snail


REGULATION

Promoter Structure

snail expression during neurogenesis evolves from segmentally repeated neuroectodermal domains forming a pan-neural pattern. A 2.8 kb regulatory region of the sna promoter drives LacZ expression in a faithful neuronal pattern. Deletion analysis of this region indicates that the pan-neural element is composed of separable CNS and PNS components. This finding is unexpected since all known genes controlling early neurogenesis, including the proneural genes (i.e. da and AS-C), are expressed in both the CNS and PNS. Expression of sna during neurogenesis is largely independent of the proneural genes da and AS-C. The separate control of CNS and PNS sna expression and independence of proneural gene regulation add to a growing body of evidence that current genetic models of neurogenesis are substantially incomplete (Ip, 1994b).

cis-Decoder discovers constellations of conserved DNA sequences shared among tissue-specific enhancers

A systematic approach is described for analysis of evolutionarily conserved cis-regulatory DNA using cis-Decoder, a tool for discovery of conserved sequence elements that are shared between similarly regulated enhancers. Analysis of 2,086 conserved sequence blocks (CSBs), identified from 135 characterized enhancers, reveals most CSBs consist of shorter overlapping/adjacent elements that are either enhancer type-specific or common to enhancers with divergent regulatory behaviors. These findings suggest that enhancers employ overlapping repertoires of highly conserved core elements (Brody, 2007).

Analysis of mammalian cis-regulatory sequences included 14 neural and 21 mesodermal enhancers whose regulatory behaviors have been characterized in developing mouse embryos. EvoPrints of these enhancers included orthologs from placental mammals (human, chimp, rhesus monkey, cow, dog, mouse, rat) or also included the opossum; these species afford enough additive divergence (~200 My) to resolve most enhancer Multi-Species Conserved Sequences (MCSs). When possible, chicken and frog orthologs were also included in the EvoPrints. Except when EvoDifference profiles revealed sequencing gaps or genomic rearrangements in one or more species that were not present in the majority of the different orthologous DNAs, pair-wise reference species versus test species readouts from all of the above BLAT formatted genomes were used to generate the EvoPrints (Brody, 2007).

Using the EvoPrint-Parser program, both forward and reverse-complement sequences of each enhancer CSB of 6 bp or greater were extracted, named and consecutively numbered. Based on their enhancer regulatory expression pattern, CSBs were grouped into two different CSB-libraries, neural and mesodermal. Although there exists a distinction between expression in either neural or mesodermal tissues, each of the CSB-libraries represent a heterogeneous population of enhancers that drive gene expression in different cells and/or different developmental times in these tissues. For this study, CSBs of 5 bp or less were not included in the analysis. Although these shorter CSBs, particularly the 5 and 4 bp CSBs, are most likely important for enhancer function, the use of CSBs of 6 bp or larger (representing greater than 80% of the conserved MCS sequences) is sufficient to resolve sequence element differences between enhancers that regulate divergent expression patterns. A total of 286 neural CSBs and 289 mesodermal CSBs were extracted from the mammalian enhancers (Brody, 2007).

For Drosophila, three CSB-libraries, neural, segmental and mesodermal, were generated from CSBs identified by EvoPrinting : neural enhancers included those regulating both CNS and peripheral nervous system (PNS) determinants; segmental enhancers included those regulating both pair-rule and gap gene expression; and mesodermal enhancers included those regulating both presumptive and late expression. Many of the D. melanogaster reference sequences used to initiate the EvoPrints were curated from the regulatory element database REDfly, while others were identified from their primary reference. The collection of neural enhancers includes both those that direct expression during early development, such as the snail , scratch, and deadpan CNS and PNS enhancers, and late nervous system regulators, such as the eyeless enhancer ey12, which confers expression in the adult brain. The early embryonic segmental enhancers represent pair-rule regulators such as the hairy stripe 1 and even-skipped stripe 1 enhancers, and gap expression regulators, such as the hunchback enhancers. The mesodermal enhancers include those directing mesodermal anlage expression of snail and tinman , and late expressing enhancers, such as those directing serpent fat body expression and mesodermal expression of Sex combs reduced. The collective evolutionary divergence of all of the EvoPrints was greater than 100 My and in most cases EvoPrints represented over approximately 160 My of additive divergence. The average CSB length for both the Drosophila and mammalian CSBs is 13 bp; the longest identified CSBs were 99 bp from the giant (-10) segmental enhancer and 95 bp from the Paired-like homeobox-2b mammalian neural enhancer (Brody, 2007).

