells then arrest in G1 phase as they pass through the lamina furrow. Ase is also expressed in cells of the IPC and at a low level in the lamina furrow. The expression pattern of Ase, which comes to a maximum at the posterior edge of the OPC, is in agreement with a possible role for Ase in aiding cell cycle arrest as cells leave the OPC (Wallace, 2000).
Cdk inhibitors have been shown to represent key regulators of mitotic activity. In Drosophila a cdk inhibitor gene, dap, has been identified that is transiently expressed during embryogenesis in cells prior to entering their last mitosis and at the onset of terminal differentiation. Ectopic expression of dap results in G1 arrest, while loss of dap function has been shown to cause one extra cell division in embryonic epidermal cells. Dpn appears to promote the continuation of mitotic activity, while Ase has a role in ending cell proliferation in the developing optic lobes. Therefore, it was asked whether altered expression of Dpn and Ase can modulate the expression of the dap. In wild-type third instar larva, optic lobe expression of dap occurs in specific domains. dap is expressed in cells of the lamina furrow and scattered cells of the lamina. There is also strong expression of dap in a subset of cells in the IPC throughout third instar. In contrast, dap expression is virtually absent from the cells of the OPC (Wallace, 2000).
The effects were determined of the loss of dpn function on the expression of dap. In homozygous dpn1 mutant third instar larva, expression expands into the area of the OPC. Also, cells of the lamina begin to express dap more strongly. In contrast, in larvae with ectopic Dpn expression, dap expression is strongly reduced or absent in the optic lobes of third instar larva. Thus, dpn activity has a negative regulatory effect on the dap RNA level (Wallace, 2000).
In homozygous ase mutant third instar larvae, there is a strong reduction of dap RNA throughout the entire developing optic lobe while dap expression in the developing eye disk appears normal. The ase loss of function phenotype demonstrates that ase activity is necessary for the expression of dap throughout the developing optic lobe. When Ase is ectopically expressed in third instar optic lobes, ectopic activation of dap expression becomes evident. Therefore, ase activity has a positive regulatory effect on the dap RNA level (Wallace, 2000).
It was asked whether the phenotypical effects on cell proliferation produced by alterations of Dpn and Ase expression may be caused, at least in part, by changes in the levels of dap transcript. During embryogenesis, alteration in the levels of dap expression through either ectopic expression or by loss of function, result in dramatic changes in mitotic activity. Therefore, the mitotic activity in optic lobes of homozygous dap6 mutant third instar larvae were analyzed. While predominately recessive lethal, a few dap6 homozygous escapees can be viable to adulthood. Therefore, the larval optic lobes of homozygous dap6 mutant third instar larva can be analyzed. In such homozygous dap6 mutant larvae over-proliferation of the cells of the optic lobes is evident. There is a significant increase in the number of mitotically active cells and break down of mitotic domains, as compared to the wild type (Wallace, 2000).
The over-proliferation phenotype of dap6 null mutants can be compared to the over-proliferation phenotype in larvae with ectopic dpn expression, and the associated suppression of dap expression. Although the over-proliferation in both cases is similar, there are clearly more cells produced in the dpn over-expressing brain lobes. This strongly indicates that other cell cycle regulators are also likely to be affected by the ectopic expression of dpn in the optic lobes (Wallace, 2000).
A model is proposed for mitotic control in the developing third instar optic lobe in which cell proliferation is modulated by a positive regulator of mitotic activity such as Dpn and a negative regulator of mitotic activity such as Ase. In this model, one role of Dpn and Ase would be to interface with cell cycle regulation through the direct or indirect modulation of dap expression. Mitotic control during optic lobe development may involve the following events. Cells that give rise to the optic lobe delaminate from the neuroectoderm during embryogenesis and remain quiescent until first instar with the help of proteins such as Anachronism. The mitotic activity is then initiated through a process that requires the trol gene product and the developmental regulator and transcription factor Eve to begin the proliferation of neuroblasts to form the OPC. The mitotically active state of OPC cells would be maintained in part by Dpn. In the absence of Dpn, the cells in the OPC have a greater chance of exiting mitosis by allowing Dap to be expressed. As cells arrive at the edge of the OPC, Ase is expressed at high levels, allowing the neuroblasts to become quiescent only after they pass out of the region where Dpn is expressed. Suppression of dap by Dpn in the OPC would allow the neuroblasts to be mitotically active while the increased expression of Ase at the posterior edge of the OPC allows the neuroblasts to exit mitosis and begin differentiation. In addition, the resulting quiescent state needs to be maintained in the lamina; otherwise the cells may reenter mitosis (Wallace, 2000 and references therein).
cDNA clone length - 2.2 kb
Base pairs in 5' UTR -269
Base pairs in 3' UTR - 448
Deadpan has a basic HLH domain, and a C-terminal WRPW domain found also in Hairy and Enhancer of split (Bier, 1992).
One of the fundamental questions in developmental biology is the role of gene activity in determining tissue fate, and how these activities are carried out both temporally and spatially. An approach to this question employs promoter analysis, the dissection of promoter sequences to find out what elements are responsible for the various genetically controlled tissue expression patterns. For deadpan, central nervous system and peripheral nervous system expression are determined by separate promoter elements. A proximal element is responsible for CNS expression, and within that element, separate regions control neuroblast (neural stem cell) versus neuronal expression. A second upstream element controls PNS expression, by specific repression of CNS expression. Thus deadpan integrates specific information from a variety of spatially and/or temporally restricted upstream regulators (Emery, 1995).
Other pan-neural genes are not required to initiate a pathway, but are needed to regulate the final outcome. Two examples are scratch and elav. These have simpler promoters, able to respond to only a small number of pan-neurally expressed transcription factors. This is reminiscent of a similar situation found in the regulation of primary versus secondary pair-rule genes (Emery, 1995).
The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).
To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).
Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).
During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).
One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).
The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).
Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).
This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).
In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).
Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).
Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).
Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).
Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).
This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).
A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).
A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).
Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).
Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).
EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).
Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).
The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).
EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).
The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).
The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).
In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).
Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).
Runx proteins have been implicated in acute myeloid leukemia, cleidocranial dysplasia, and stomach cancer. These proteins control key developmental processes in which they function as both transcriptional activators and repressors. How these opposing regulatory modes can be accomplished in the in vivo context of a cell has not been clear. The developing cone cell in the Drosophila visual system was used to elucidate the mechanism of positive and negative regulation by the Runx protein Lozenge (Lz). A regulatory circuit is described in which Lz causes transcriptional activation of the homeodomain protein Cut, which can then stabilize a Lz repressor complex in the same cell. Whether a gene is activated or repressed is determined by whether the Lz activator or the repressor complex binds to its upstream sequence. This study provides a mechanistic basis for the dual function of Runx proteins that is likely to be conserved in mammalian systems (Canon, 2003).
To understand negative regulation by the Lz protein, regulation of the deadpan (dpn) gene was investigated. In wild-type eyes, Dpn is expressed in photoreceptors R3/R4 and R7. In lz mutants, dpn is also ectopically activated in cone cells, suggesting that Lz either directly or indirectly represses dpn in these cells. Dpn was therefore used as a marker to investigate negative regulation by Lz (Canon, 2003).
The presence of two perfect consensus Runx protein-binding sites (5'-RACCRCA-3') upstream of the dpn-coding region suggested possible direct negative regulation by Lz. Gel-shift experiments showed that Lz specifically binds to both sites. To determine whether these sequences are required for proper dpn regulation, lacZ reporter constructs were made driven by dpn upstream and intronic fragments, and these were transformed into flies. A 4667-bp upstream fragment plus intron I (227 bp) caused expression of lacZ in R3/R4 and R7 faithfully recapitulating the pattern of wild-type dpn expression in the eye. This site is therefore referred to as the dpn eye enhancer (DEE). When the two Lz-binding sites (LBS) in the DEE were mutated (to 5'-RAAARCA-3'; DEE-MutLBS), lacZ expression was also seen in cone cells. Therefore, lack of Lz binding to this enhancer will cause its derepression in cone cells, establishing that Lz directly represses transcription of dpn in cone cells (Canon, 2003).
Like all Runx proteins, Lz contains the conserved C-terminal pentapeptide motif VWRPY, which binds the global corepressor Groucho (Gro). Gro does not bind DNA on its own, but functions as a repressor for sequence-specific DNA-binding factors. Gro is expressed ubiquitously and has early pleiotropic roles in eye development, such as mediating repression by bHLH proteins, making it difficult to study possible involvement of Gro in cone cell development in loss-of-function mutant clones in the eye. Therefore the Gro-interaction domain at the C terminus of Lz was altered from VWRPY to VWEAA, a change that abrogates Gro binding to bHLH proteins. Lz-EAA protein was then expressed under the control of the endogenous eye-specific lz enhancer and its ability to repress dpn was tested in vivo. Whereas a wild-type lz+ transgene efficiently represses dpn in cone cells, Lz-EAA was unable to keep dpn off in these same cells. Neuronal differentiation occurs normally in both cases as determined by the neural marker Elav. This shows that the C terminus of Lz, a known Gro-interaction domain, is required for Lz-mediated repression of dpn. The activation function of Lz-EAA, as determined by its ability to activate D-Pax2 expression, remains intact. Therefore, Gro mediates repression by Lz as it does for other Runx proteins. It still remained unclear, however, why in the same cell Lz represses dpn transcription while it directly activates D-Pax2. Clearly, the presence of Gro alone does not cause Lz to become a dedicated repressor in the cone cell (Canon, 2003).
Hairy-related proteins constitutively bind Gro through the conserved sequence WRPW, and function as dedicated repressors. To further address the significance of the C terminus of Lz, the C-terminal amino acids of Lz were changed from WRPY to WRPW to resemble Hairy-related repressors. As a correlate, a Lz-VP16 fusion was made, with the potent activation domain of VP16 fused onto the C terminus of Lz. The ability of Lz-WRPW and Lz-VP16 to regulate Lz targets was tested in vivo. Lz-WRPW efficiently represses dpn in cone cells like the wild-type Lz+ but was unable to activate expression of D-Pax2. In contrast, Lz-VP16 failed to repress dpn in cone cells but effectively activates D-Pax2 in cone cells. Therefore, Lz-WRPW functions as a dedicated repressor, and Lz-VP16 as a constitutive activator. These results suggest that Runx-Gro interactions are regulated, because wild-type Runx proteins function as both activators and repressors (Canon, 2003).
The Lz-binding sites in the dpn and D-Pax2 enhancers were compared and distinct differences were found in the neighboring sequences. In the dpn enhancer, each Lz-binding site is followed by AT-rich sequences that are similar to each other (5'-AATCTTT-3' and 5'-TAATCTT-3'). In contrast, sequences near the three Lz-binding sites in the D-Pax2 enhancer, a positively regulated enhancer, are dissimilar and are not as rich in AT sequences. To determine if the difference in these sequences influences the mode of Lz regulation, both AT-rich sequences in the DEE were replaced with the corresponding sequence (GCTG) from the D-Pax2 enhancer. When transformed into flies, the resulting DEE-MutAT enhancer could not support repression of the reporter gene in cone cells. This was the same phenotype that was seen when the Lz-binding sites were mutated in the DEE. In this case, however, alteration of the AT-rich sites had no effect on Lz binding. Therefore, disruption of the AT-rich sequences in the DEE prevents repression of this enhancer by a mechanism that is independent of Lz binding. It is concluded that a cofactor binds to the AT-rich regions next to the Lz-binding sites and is essential for mediating repression of dpn in cone cells (Canon, 2003).
Next, whether it was possible for the dpn enhancer to be repressed independently of the AT-rich sequences was investigated. Lz-WRPW has been shown to function as a dedicated repressor in cone cells. The ability of Lz-WRPW to regulate DEE-MutAT was tested. Significantly, although wild-type Lz failed to repress DEE-MutAT, Lz-WRPW was effective in repressing this enhancer in cone cells. Therefore, Lz-WRPW is able to repress transcription of the DEE without a requirement for the nearby AT-rich sites (Canon, 2003).
The homeodomain protein Cut is expressed specifically in the four cone cells in the eye and has been shown previously to bind AT-rich sequences. The ability of Cut to bind the AT-rich sequences next to the Lz sites in the DEE was tested. Electromobility-shift assays were conducted using probes containing the Lz-binding sites and adjacent AT sequences from the dpn enhancer. Nuclear extracts of cells transfected with a Cut-expressing vector bind the two AT-rich sequences, and this binding is specific as established by competition assays. Further, extracts from cells transfected with both lz and cut cause a supershifted band, indicating that Lz and Cut can bind together to the same probe (Canon, 2003).
To address the in vivo relevance of these results, FLP/FRT-mediated clones were made in the eye that were mutant for the cut locus. Strikingly, Dpn was ectopically expressed in cone cells in the absence of Cut. This provides genetic proof that, in vivo, Cut represses dpn expression in cone cells. Cut is therefore required along with Lz for repression of dpn in these cells (Canon, 2003).
Interestingly, D-Pax2, which is directly activated by Lz, is needed to activate cut in cone cells. Therefore, although indirectly, Lz positively regulates cut. This presents an interesting developmental circuit in which Lz, acting as a transcriptional activator, causes expression of a cofactor that then binds with Lz to convert it into a direct repressor of transcription. Both the presence of the cofactor and binding sites for this cofactor in the controlling regions of an Lz target gene are required for Lz-mediated repression (Canon, 2003).
This model was then tested in R7 cells where both Dpn and Lz are coexpressed. Here, Lz does not repress dpn, presumably because Cut is absent from R7. Consistent with this notion, mis-expression of Cut in R7 cells using lz-Gal4 causes repression of dpn in these cells. This is not a secondary result of a change in cell fate because the expression of the R7 cell-specific marker Prospero remains unchanged in this genetic background (Canon, 2003).
These results add another level of complexity to recent studies demonstrating a combinatorial code whereby a relatively small number of signaling pathways and activated transcription factors work together to generate unique cell fates. In cone cells, the Notch and EGFR pathways are required along with Lz to activate D-Pax2, and therefore cut. In contrast, the combination of these few inputs is not right for activation of cut in the R7 neurons, and therefore dpn is not repressed. The circuit described here demonstrates a higher order of sophistication necessary for a cell to choose between a neuronal and nonneuronal fate using a very limited number of inputs. Using a self-regulated circuit and just two signaling pathways, a single Runx protein is capable of causing opposing effects on different enhancers in the same cell, resulting in a unique fate (Canon, 2003).
These observations suggest that Gro binds proteins with a WRPW motif in a stable manner and causes constitutive repression as seen for both Lz-WRPW and Hairy-related proteins that contain the WRPW motif. In contrast, Gro interaction with the WRPY motif in Runx proteins requires a cofactor, such as Cut, for stabilization. Therefore, repression is regulated as Runx forms a functional repressor complex with Gro only in the presence of the cofactor Cut. This hypothesis was tested in immunoprecipitation (IP) experiments. On its own, Lz weakly interacts with Gro. In the presence of Cut, however, the Lz-Gro interaction is dramatically increased. As expected, Lz-WEAA did not coimmunoprecipitate with Gro, with or without Cut, and Lz-WRPW interacted strongly with Gro, in both the presence and absence of Cut. These results are entirely consistent with all of the in vivo observations: (1) Lz functions as a repressor only in the cells that express the Cut protein; (2) Lz-WRPW, which functions as a constitutive repressor, can repress DEE-MutAT, in spite of the mutant AT-sites and absence of Cut binding; (3) wild-type Lz does not repress DEE-MutAT because Cut cannot bind, and therefore the Lz-Gro complex is not stabilized (Canon, 2003).