As an initial step toward understanding the nature of the CSB substructure, a set of DNA sequence alignment tools, known collectively as cis-Decoder, were developed that allow identification of 6 bp or greater perfect match identities, called cis-Decoder Tags (cDTs), within two or more CSBs from either similar or divergent enhancers. The cDTs, which range in size from 6 to 14 bp with an average of 7 or 8 bp, are organized into cDT-libraries that identify sequence elements within CSBs of the same CSB-library. In addition, common cDT-libraries that represent sequence elements aligning to CSBs of two or more different CSB-libraries were also organized (Brody, 2007).

Mammalian CSB alignments, using the CSB-aligner program, yielded 336 neural specific and 60 neural-enriched cDTs and analysis of the mammalian mesodermal CSBs yielded 258 mesodermal specific and 55 mesodermal enriched cDTs. The CSB alignments also produced 137 cDTs that are common to both neural and mesodermal CSBs. Alignments of the Drosophila enhancer CSBs yielded 444 neural specific cDTs (showing no hits on mesodermal or segmental enhancer CSBs), 284 segmental enhancer specific cDTs and an additional 451 cDTs found in neural and segmental enhancers but not part of mesodermal CSBs. Also 451 cDTs were identified that were enriched in neural and/or segmental CSBs but were also found at a lower frequency in mesodermal enhancer CSBs. From the mesodermal CSBs analyzed, 169 mesodermal specific cDTs (not in neural or segmental enhancer CSBs) were identified along with 104 additional cDTs enriched in mesodermal enhancers but also found at a lower frequency among neural and/or segmental enhancer CSBs. A common cDT-library was also generated that contains 993 cDTs that represent common sequence elements found in CSBs of both neural and mesodermal enhancers (Brody, 2007).

The constituent sequence elements of the different cDT-libraries are dependent on the enhancers used to identify them. As additional CSBs are included in the cDT-library construction, certain cDTs may be re-designated. For example, some that are currently considered neural specific will be discovered to be neural enriched, and others that are part of enriched libraries may be reassigned to common cDT-libraries (Brody, 2007).

Although each mammalian and fly cDT is present in at least two or more enhancers, most are not found as repeated sequences in any of the enhancers. In addition, one of the principle observations of this analysis is that enhancers of similarly regulated genes share different combinatorial sets of elements that are enhancer-type specific (Brody, 2007).

Cross-library CSB alignments revealed that nearly all CSBs contain cDTs that are either shared by CSBs from divergent enhancer types or found only in CSBs from enhancers with related regulatory functions. For example, the 37 bp neural mastermind #10 CSB (TATTATTACTATATACAATATGGCATATTATTATTAC) contains a 9 bp sequence (first underlined sequence) also found in the 20 bp #8 CSB from the dpp mesodermal enhancer and it also contains a 14 bp sequence (second underlined sequence) that constitutes the entire 14 bp #33 CSB from the neural enhancer region of nerfin-1 (Brody, 2007).

The analysis of both the mammalian and fly common cDT-libraries reveals that many cDTs contain core recognition sequences for known transcription factors. However, when additional flanking CSB sequences are considered, many common transcription factor binding sites become tissue specific cDTs. For example, the DNA-binding site for basic helix-loop-helix (bHLH) transcription factors, the E-box motif CAGCTG is present 22 times in different neural CSBs, and 2 and 4 times within the CSBs of segmental and mesodermal enhancers, respectively. However, when flanking sequences are included in the analysis, such as the sequences CAGCTGG, CAGCTGAT, CAGCTGTG, CAGCTGCA, CAGCTGCT and ACAGCTGCC, all are neural specific cDTs (E-box underlined). It has been previously shown that different E-boxes bind different bHLH transcription factors to regulate different neural target genes. Although transcription factor consensus DNA-binding sites are well represented in the cDT-libraries, greater than 50% of the cDTs in all of the libraries, both mammalian and fly, represent novel sequences whose function(s) are currently unknown. The fact that there exists such a high percentage of novel sequences within these highly conserved sequences indicates that the identity, function and/or the combinatorial events that regulate enhancer behavior are as yet unknown (Brody, 2007).