Runx proteins have been shown to act as positive and negative regulators. This study, however, is the first to demonstrate that a Runx protein can act as both a direct transcriptional activator and repressor in vivo in the same cell, and that the repressive role requires involvement of the cofactor Cut. The mechanism unraveled here for a Runx protein is similar to that described for a Rel protein, suggesting a common strategy adopted by transcription factors that switch between positive and negative regulation. Furthermore, Cut is conserved in mammals (called CDP or Cux) and has been implicated in the repression of several genes, including osteocalcin (OC). Interestingly, the OC gene is positively regulated by Runx2. These in vitro studies did not investigate a relationship between Runx and Cux. This analysis of dpn repression by Lz and Cut raises the possibility that mammalian Runx proteins may also switch from activation to repression modes through involvement of Cux proteins. If confirmed, such correlations will prove to be important as the mammalian Runx protein AML-1 (Acute Myeloid Leukemia-1) is the most frequent site of translocations that cause leukemia, and human CutL1 is located in a chromosomal region that is often rearranged in cancers, including myeloid leukemia (Canon, 2003 and references therein).
deadpan expression in neuroblasts is regulated by the proneural gene daughterless (Younger-Shepherd, 1992). Late expression in some CNS neurons is independent of daughterless (Bier, 1992).
Neurons and glia are often derived from common multipotent stem cells. In Drosophila, neural identity appears to be the default fate of these precursors. Stem cells that generate either neurons or glia transiently express neural stem cell-specific markers. Further development as glia requires the activation of glial-specific regulators. However, this must be accompanied by simultaneous repression of the alternate neural fate. The Drosophila transcriptional repressor Tramtrack is a key repressor of neuronal fates. It is expressed at high levels in all mature glia of the embryonic central nervous system. Analysis of the temporal profile of Tramtrack expression in glia shows that it follows that of existing glial markers. When expressed ectopically before neural stem cell formation, Tramtrack represses the neural stem cell-specific genes asense and deadpan. Surprisingly, Tramtrack protein levels oscillate in a cell cycle-dependent manner in proliferating glia, with expression dropping before replication, but re-initiating after S phase. Overexpression of Tramtrack blocks glial development by inhibiting S-phase and repressing expression of the S-phase cyclin, cyclin E. Conversely, in tramtrack mutant embryos, glia are disrupted and undergo additional rounds of replication. It is proposed that Tramtrack ensures stable mature glial identity by both repressing neuroblast-specific genes and controlling glial cell proliferation (Badenhorst, 2001).
The timing of Ttk69 shows that it does not initiate glial determination. It has been proposed that Ttk69 is expressed in glia to repress neural identity genes. Lateral glioblasts transiently express neural stem cell markers during their development and can adopt the neuronal fate when the glial-determining pathway is not initiated in gcm mutants. Stable glial identity could require neuronal repression. To determine neuronal-specific genes repressed by Ttk69, an analysis was carried out of how ectopic expression of Ttk69 at various stages of nervous system development affects expression of the hierarchy of neuronal markers. This included the proneural genes of the achaete-scute complex, the pan-neural genes (for example asense) and the mature neuronal markers Elav and the antigen 22C10 (Badenhorst, 2001).
Ectopic expression of Ttk69 at any stage does not prevent neuroblast formation. Thus, expression of Ttk69 before neuroblast formation using Kr-Gal4 does not repress the proneural genes achaete or lethal of scute. Strikingly, however, it does inhibit the pan-neural genes asense, dpn and scratch. Consequently, further neuronal development is inhibited and expression of both mature neuronal markers Elav and 22C10 is ablated. Equivalent results were obtained by ectopically expressing Ttk69 in neuroblasts and their progeny using the sca-Gal4 driver. Such expression almost completely inhibits the normal expression of dpn in the embryonic CNS (Badenhorst, 2001).
If, however, Ttk69 is ectopically expressed after the normal neuroblast expression of asense and deadpan, neurons are not ablated. Thus, directed expression of Ttk69 using elav-Gal4 (which is expressed in all post-mitotic neurons after the phase of pan-neural gene expression does not repress the neural markers Elav, 22C210 or Fasciclin II. This indicates that the neural stem cell-specific genes asense and deadpan are the principal targets of Ttk69 repression in the hierarchy of neural determination. Moreover, neural identity, once conferred, cannot be reversed by Ttk69 overexpression, since Ttk69 expression cannot switch neurons to the alternative glial fate (Badenhorst, 2001).
Deadpan is involved in dosage compensation, the regulation of balance between the function of sex chromosomes and autosomes in both sexes. Deadpan is a negative regulator of Sex-lethal, interacting in this function with scute (Bier, 1992).
Deadpan is implicated in the negative regulation of transcription and has structural affinity to Hairy and Enhancer of split, both of which are involved in negative regulation of neurogenesis (Bier, 1992).
Drosophila sex is determined by the action of the balance between the X chromosome and the autosomes (X:A) on transcription of Sex-lethal, a feminizing switch gene. Loss-of-function mutations in denominator elements of the X:A signal were obtained by selecting for dominant suppressors of a female-specific lethal mutation in the numerator element, sisterlessA (sisA). Ten suppressors were recovered in this extensive genome-wide selection. All were mutations in deadpan, a pleiotropic locus acts as a denominator element. Detailed genetic and molecular characterization is presented of this diverse set of new dpn alleles including their effects on Sxl. Although selected only for impairment of sex-specific functions, all are also impaired in nonsex-specific functions. Male-lethal effects were anticipated for mutations in a major denominator element, but viability of males lacking dpn function is reduced no more than 50% relative to their dpn- sisters. Moreover, loss of dpn activity in males causes only a modest derepression of the Sxl 'establishment' promoter (Sxlpe), the X:A target. By itself, dpn cannot account for the masculinizing effect of increased autosomal ploidy, the effect that gives rise to the concept of the X:A ratio; nevertheless, if there are other denominator elements, these results suggest that their individual contributions to the sex-determination signal are even less than those of dpn. The time course of expression of dpn and of Sxl in dpn mutant backgrounds suggests that dpn is required for sex determination only during the later stages of X:A signaling in males to prevent inappropriate expression of Sxlpe in the face of increasing sis gene product levels (Barbash, 1996).
In addition to deadpan, several other genes encoding transcription factors of the helix-loop-helix (HLH) family: sisterless-b (or as it is also know, scute), daughterless and extramacrochaetae regulate Sex lethal. DA/SIS-B heterodimers bind several sites on the SXL early promoter with different affinities and consequently tune the level of active transcription from this promoter. Repression by the DPN product of DA/SIS-B dependent activation of Sex-lethal results from specific binding of DPN protein to a unique site within the promoter. This contrasts with the mode of emc repression, which inhibits the formation of the DA/SIS-B heterodimers (Hoshijima, 1995).
Basic helix-loop-helix (bHLH) transcription factors are characterized by a conserved four-helix bundle that recognizes a specific hexanucleotide DNA sequence in the major groove. Previous studies have shown that amino acids in the basic region make base-specific contacts, whereas the HLH region is responsible for dimerization. Structural data suggest that portions of the loop region may be proximal to the DNA; however, the role of the loop in DNA-binding affinity and specificity has not been investigated. Protein-DNA recognition by the Drosophila bHLH transcription factor Deadpan was probed using combinatorial solid-phase peptide synthesis methods. A series of bHLH peptide libraries that modulate amino acid content and length in the loop region was screened with DNA and peptide affinity columns, and analyzed using matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS). A functional bHLH peptide with reduced loop length was found, and Lys80 was unambiguously identified as the sole loop residue critical for DNA binding. Unnatural amino acids were substituted at this position to assess contributions of the terminal amino group and the alkyl chain length to DNA-binding affinity and specificity. Using combinatorial solid-phase peptide synthesis methods and MALDI-MS, a key amino acid involved in DNA binding by a bHLH protein has been identified. This approach provides a powerful alternative to current recombinant DNA methods to identify and probe the energetics of protein-DNA interactions (Winston, 2000).
Deadpan may be a negative regulator of the achaete-scute complex. It could do this by directly binding to and inhibiting factors that activate AS-C . This interaction has different conseqences, depending on gender. Important here is the ratio of deadpan to scute. Males carrying wild type scute and a deadpan lethal insertion have never been recovered. Females with three copies of wild type scute but homozygous for the deadpan-mutating insertion have improved viability, whereas females with three copies of wild type deadpan and one copy of wild type scute show reduced viability (Bier, 1992).
Hairy, Deadpan and E(SPL) proteins have three evolutionarily conserved domains required for their function: the bHLH, Orange, and WRPW domains. However, the suppression of Scute activity by Hairy does not require the WRPW domain. The Orange domain is an important functional domain that confers specificity among members of the Hairy/E(SPL) family. A Xenopus Hairy homology conserves not only Hairy's structure but also its biological activity. Transcriptional repression by the Hairy/E(SPL) family of bHLH proteins involves two separable mechanisms: repression of specific transcriptional activators, such as Scute, through the bHLH and Orange domains and repression of other activators via interaction of the C-terminal WRPW motif with corepressors, such as the Groucho protein (Dawson, 1995).
The basic helix-loop-helix domain of the Drosophila transcription factor Deadpan was prepared by total chemical protein synthesis in order to characterize its DNA binding properties. Circular dichroism spectroscopy was used to correlate structural changes in Dpn with physiologically relevant monovalent (KCl) and divalent (MgCl2) cation concentrations. In addition, electrophoretic mobility shift assay (EMSA) and fluorescence anisotropy methods were used to determine equilibrium dissociation constants for the interaction of Dpn with two biologically relevant promoters involved in neural development and sex determination pathways. In this study, DNA binding conditions were optimized for Dpn, and a markedly higher DNA binding affinity was found for Dpn than reported for other bHLH domain transcription factors. Dpn binds as a homodimer (Kd = 2.6 nM) to double-stranded oligonucleotides containing the binding site CACGCG. In addition, Dpn binds with the same affinity to a single or tandem binding site, indicating no cooperativity between adjacent DNA-bound Dpn dimers. DNA binding was also monitored as a function of physiologically relevant KCl and MgCl2 concentrations, and this activity was found to be significantly different in the presence and absence of the nonspecific competitor poly(dI-dC). Moreover, Dpn displays moderate sequence selectivity, exhibiting a 100-fold higher binding affinity for specific DNA than for poly(dI-dC). This study constitutes the first detailed biophysical characterization of the DNA binding properties of a bHLH protein (Winston, 1999).
Yeast SIR2 (Silent Information Regulator 2) is a nicotinamide adenine dinucleotide (NAD)+-dependent histone deacetylase required for heterochromatic silencing at telomeres, rDNA, and mating-type loci. The Drosophila Sir2 also encodes deacetylase activity and is required for heterochromatic silencing, but unlike ySir2, is not required for silencing at telomeres. Drosophila Sir2 interacts genetically and physically with members of the Hairy/Deadpan/E(Spl) family of bHLH euchromatic repressors, key regulators of Drosophila development. Drosophila Sir2 is an essential gene whose loss of function results in both segmentation defects and skewed sex ratios, associated with reduced activities of the Hairy and Deadpan bHLH repressors. These results indicate that Sir2 in higher organisms plays an essential role in both euchromatic repression and heterochromatic silencing (Rosenberg, 2002).
HES family repressors are involved in a number of important developmental processes, including sex determination. Dpn acts as a 'denominator' or negative regulatory element in the process of Drosophila sex determination in which the balance of X-encoded activators, or 'numerator' elements, and autosomally encoded denominator elements regulate the transcription of a master control gene called Sex lethal (Sxl). Sxl activity is required for female development and is expressed in all cells in females, whereas males do not require Sxl activity and do not express active Sxl protein. Loss of Dpn function results in inappropriate activation of Sxl expression, which in turn leads to aberrant dosage compensation and male specific lethality. Since Sir2 interacts physically with Dpn, it is expected that if Dpn requires Sir2 activity to function in sex determination, then lowering Sir2 gene dosage would result in fewer male progeny. Consistent with this hypothesis, a marked decrease is found from the expected number of adult loss-of-function (LOF) Sir2 male progeny and male Sir2 embryos stained for Sxl exhibit ectopic Sxl expression. If Sir2 is involved in assessing the balance of X:A factors in sex determination, it might be expected that overexpression of Sir2 would repress Sxl, resulting in female specific lethality. Indeed, it is found that when Sir2 is overexpressed, female embryos exhibit reduced Sxl expression (Rosenberg, 2002).
In Drosophila, protein kinase CK2 regulates a diverse array of developmental
processes. One of these is cell-fate specification (neurogenesis) wherein CK2 regulates basic-helix-loop-helix (bHLH) repressors encoded by the Enhancer of Split Complex [E(spl)C]. Specifically, CK2 phosphorylates and activates repressor functions of E(spl)M8 during eye development. This study describes the interaction of CK2 with an E(spl)-related bHLH repressor, Deadpan (Dpn). Unlike E(spl)-repressors which are expressed in cells destined for a non-neural cell fate, Dpn is expressed in the neuronal cells and is thought to control the activity of proneural genes. Dpn also regulates sex-determination by repressing sxl, the primary gene involved in sex differentiation. Dpn is weakly phosphorylated by monomeric CKalpha, whereas it is robustly phosphorylated by the embryo holoenzyme, suggesting a positive role for CK2beta. The weak phosphorylation by CK2_ is markedly stimulated by the activator polylysine to levels comparable to those with the holoenzyme. In addition, pull down assays indicate a direct interaction between Dpn and CK2. This is the first demonstration that Dpn is a partner and target of CK2, and raises the possibility that its repressor functions might also be regulated by phosphorylation (Karandikar, 2005).
A subset of E(spl)-repressors, i.e., M5, M7, and M8, robustly interact with CK2alpha (Trott, 2001). In addition, these three proteins are equivalently phosphorylated by monomeric CK2alpha or the holoenzyme at a conserved CK2 site that is located in close proximity to the C-terminal Groucho binding WRPW motif. Furthermore, deletion of the CK2 site (SDCD) or replacement of the CK2 phosphoacceptor in M8 with Asp abolishes interaction, suggesting that the CK2-site might, by itself, confer interaction. Given the overall structural conservation of the HES family, i.e., E(spl), Dpn, and Hairy, the sequence of Dpn was analyzed to determine the presence of CK2 sites and their positional conservation, if any. This analysis revealed the presence of two potential sites, i.e., S9DDD and S408DCS411LDE. While the N-terminal site satisfies the requirement for an Asp/Glu at the n+1 and n+3 positions, the C-terminal site is lacking Asp/Glu at the n + 1. However, it is noted that a number of substrates where the n + 1 position is not an Asp/Glu have been identified. In Dpn, the first site is adjacent to the basic domain and harbors a single potential phosphoacceptor (Ser9). In contrast, the second site is located in the vicinity of the Groucho binding WRPW motif and contains two potential phosphoacceptors (Ser408 and Ser411) that might be subject to hierarchical phosphorylation by CK2. Interestingly, the second site localizes to a region of Dpn which, although hypervariable amongst HES members, is positionally conserved in a number of repressors (M5/7/8, Hes6, etc.). In the case of M8 and its murine homolog Hes6, this site is targeted by CK2 in vitro, and its perturbation dramatically affects Hes6 and M8 repressor activity in vivo (Karandikar, 2005).