Although the resolution of cis-Decoder analysis increases as more enhancers and/or enhancer types are included in the CSB and cDT alignments, analysis of mammalian enhancers found that many shared sequence elements can be identified among related enhancers when as few as two different enhancer groups are used to generate specific cDT-libraries. This is a particularly useful feature of cis-Decoder, especially when studying a biological process or developmental event where relatively little is known about the participating genes and their controlling enhancers. To demonstrate the ability of cis-Decoder to analyze relatively small subsets of enhancers, this study showed how cDT-libraries generated from 14 neural and 21 mesodermal mammalian enhancers can be used to distinguish between the neural and mesodermal enhancers that regulate embryonic expression of Dll1 (Brody, 2007).

Dll1 encodes a Notch ligand that is essential for cell-cell signaling events that regulate multiple developmental events. Studies in the mouse reveal that Dll1 is dynamically expressed in specific regions of the developing brain, spinal cord and also in a complex pattern within the embryonic mesoderm. The 1.6 kb Dll1 cis-regulatory region, located 5' to its transcribed sequence, has been shown to contain distinct enhancers that direct gene expression in these different tissues. These studies have identified two highly conserved neural enhancers, designated Homology I (H-I) and Homology II (H-II), and two mesodermal enhancers termed msd and msd-II. The H-I enhancer directs expression to the ventral neural tube, while the H-II enhancer primarily drives Dll1 expression in the marginal zone of the dorsal region of the neural tube. The msd enhancer drives expression in paraxial mesoderm, and msd-II directs Dll1 expression to the presomitic and somitic mesoderm (Brody, 2007).

An EvoPrint of the Dll1 cis-regulatory region reveals clustered CSBs in each of the enhancer regions. The EvoPrint analysis used mouse (reference DNA), human, rhesus monkey, cow, rat, opossum and Xenopus tropicalis orthologs, representing over approximately 240 My of collective evolutionary divergence. EvoPrint-parser CSB extraction of the EvoPrint generated a total of 35 CSBs of 6 bp or longer, representing 83% of the total MCS. A cDT-scan of the four Dll1 enhancer regions using the mammalian neural and mesodermal specific cDT-libraries accurately differentiates between the neural and mesodermal enhancers. The cDT-library scan identified 77 type-specific sequence elements within the Dll1 CSBs and over half (52%) align with three or more CSBs from different enhancers, indicating that, even if Dll1 had been excluded from the analysis that generated the specific cDT-libraries, there would still be extensive coverage of the Dll1 CSBs by type-specific cDTs. All but eight of the CSBs contain elements that align with one or more neural or mesodermal specific cDTs. The H-I and H-II early CNS enhancers exhibited 64% and 43% coverage, respectively, by neural specific cDTs. The CSBs of the two mesodermal enhancers, msd and msd-II, exhibited 48% and 56% coverage, respectively, by one or more mesodermal specific cDTs. When common cDTs, shared by mesodermal and neural enhancers, were taken into account, coverage of all four enhancers was 81% (Brody, 2007).