Given the strong two hybrid interaction of E(spl)M5/7/8 with CK2, and the fact that interaction required integrity of the CK2 site, it was asked whether Dpn is also a partner of CK2. However, in an explicit test it was observed that strength of the (two hybrid) interaction between LexA-Dpn and AD-CK2alpha appears marginal when compared to that between LexA-M8 and AD-CK2alpha. This result is surprising because Dpn contains two CK2 sites, both of which are significantly more acidic than the single site in M5/7/8. It was reasoned that the significantly attenuated Dpn-CK2alpha interaction might reflect attenuated expression and/or instability of Dpn in yeast, or, perhaps, its ability to act as a repressor in yeast. An alternative possibility is that this interaction also requires CK2beta. If so, a direct biochemical route might be more informative to assess targeting of Dpn by CK2 (Karandikar, 2005).
To test if Dpn is a CK2 target an in vitro phosphorylation assay was performed. GST and GST-Deadpan were subjected to phosphorylation using purified monomeric CK2alpha or CK2 holoenzyme. The former isoform is relevant to the two hybrid analysis, whereas the latter isoform mimics the environment most likely to be encountered in vivo and thus might be considered to be physiologically more relevant. The results indicate that GST-Dpn is phosphorylated weakly by monomeric CK2alpha, whereas it was robustly phosphorylated by the embryo-holoenzyme. No phosphorylation of the GST affinity tag was observed for either isoform of CK2. These results suggest that phosphorylation of Dpn by CK2 is positively influenced by the beta subunit, and might explain its 'weak' interaction with CK2alpha in yeast. It is not considered likely that Dpn interacts exclusively via CK2beta, because CK2alpha exhibits phosphorylation of this bHLH protein, albeit weakly. The more likely scenario is that the Dpn interacts with CK2 via a binding site encompassing both subunits, i.e., the holoenzyme. Because this is the in vivo conformation of CK2 strengthens the notion that Dpn is a CK2 target. Comparative kinetic analysis with the two isoforms will be needed to address how CK2beta enhances interaction and phosphorylation of Dpn (Karandikar, 2005).
Although the phosphorylation analysis suggests that Dpn interacts preferentially with the holoenzyme, two hybrid analysis with this isoform per se has been precluded because yeast strains that express equivalent amounts of CK2alpha and CK2beta are currently unavailable. Therefore the ability of Dpn to form a direct complex with embryo-CK2 or CK2alpha was assessed. GST-alone and GST-Dpn were purified, immobilized on glutathione-sepharose, and tested for complex formation with the two isoforms of CK2. The presence of CK2 in the bound (pellet) and unbound (supernatant) fractions was assessed by Western blotting using an antisera that recognizes both (alpha and beta) subunits of CK2. Incubation of GST-Dpn beads withCK2alpha resulted in a minor amount of immunoreactive material in the pellet. In contrast, incubation of GST-Dpn beads with embryo-CK2 resulted in significantly greater amounts of immunoreactive material in the pellet, demonstrating that Dpn and CK2-holoenzyme interact directly. These binding data appear to qualitatively mirror the phosphorylation data, and it is estimated that ~20% of the holoenzyme interacted with Dpn. Given the experimental conditions of these assays, CK2-holoenzyme contributed half the amount of catalytic subunit compared to CK2alpha alone, suggesting that complex formation appears to be relatively efficient for the holoenzyme. These results demonstrate that the Dpn-CK2 interaction is direct. In addition, complex formation occurs in the absence of MgATP, in line with previous analysis of the interaction of this enzyme with M5/7/8, ZFP35, etc (Karandikar, 2005).
The observations of a direct CK2-Dpn complex and its preferential phosphorylation by the holoenzyme, suggest a positive role for CK2beta. The marginal ability of CK2alpha to phosphorylate Dpn, and the fact that CK2beta mediates activation by polybasic effectors, led to an assessment of whether phosphorylation was responsive to polybasic activation. The marginal phosphorylation of Dpn by CK2alpha was unaffected by either spermine or protamine, but was dramatically stimulated by poly(DL)lysine. The stimulatory effects of poly(DL)lysine are not due to non-specific phosphorylation, because GST is not phosphorylated in its presence. In contrast, phosphorylation of Dpn by embryo-CK2 was unresponsive to further activation by these effectors. These results suggest that phosphorylation of Dpn by embryo-CK2 is unresponsive to further activation, and support the notion that substrates that are efficiently phosphorylated, e.g., the RII subunit of PKA, topoisomerase II, etc., are generally refractory to these activators (Karandikar, 2005).
While the mechanism by which Dpn functions during neurogenesis remains to be resolved, its role(s) during sex determination is much better understood. In either case, however, one common feature of its functions is antagonism of ASC, whereby Dpn represses transcription of ASC via DNA-binding. In line with this, ectopic expression of dpn reduces ASC activity, suggesting a negative interaction between these two loci. It is noteworthy that a similar function is ascribed to HES repressors as well, although in their case DNA-binding as well as direct interactions with proneural factors (ASC and Atonal) are known to be required for antagonism (Karandikar, 2005).
How might phosphorylation of Dpn regulate its in vivo
functions? It is difficult to propose this with certainty based solely on in vitro analysis. However, based on the extensive body of genetic and molecular analysis on Dpn to date, and the emerging notion that CK2 profoundly influences the activity of the related repressor, E(spl)M8, during eye development (Karandikar, 2004), some possibilities can be predicted. As stated above, CK2 phosphorylation regulates repressor activity of M8 and replacement of the phosphoacceptor with Asp generates a dominant allele that is severely exacerbated for its antineurogenic functions. A similar CK2 dependent mechanism might also underlie the interaction of M8 with the ASC-bHLH activator, Lethal of Scute. In a similar vein, it is conceivable that phosphorylation of Dpn might augment its ability to antagonize ASC-derived bHLH activators by either modulating DNA binding or direct protein-protein interactions. CK2 is known to regulate DNA-binding as well as protein-protein interactions (Karandikar, 2005).
The development of nervous system is regulated by the interplay between proneural proteins and their repressors. A general strategy during neurogenesis appears to be the conferring of neural potential on a field of cells, from which arises a precise pattern of neural and accessory cell fates through this interplay and, as such, this mechanism also appears to be involved in other cell fate decisions. It is increasingly becoming apparent that cell fate choice is unlikely to be based simply on the levels of an activator versus its cognate repressor. Rather, this interplay must also be modulated in a spatial and temporal context. In such a scenario, regulation of protein turnover, presence or absence of cofactors, and regulatory modifications, are among those factors that might provide a means to achieve 'fine tuning' of this interplay. In this context, protein kinases and/or phosphatases might provide a simple bistable mechanism to 'fine tune' the developmental outcome. Such a mechanism is beginning to emerge for regulation of repression by E(spl)M8 and its mammalian counterpart, Hes6. In both, phosphorylation by CK2 regulates their ability to interact with and antagonize proneural factors. Given the expanding repertoire of HES proteins that are targeted by CK2, it would not come as a surprise that a similar mechanism might also be employed for regulation of another HES member, Dpn (Karandikar, 2005).
Among the HESmembers that are CK2targets, Dpn differs from E(spl) in a number of ways. While E(spl) transcription [by Su(H)] occurs in response to an activated Notch receptor, Dpn has been thought to be Notch-independent, although it contains binding sites for Su(H) in a region that recapitulates PNS/CNS specific expression. Furthermore, E(spl) repressors block proneural proteins in cells undergoing lateral inhibition, whereas Dpn achieves a similar outcome but in neural cells. The remarkable conservation of CK2 by itself, and its ability to modulate the activity of repressors in different developmental contexts might be indicative of its selection as a general modulator of cell fate determination (Karandikar, 2005).
See the embryonic expression pattern of dpn at the Berkeley Drosophila Genome Project Patterns of Gene Expression Site.
Zygotic expression of deadpan at the syncytial stage is found at low levels throughout the embryo, with the exception of the pole cells. deadpan transcription soon fades, but then reappears in a striped pattern during the middle of cell cycle 13, with 8 stripes of cells arrayed along the anterior-posterior axis. deadpan transcripts are concentrated in the apical region of expressing cells. This pattern fades and deadpan is then expressed in neuroectodermal cells, confined to neuroblasts. By 7 hours all neuroblasts express deadpan, but again this fades as primary neural precursors disappear. Finally deadpan is again expressed in the peripheral and central nervous systems as neurons begin to differentiate (Bier, 1992).
deadpan is expressed at several stages prior to neurogenesis. The earliest zygotic expression occurs in the precellular blastoderm during nuclear division cycle 13 and is nearly ubiquitous. This initial zygotic expression has been found to be involved in sex determination, acting as an autosome counting element to set the X/A ratio. dpn is then expressed in a transient gap gene-like pattern, from which emerges a set of eight pair-rule stripes. No function is apparent for this pair-rule pattern of dpn expression. dpn expression fades as germband extension begins and reappears shortly, in a set of proneural-like patches prior to the first neural precursor delaminations. Expression is quickly limited to these S1 neuroblasts as they delaminate. As further neuroblasts delaminate, they also begin expressing dpn. By late germband extension, dpn expression in CNS neuroblasts consists of a 'rosette' pattern of dpn-expressing cells in each hemisegment. The absence of labelled cells in the center of the rosettes is attributed to the lack of dpn expression in GMCs based on the following evidence: dpn is not expressed in identified secondary precursors of the PNS; dpn has been shown to be absent from GMCs when they can be easily visualized during larval development; and only large cells with the appearance of neuroblasts are visualized with either endogenous dpn probes or the reporter gene probes at early stages of development. Although dpn expression from some GMCs cannot be strictly excluded, absence of expression in these cells is the most likely basis for the differences between dpn and scrt expression during stage 11. At this stage, the first PNS precursors delaminate as one, then two dpn-expressing cells per hemisegment. During embryonic stage 12 (germband retraction), subsequent groups of primary PNS precursors delaminate and express dpn. Secondary PNS precusors do not appear to express dpn. This fact is most clearly evident in the transient expression of dpn in the first PNS precursor cells (A and P cells), which disappear before the next PNS precursors are formed. Thus, in these cells, dpn expression is lost either prior to the cell division, giving rise to secondary precursors, or shortly after this division. After complete germband retraction, postmitotic neurons in both CNS and PNS again express dpn for a brief period prior to developing their final morphologies. dpn expression then fades and is not expressed again until the third larval instar (Emery, 1995).
In leg imaginal discs, deadpan is expressed in non-neuronal cells, forming a pattern resembling that of hairy (Bier, 1992).
Mammalian neural stem cells generate transit amplifying progenitors that expand the neuronal population, but these type of progenitors have not been studied in Drosophila. The Drosophila larval brain contains 100 neural stem cells (neuroblasts) per brain lobe, which are thought to bud off smaller ganglion mother cells (GMCs) that each produce two post-mitotic neurons. This study used molecular markers and clonal analysis to identify a novel neuroblast cell lineage containing transit amplifying GMCs (TA-GMCs). TA-GMCs differ from canonical GMCs in several ways: each TA-GMC has nuclear Deadpan, cytoplasmic Prospero, forms Prospero crescents at mitosis, and generates up to 10 neurons; canonical GMCs lack Deadpan, have nuclear Prospero, lack Prospero crescents at mitosis, and generate two neurons. It is concluded that there are at least two types of neuroblast lineages: a Type I lineage where GMCs generate two neurons, and a type II lineage where TA-GMCs have longer lineages. Type II lineages allow more neurons to be produced faster than Type I lineages, which may be advantageous in a rapidly developing organism like Drosophila (Boone, 2008).
During a clonal analysis of a larval neuroblast self-renewal mutant it was realized that wild type brains have two distinct types of neuroblast lineages. Mosaic analysis with repressible cell marker (MARCM) was used to generate GFP-marked single cell clones in the larval brain. Depending on the cell in which chromosomal recombination occurs, it is possible to label a single neuroblast and all its progeny, a single GMC and all its progeny, or a single neuron derived from a terminal mitosis. A low density of clones was induced randomly throughout the brain at either mid-first or mid-second larval instar and all clones were assayed 48 h after induction. Two distinct neuroblast lineages were found: a 'Type I' lineage that matches previously reported neuroblast lineages, and a novel 'Type II' lineage that is larger and more complex (Boone, 2008).
Type I neuroblast clones always contained one large neuroblast near the surface of the brain that had nuclear Dpn and cytoplasmic Pros. These clones always contained a column of smaller cells that lacked Dpn and had nuclear Pros, with the occasional presence of a single Dpn+ small cell contacting the neuroblast, which is likely to be a newborn GMC. The cells furthest from the neuroblast were Dpn Pros mature neurons that extend GFP1 axons into the central brain. Type I neuroblast lineages are the sole occupants of the dorsoanterior lateral (DAL) brain region, but can also be found in all other brain regions. To minimize regional variation in neuroblast lineages. Analysis of Type I neuroblasts was restricted to the DAL region (Boone, 2008).
Type I GMC clones were assayed only in the DAL region, where no Type II neuroblasts were observed. All clones lacking a large Dpn+ neuroblast were considered to be GMC clones, and these GMC clones generated at most just two cells. Thus, Type I lineages are identical to those reported for Drosophila embryonic neuroblasts, larval mushroom body neuroblasts, and grasshopper neuroblasts (Boone, 2008).
Type II neuroblast clones always contained one large Dpn+ neuroblast near the surface of the brain, but also contained a distinctive group of small Dpn+ cells that lack nuclear Pros. There are also usually 1-2 small cells in direct contact with the neuroblast that lack both Dpn and nuclear Pros. These two types of small cells are never observed in Type I clones and are a defining feature of Type II clones. Type II neuroblast clones are found in several brain regions, including a cluster within the DPM region. One Type II neuroblast appears to be the previously identified DPMpm1 neuroblast based on its distinctive axon projection that bifurcates over the medial lobe of the mushroom body before crossing the midline (Boone, 2008).
Type II GMC clones were identified by the lack of a large Dpn+ neuroblast. All brain regions that contained Type II neuroblast lineages produced GMC clones of greater than two cells; all brain regions that lacked Type II neuroblast lineages never generated >2 cell GMC clones. Type II GMC clones often contained Dpn+ Proscyto small cells that are unique to Type II neuroblast lineages, confirming that these clones are sublineages of a Type II neuroblast lineage. It is concluded that Type II neuroblasts generate GMCs that produce more than two neurons. Because Type II GMC clones could generate several fold more neurons than a Type I GMC, they were called 'transit amplifying GMCs' or TA-GMCs (Boone, 2008).
TA-GMC clones also contained small cells with nuclear Pros; it is suggested that these cells are equivalent to Type I GMCs based on their cell division profile, and because two cell clones were observed in regions of the brain that contained Type II neuroblast lineages. However, the possibility that some of these nuclear Pros cells are post-mitotic immature neurons cannot be ruled out (Boone, 2008).
If Type II lineages generate TA-GMCs that make an average of twice as many neurons as a Type I lineage, it would be expected that Type II lineages generate approximately twice as many cells over the same timespan compared with Type I lineages. Indeed, it was found that when Type I or Type II clones are grown for the same length of time (between clone induction and analysis), Type II clones generate approximately twice as many neurons. Type I clones in the DAL generate 40.4 +/ 3.1 cells, whereas Type II lineages in the DPM generate 71.2 +/- 6.3 cells . In all cases the final Type I and Type II neuroblast clones contained a single large Dpn+ neuroblast, ensuring that only single neuroblast clones were counted. It is concluded that Type II TA-GMCs generate more neurons than Type I GMCs, and that Type II lineages generate more neurons than Type I lineages (Boone, 2008).