cDT-cataloger analysis of aligning cDTs with H-I and H-II early CNS enhancers revealed that the H-I enhancer shares a remarkable 9 different sequence elements with the Wnt-1 early CNS neural plate enhancer CSBs, representing 62 bp (32%) of the H-I CSB coverage, 7 elements with the Paired-like homeobox-2b (Phox2b) hindbrain-sensory ganglia enhancer CSBs (23% coverage) and 6 sequence elements (20% coverage) with the Sox9p hindbrain-spinal cord enhancer CSBs as well as numerous other neural specific elements in common with CSBs of other neural enhancers. Comparisons of Dll1 H-I, Wnt-1, Phox2b and Sox9p enhancer CSBs reveal that the orientation and order of the shared cDTs are unique for each of the enhancers. The H-I and H-II enhancer CSBs also share the 7 bp sequence element GCTCCCC, and H-I has a repeat sequence element (AGTTAAA) that is present in two of its CSBs. The conserved AGTTAAA repeat is also part of a CSB in Phox2b enhancer. cDT-cataloger analysis of the mesodermal enhancer cDT hits reveals that, together, msd and msd-II share 7 elements in common with the mesodermal enhancer of Nkx2.5 as well as numerous elements in common with CSBs of other mesodermal enhancers (Brody, 2007).

To demonstrate the ability of cis-Decoder to differentiate between Drosophila neural and mesodermal enhancers, an analysis was performed of the snail upstream cis-regulatory region. The enhancers that regulate snail's dynamic embryonic expression have been mapped to a 2,974 bp upstream DNA fragment. An EvoPrint of this sequence reveals that each of the restriction fragments that contain the different enhancer activities (CNS, mesodermal and PNS) harbor clusters of highly conserved CSBs. The combined evolutionary divergence of the snail upstream EvoPrint (generated from Drosophila melanogaster, D. sechellia, D. yakuba, D. erecta, D. ananassae, D. pseudoobscura, D. mojavensis, D. virilis and D. grimshawi orthologous sequences) is approximately 160 My, suggesting that many, if not all, of the identified CSBs are likely to be genus invariant and that each base-pair within a CSB has been evolutionarily challenged (Brody, 2007).

To identify sequence elements within the snail upstream CSBs that are present in CSBs of other functionally related or unrelated enhancers, a cDT-scan of the snail EvoPrint was carried out using the neural, segmental and mesodermal specific cDTs and the enriched cDT-libraries. Within the snail early CNS neuroblast enhancer region, the cDT-library scan identified 22 different neural and neural/segmental cDT hits, distributed among all but one of the CSBs, covering 73% of the CSBs. Interestingly, 10 of the 22 cDTs that align with the early CNS enhancer CSBs are found in CSBs of both neural and segmentation enhancers. The high percentage of neural/segmental cDT hits most likely reflects the fact that this enhancer initially drives snail expression in the neuroectoderm in a pair-rule pattern and then in a segmental pattern corresponding to the first wave of delaminating neuroblasts. cDT-cataloger analysis of the aligning cDTs reveals that many of the identified sequence elements are also part of other early neuroblast enhancer CSBs. For example, the 9 bp cDTs ATTCCTTTC, ATTGATTGT, ATTGTGCAA, TGCAATGCA and GATTTATGG are also present, respectively, in CSBs from the nerfin-1, biparous, string, scratch and worniu neuroblast enhancers (Brody, 2007).

Within the presumptive mesodermal enhancer CSBs, 11 cDTs mesodermal specific aligned with 5 of the 12 CSBs, covering 40% of the CSBs. Like the neural cDTs, some of the mesodermal cDTs contain putative DNA-binding sites for classes of known transcription factor families. For example, the seventh cDT (TAATTGGA) contains a consensus core DNA-binding sequence (underlined) for Antennapedia class homeodomain factors (Brody, 2007).

In the snail early PNS enhancer region, 5 of the 7 CSBs aligned with a total of 15 different cDTs that cover 69% of the total PNS CSB sequence. Similar to the CNS enhancer CSB cDT alignments, close to half of the PNS cDT hits represent sequence elements within both neural and segmental enhancer CSBs, again most likely a reflection of the segmental structure of the PNS. The significant overlap in cDTs found in both CNS and PNS enhancer CSBs may reflect the likelihood that many early neural specific transcriptional regulatory factors are pan-neural (Brody, 2007).