This study characterized the cell division patterns within Type I and Type II lineages to help understand the relationship between different cell types in a lineage. It was first asked what cell type is directly produced by Type I and Type II neuroblasts? Type I neuroblasts in the DAL region always segregate Pros protein into the newborn GMC resulting in easily detectable levels of Pros in neuroblast progeny. Thus, Type I neuroblasts in the DAL generate nuclear Pros+ GMCs, as previously reported. In contrast, Type II neuroblasts of the DPM region often fail to segregate Pros protein, despite proper localization of other apical/ basal proteins, which would account for reduced Pros levels in newborn progeny. The variation in Pros localization among DPM neuroblasts could be due to the presence of some Type I neuroblasts in the region, or actual variation among Type II neuroblasts. It is concluded that Type II neuroblasts divide asymmetrically, but can fail to segregate Pros protein into their newborn progeny (Boone, 2008).
Next, the relationship between the Type II small cells that have high Dpn, low Pros (Dpn+ Proscyto) and those that contain high Pros, but no Dpn (Dpn- Prosnucl), was investiged. It was found that mitotic Dpn+ small cells always form Mira/Pros cortical crescents, with Pins protein localized to the opposite cortical domain, and the spindle aligned along this cortical polarity axis. This type of division is unique to Type II lineages, as all Type I GMCs always showed diffuse cytoplasmic Pros during mitosis. It is concluded that Type II Dpn+ small cells undergo molecularly asymmetric cell divisions to generate a Pros+ sibling and a Pros- sibling. It is proposed that the sibling with little or no Pros remains a Dpn+ TA-GMC, whereas the Pros+ sibling generates one or two post-mitotic neurons, similar to Pros+ GMCs in Type I lineages (Boone, 2008).
To characterize the cell cycle kinetics of Type I GMCs and Type II TA-GMCs, BrdU labeling experiments were performed. Larvae were exposed to a 4.5 h BrdU pulse and then immediately fixed and assayed for BrdU incorporation. As expected, both Type I and Type II neuroblasts always incorporated BrdU. Type I neuroblasts showed only a few closely-associated GMCs labeled, whereas Type II neuroblasts had a much larger number of labeled progeny. It is unlikely that the Type II neuroblasts generate all of these progeny during the 4.5 h labeling window, because the shortest neuroblast cell cycle time observed in any brain region was ~50 min, and thus it is concluded that Type II neuroblast progeny undergo more rounds of cell division that Type I GMCs (Boone, 2008).
To determine if the proliferative Type II neuroblast progeny are competent to differentiate into neurons, a BrdU pulse/chase experiment was performed. Larvae were fed BrdU for 4.5 h as described above, but then allowed to develop for 18 h without BrdU. Type I neuroblasts lacked BrdU incorporation, as expected due to label dilution during the chase interval, but BrdU was maintained in the Elav1 post-mitotic neurons born during the pulse window. Type II neuroblasts and most of their progeny also diluted out BrdU, confirming their status as proliferative cells, and some Elav1 post-mitotic neurons were born during the pulse interval and maintained BrdU labeling. It is concluded that Type II neuroblast progeny are proliferative but can still give rise to differentiated neurons (Boone, 2008).
There are currently no molecular markers that can be used to unambiguously identify Type II neuroblasts. The inability to form Pros crescents may be shared by all Type II neuroblasts, but even so, it would only be a useful marker for mitotic neuroblasts. In the DPM brain region (enriched for Type II lineages) it was found about 50% of the mitotic neuroblasts have little or no Pros crescent, and based on the distinctive lack of Pros in some Type II neuroblast progeny, it is concluded that these are Type II neuroblasts. (The 50% of the DPM neuroblasts that form Pros crescents may be Type I neuroblasts within the region, a special subset of Type II neuroblasts, or there may be stochastic variability in Pros crescent-forming ability among Type II neuroblasts.) In any case, these findings may explain why some labs report seeing Pros crescents whereas others report that neuroblasts do not form Pros crescents; both are correct because there are two types of larval neuroblast lineages (Boone, 2008).
It is unknown whether neuroblasts can switch back and forth between Type I and Type II modes of cell lineage. If the level of Pros in the neuroblast is the key factor distinguishing these modes of division, then experimentally raising Pros levels in Type II lineages may switch them to Type I lineages; conversely, reducing Pros levels in Type I lineages may switch them to Type II lineages. As more brain neuroblasts become uniquely identifiable it will be interesting to address this question. It will also be interesting to search for Type II neuroblast lineages in other insects or crustaceans where Type I neuroblast lineages have been documented (Boone, 2008).
What terminates the TA-GMC lineage? The TA-GMC may fall below a size threshold for continued proliferation. Alternatively, TA-GMCs may lose contact with a niche-derived signal that maintains their proliferation; Hedgehog, Fibroblast growth factor, and Activin are all required for larval brain neuroblast proliferation, but none have been tested for a role in TA-GMC proliferation. Lastly, there may be lineage-specific factors segregated into the TA-GMCs that limit their mitotic potential. TA-GMCs may die at the end of their lineage, as do some neuroblasts, or they may differentiate. It has been shown that loss of Pros and Brat together can generate a more severe neuroblast tumor phenotype than either alone. This suggests that the Type II lineages may be especially sensitive to further loss of differentiation promoting factors due to their low levels of endogenous Pros. Indeed, a dramatic neuroblast tumor phenotype has been observed in type II lineages in lethal giant discs mutants. This raises the question of how Type II lineages benefit the fly. They have the ability to generate more neurons in a faster period of time, due to the presence of TA-GMCs, and may be an evolutionary adaptation to the rapid life cycle of Drosophila. Slower developing insects may not require such rapid modes of neurogenesis (Boone, 2008).
deadpan mutants die at various stages of development, but there are no consistant morphological defects (Bier, 1992).
scratch interacts genetically with deadpan. These two genes have similar pan-neural expression patterns but encode unrelated proteins. Loss of function of either of these genes alone does not lead to obvious morphological disruption of the embryonic nervous system. Under optimal conditions, animals homozygous null for each of these genes occasionally complete development and eclose. In contrast, animals null for both genes never hatch and frequently exhibit a dramatic reduction of the nervous system. In addition, axon projections are frequently disorganized. Double mutants have missing and disorganized longitudinal and commissural axon tracts. CNS defects are evident early during neurogenesis as there are fewer hunchback expressing cells contributing to the S1 wave of neuroblasts than in wild type embryos (Roark, 1995).
Dendrite arborization patterns are critical determinants of neuronal function. To explore the basis of transcriptional regulation in dendrite pattern formation, RNA interference (RNAi) was used to screen 730 transcriptional regulators and 78 genes involved in patterning the stereotyped dendritic arbors of class I da neurons were identified in Drosophila. Most of these transcriptional regulators affect dendrite morphology without altering the number of class I dendrite arborization (da) neurons and fall primarily into three groups. Group A genes control both primary dendrite extension and lateral branching, hence the overall dendritic field. Nineteen genes within group A act to increase arborization, whereas 20 other genes restrict dendritic coverage. Group B genes appear to balance dendritic outgrowth and branching. Nineteen group B genes function to promote branching rather than outgrowth, and two others have the opposite effects. Finally, 10 group C genes are critical for the routing of the dendritic arbors of individual class I da neurons. Thus, multiple genetic programs operate to calibrate dendritic coverage, to coordinate the elaboration of primary versus secondary branches, and to lay out these dendritic branches in the proper orientation (Parrish, 2006; Full text of article).