Many of the snail enhancer CSB-cDT hits represent sequences found only in two CSBs, snail itself and one other. In these instances it appears that these elements, although specific for neural or mesodermal CSBs, are relatively rare when compared to others. Only through analysis of additional enhancers will it be clear whether these rare elements are indeed type-specific or only enriched in the type-specific CSBs. Nevertheless, the fact that the sequence elements identified by these rare cDTs are conserved in two distinct enhancer CSBs that have both been under positive selection for over 160 My of collective divergence merits their inclusion in the analysis (Brody, 2007).

As part of this study of Drosophila enhancers, cis-Decoder analysis was carried out of 38 segmentation enhancers responsible for both gap and pair-rule gene expression during Drosophila embryogenesis. Although the segmentation enhancer specific library consisted of only 284 cDTs, these cDTs aligned with over 70% of bases of the CSBs of segmentation enhancers. As an example of alignment of these cDTs with a segmental enhancer, an alignment of segmentation specific cDTs with the hairy stripe 1 enhancer is presented. cis-Decoder recognizes highly conserved Abdominal-B, HOX, Hunchback, Kruppel and Tramtrack binding sites, as well as additional uncharacterized sites, as being shared by hairy stripe 1 enhancer and other segmentation enhancers (Brody, 2007).

Although cDT-libraries were initially generated from general classes of different enhancer types, this approach should be applicable to the analysis of gene co-regulation in any cell type involved in any biological event. As the variety and depth of the different cDT-libraries increase, it is thought that cDT-library scans of EvoPrinted putative enhancer regions will have great utility for the identification and initial characterization of cis-regulatory sequences. Future efforts that address the role of individual enhancer CSBs and the dissection of their modular elements will undoubtedly yield new insights into the function of these 'evolutionarily hardened' sequences and ultimately produce a better understanding of the regulatory code underlying coordinate gene expression (Brody, 2007).

Transcriptional Regulation

The first step in the differentiation of the Drosophila mesoderm is the activation of two regulatory genes, twist and snail, in ventral regions of early embryos. sna is a target of the Dorsal (DL) morphogen. DL and TWI directly activate sna expression. Site-directed mutagenesis of DL- and TWI-binding sites within defined regions of the sna promoter suggest that the two proteins (containing the Rel and helix-loop-helix domains, respectively) function multiplicatively to ensure strong, uniform expression of sna, particularly in ventral-lateral regions where there are diminishing amounts of DL. These results are consistent with the possibility that the sharp sna transcription borders are formed by multiplying the shallow DL gradient and the steeper TWI gradient (Ip, 1992b).

decapentaplegic (dpp), zerknullt (zen), twist (twi), and snail, four zygotic patterning genes, are initially expressed either dorsally or ventrally in the segmented region of the embryo, and at the poles. In the segmented region of the embryo, correct expression of these genes depends on cues from the maternal morphogen Dorsal (DL). The DL gradient appears to be interpreted on three levels: dorsal cells express dpp and zen, but not twi and sna; lateral cells lack expression of all four genes; and ventral cells express twi and sna, but not dpp and zen. DL appears to activate the expression of twi and sna and repress the expression of dpp and zen. Polar expression of dpp and zen requires the terminal system to override repression by DL, while that of twi and sna requires the terminal system to augment activation by DL (Ray, 1991).

dpp expression by the dorsal ectoderm is directly involved in functioning of snail expressing mesodermal cells. Normally, the sna expression pattern encompasses 18-20 cells in ventral and ventrolateral regions. Narrowing the sna pattern results in fewer invaginated cells. As a result, the mesoderm fails to extend into lateral regions so that fewer cells come into contact with dpp-expressing regions of the dorsal ectoderm. This leads to a substantial reduction in visceral and cardiac tissues, consistent with recent studies suggesting that DPP induces lateral mesoderm. These results also suggest that the dorsal regulatory gradient defines the limits of inductive interactions between germ layers after gastrulation (Maggert, 1995).