To assay for the stereotyped dendrite arborization pattern of class I da neurons (hereafter referred to as class I neurons) in RNAi-based analysis of dendrite development, a Gal4 enhancer trap line (Gal4221) was used that is highly expressed in class I neurons and weakly expressed in class IV neurons during embryogenesis. Because of the simple and stereotyped dendritic arborization patterns of the dorsally located ddaD and ddaE, the studies of dendrite development focused on these two dorsally located class I neurons (Parrish, 2006).
To establish that RNAi is an efficient method to systematically study dendrite development in the Drosophila embryonic PNS, it was demonstrated that injecting embryos with double-stranded RNA (dsRNA) for green fluorescent protein (gfp) is sufficient to attenuate Gal-4221-driven expression of an mCD8::GFP fusion protein as measured by confocal microscopy. Next whether RNAi could efficiently phenocopy loss-of-function mutants known to affect dendrite development was tested. Similar to the mutant phenotype of short stop (shot), which encodes an actin/microtubule cross-linking protein, shot(RNAi) caused routing defects, dorsal overextension, and a reduction in lateral branching of dorsally extended primary dendrites. Likewise, RNAi of sequoia or flamingo resulted in overextension of ddaD and ddaE, RNAi of hamlet resulted in supernumerary class I neurons, and RNAi of tumbleweed resulted in supernumerary class I neurons and a range of arborization defects, consistent with the reported mutant phenotypes. Thus, RNAi is effective in generating reduction of function phenotypes in embryonic class I dendrites (Parrish, 2006).
In addition to genes with functions in promoting dendrite arborization, 20 group A genes were identified that regulate dendrite arborization by limiting dendrite growth and/or branching. Consistent with recent reports that loss of function of the BTB/POZ domain TF abrupt (ab) causes an increase in dendritic branching and altered distribution of branches, it was found that ab(RNAi) altered the arborization of class I dendrites. ab(RNAi) caused an increase in the number and length of lateral branches, expanding the coverage field most noticeably along the anteroposterior (AP) axis. In addition to these defects, ab(RNAi) also caused frequent cell death, consistent with the phenotype observed for a hypomorphic allele of ab (Parrish, 2006).
Increased dendritic branching also resulted from RNAi of several genes known to affect nervous system development, including Adh transcription factor 1 (Adf1), the zinc finger TF nervy (nvy), the basic helixloophelix (bHLH) TF deadpan (dpn), as well as genes not previously known to affect neuronal function, such as the putative transcription elongation factor Elongin c. Both Adf1 and dpn mutants have defects in larval locomotion and, in light of recent findings suggesting that da neurons may regulate aspects of larval locomotion, it is possible that dendrite defects underlie these behavioral defects. Consistent with its role in class I dendrite development, dpn is expressed in all PNS neurons. Likewise, nervy has been implicated in regulation of axon branching in motorneurons and is apparently expressed in most neurons. Thus, nervy likely regulates multiple aspects of neuronal differentiation. Finally, Elongin C may regulate transcriptional elongation but also likely functions as a component of a multimeric protein complex that includes the von Hippel-Lindau (VHL) tumor suppressor and targets specific proteins for poly-ubiquitination and degradation. Moreover, BTB/POZ domain proteins (such as cg1841 and ab) function as substrate adaptors for cullin E3 ligases. Interestingly, RNAi of a Drosophila homolog (tango) of a known VHL substrate (HIF-1) also affected dendrite arborization. It thus appears that protein degradation pathways regulate dendrite arborization (Parrish, 2006).
Badenhorst, P. (2001). Tramtrack controls glial number and identity in the Drosophila embryonic CNS. Development 128: 4093-4101. 11641231
Barbash, D. A. and Cline, T. W. (1995). Genetic and molecular analysis of the autosomal component of the primary sex determination signal of Drosophila melanogaster. Genetics 141(4): 1451-71. PubMed citation: 8601486
Bier, E., Vassin, H., Younger-Shepherd, S., Jan, L.Y. and Jan, Y.N. (1992). deadpan, an essential pan-neural gene in Drosophila, encodes a helix-loop-helix protein similar to the hairy gene product. Genes Dev. 6: 2137-2151. PubMed citation: 1427077
Boone, J. Q. and Doe, C. Q. (2008). Identification of Drosophila type II neuroblast lineages containing transit amplifying ganglion mother cells. Dev Neurobiol. 68(9): 1185-1195. PubMed citation: 18548484
Brody, T., Rasband, W., Baler, K., Kuzin, A., Kundu, M. and Odenwald, W. F. (2008). Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers. BMC Genomics 9: 371. PubMed Citation: 18673565
Canon, J. and Banerjee, U. (2003). In vivo analysis of a developmental circuit for direct transcriptional activation and repression in the same cell by a Runx protein. Genes Dev. 17: 838-843. 12670867
Dawson, S. R., et al. (1995). Specificity for the hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression. Mol Cell Biol 15: 6923-6931. PubMed citation: 8524259
Emery, J.F. and Bier, E. (1995). Specificity of CNS and PNS regulatory subelements comprising pan-neural enhancers of the deadpan and scratch genes is achieved by repression. Development 121: 3549-3560. PubMed citation: 8582269
Hoshijima, K., et al. (1995). Transcriptional regulation of the Sex-lethal gene by helix-loop-helix proteins. Nucleic Acids Res 23: 3441-3448. PubMed citation: 7567454
Karandikar, U., Trott, R. L., Yin, J., Bishop, C. P. and Bidwai, A. P. (2004). Drosophila CK2 regulates eye morphogenesis via phosphorylation of E(spl)M8. Mech. Dev. 121: 273-286. 15003630
Karandikar, U. C., Shaffer, J. Bishop, C. P. and Bidwai, A. P. (2005). Drosophila CK2 phosphorylates Deadpan, a member of the HES family of basic-helix-loop-helix (bHLH) repressors. Molec. Cell. Biochem. 274: 133-139. 16342413
Parrish, J. Z., Kim, M. D., Jan, L. Y. and Jan, Y. N. (2006). Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites. Genes Dev. 20(7): 820-35. Medline abstract: 16547170
Roark, M., et al. (1995). scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development. GenesDev. 9: 2384-98. PubMed citation: 7557390
Rosenberg, M. I. and Parkhurst, S. M. (2002). Drosophila Sir2 is required for heterochromatic silencing and by euchromatic Hairy/E(Spl) bHLH repressors in segmentation and sex determination. Cell 109: 447-458. 12086602
Trott, R. L., Kalive, M., Paroush, Z. and Bidwai, A. P (2001). Drosophila melanogaster casein kinase II interacts with and phosphorylates the basic-helix-loop helix (bHLH) proteins m5, m7, and m8 derived from the Enhancer of split complex. J. Biol. Chem. 276: 2159-2167. 11208814
Wallace, K., Liu, T. H. and Vaessin, H. (2000). The pan-neural bHLH proteins DEADPAN and ASENSE regulate mitotic activity and cdk inhibitor dacapo expression in the Drosophila larval optic lobes. Genesis 26(1): 77-85. PubMed citation: 10660675
Winston, R. L., et al. (1999). Characterization of the DNA binding properties of the bHLH domain of Deadpan to single and tandem sites. Biochemistry 38(16): 5138-46. PubMed citation: 10213619
Winston, R. L. and Gottesfeld, J. M. (2000). Rapid identification of key amino-acid-DNA contacts through combinatorial peptide synthesis. Chem. Biol. 7(4): 245-51. PubMed citation: 10780928
Younger-Shepherd, S., Vassin, H., Bier, E., Jan, L.Y. and Jan, Y.N. (1992). deadpan, an essential pan-neural gene encoding an HLH protein, acts as a denominator in Drosophila sex determination Cell 70: 911-922. PubMed citation: 1525829
Date revised: 15 November 2008Home page: The Interactive Fly © 1995, 1996 Thomas B. Brody, Ph.D.
The Interactive Fly resides on the
Society for Developmental Biology's Web server.