During Drosophila gastrulation, morphogenesis occurs as a series of cell shape changes and cell movements that probably involve adhesive interactions between cells. The dynamic aspects of cadherin-based cell-cell adhesion were examined in the morphogenetic events to assess the contribution of such activity to morphogenesis. Shotgun and Cadherin-N show complementary expression patterns in the presumptive ectoderm and mesoderm at the mRNA level. Switching of cadherin expression from the Shotgun to the CadN type in the mesodermal germ layer occurs downstream of the mesoderm-determination genes twist and snail. These dynamic aspects of cadherin-based cell-cell adhesion appear to be associated with the following: (1) initial establishment of the blastoderm epithelium; (2) acquisition of cell motility in the neuroectoderm; (3) cell sheet folding, and (4) epithelial to mesenchymal conversion of the mesoderm. These observations suggest that the behavior of the Shotgun-catenin adhesion system may be regulated in a stepwise manner during gastrulation to perform successive cell-morphology conversions. Also discussed are the processes responsible for loss of epithelial cell polarity and elimination of preexisting Shotgun-based epithelial junctions during early mesodermal morphogenesis (Oda, 1998).

Huckebein (hkb) sets the anterior and the posterior borders of the ventral furrow, but acts by different modes of regulation. In the posterior part of the blastoderm, HKB represses the expression of sna in the endodermal primordium. In the anterior part, HKB antagonizes the activation of target genes by TWI and SNA. Here, Bicoid permits the co-expression of hkb, sna and twi, all of which are required for the development of the anterior digestive tract. Mesodermal fate is determined where sna and twi are expressed, but not hkb. Anteriorly hkb together with sna determines endodermal fate, while hkb together with sna and twi are required for foregut development (Reuter, 1994).

Both escargot and snail have similar DNA binding specificity and both are required in the wing imaginal disc. Both escargot and snail are required for for their own expression (autoregulation) and for regulation of expression of each other (Fuse, 1996).

Dorsoventral (DV) patterning of the Drosophila embryo is initiated by a broad Dorsal (Dl) nuclear gradient, which is regulated by a conserved signaling pathway that includes the Toll receptor and Pelle kinase. What are the consequences of expressing a constitutively activated form of the Toll receptor, Toll(10b), in anterior regions of the early embryo? Using the bicoid 3' UTR, localized Toll(10b) products result in the formation of an ectopic, anteroposterior (AP) Dl nuclear gradient along the length of the embryo. The analysis of both authentic Dorsal target genes and defined synthetic promoters suggests that the ectopic gradient is sufficient to generate the full repertory of DV patterning responses along the AP axis of the embryo. For example, mesoderm determinants are activated in the anterior third of the embryo, whereas neurogenic genes are expressed in central regions. These results raise the possibility that Toll signaling components diffuse in the plasma membrane or syncytial cytoplasm of the early embryo (Huang, 1997).

The Huang (1997) paper also clearly summarizes what is known about the regulation of genes involved in dorsal/ventral patterning. There are five distinct thresholds of gene activity in response to the Dorsal nuclear gradient in early embryos. The type I target gene folded gastrulation is activated only in response to peak levels of the Dl gradient, so that expression is restricted to a subdomain of the presumptive mesoderm. The PE enhancer from the twist promoter region exhibits a similar pattern of expression. This enhancer contains a cluster of low-affinity Dl binding sites that restrict expression to the ventral-most regions of early embryos. The type II target gene snail contains a series of low-affinity Dl-binding sites, as well as binding sites for the bHLH activator, Twist. The Dl and Twist proteins appear to make synergistic contact with the basal transcription complex, so that snail is activated throughout the presumptive mesoderm in response to both peak and high levels of the Dl gradient. The ventral midline arises from the mesoderm, which is derived from the ventral-most regions of the neuroectoderm. Mesectoderm differentiation is controlled by the bHLH-PAS gene, sim. Some of the E(spl) complex also exhibit early expression in the presumptive mesectoderm. A synthetic enhancer containing high-affinity Dl-binding sites and Twist binding sites exhibits expression in this region. The type IV target gene rhomboid is expressed in lateral stripes that encompass the ventral half of the presumptive neuroectoderm. These stripes are regulated by a 300-bp enhancer (NEE) that contains high-affinity Dl-binding sites, Twist-binding sites, and "generic" E-box sequences that appear to bind ubiquitously distributed bHLH activators (Daughterless and Scute), which are present in the unfertilized egg. The fifth and final threshold response is defined by the lowest levels of the Dl gradient. The zerknullt target gene is repressed by high and low levels of the gradient, so that expression is restricted to the presumptive dorsal ectoderm. The zen promoter region contains high-affinity Dl-binding sites and closely linked "corepressor" sites. Efficient occupancy of the Dl sites appears to depend on strong, cooperative DNA-binding interactions between Dl and the corepressors. The same low levels of Dl that repress zen also repress sog. The sim, E(spl), rho and sog expression patterns are restricted to the neurogenic ectoderm and excluded from the ventral mesoderm by Snail, which encodes a zinc finger repressor (Huang, 1997).

This study also provides evidence that neurogenic repressors may be important for the establishment of the sharp mesoderm/neuroectoderm boundary in the early embryo. About half of the embryos carrying the Toll anteriorly expressed transgene exhibit a ventral gap in the endogenous ventral expression pattern of snail behind the ectopic anterior staining pattern. Although the identity of the repressor creating this gap is unknown, it is conceivable that members of the E(spl) complex encode putative snail repressors because previous studies have shown that the m7 and m8 genes are expressed in the lateral neuroectoderm of early embryos. Proteins coded for by these genes are known to repressors. These proteins might be regulated by the gene hierarchy responsible for D/V polarity (Huang, 1997).

The Groucho corepressor mediates negative transcriptional regulation in association with various DNA-binding proteins in diverse developmental contexts. Groucho has been implicated in Drosophila embryonic terminal patterning: it is required to confine tailless and huckebein terminal gap gene expression to the pole regions of the embryo. An additional requirement for Groucho in this developmental process has been revealed by establishing that Groucho mediates repressor activity of the Huckebein protein. Putative Huckebein target genes are derepressed in embryos lacking maternal groucho activity and biochemical experiments demonstrate that Huckebein physically interacts with Groucho. Using an in vivo repression assay, a functional repressor domain in Huckebein that has been identified contains an FRPW tetrapeptide, similar to the WRPW Groucho-recruitment domain found in Hairy-related repressor proteins. Mutations in Huckebein’s FRPW motif abolish Groucho binding and in vivo repression activity, indicating that binding of Groucho through the FRPW motif is required for the repressor function of Huckebein. Thus Groucho-repression regulates sequential aspects of terminal patterning in Drosophila (Goldstein, 1999).

One proposed Hkb target is the snail (sna) gene, which is transcribed in the ventral-most portion of the embryo. sna expression is thought to be excluded from the posterior pole by hkb activity. Accordingly, sna and hkb expression domains abut in cellularizing wild-type embryos, whereas sna expression extends to, and includes, the posterior pole of hkb mutant embryos. In torD embryos, hkb expression expands towards the center of the embryo and the sna domain correspondingly retracts. By contrast, in gromat- embryos, the expression of sna does not respect the sna posterior border and spreads to the pole, overlapping extensively with the hkb expression domain. The expression of the T-related gene brachyenteron (byn; also called Trg) also seems to be repressed by Hkb. byn is not expressed at the most posterior region of wild-type (or torD) embryos, whereas it extends throughout the posterior cap of hkb mutant embryos, consistent with hkb setting the posterior limit of byn expression. However, it is found that byn is ectopically expressed at the posterior tip of gromat- embryos. Together, these results suggest that gro is, directly or indirectly, necessary for hkb repressor functions (Goldstein, 1999).

Differential activation of the Toll receptor leads to the formation of a broad Dorsal nuclear gradient that specifies at least three patterning thresholds of gene activity along the dorsoventral axis of precellular embryos. The activities of the Pelle kinase and Twist basic helix-loop-helix (bHLH) transcription factor in transducing Toll signaling have been investigated. Pelle functions downstream of Toll to release Dorsal from the Cactus inhibitor. Twist is an immediate-early gene that is activated upon entry of Dorsal into nuclei. Transgenes misexpressing Pelle and Twist were introduced into different mutant backgrounds and the patterning activities were visualized using various target genes that respond to different thresholds of Toll-Dorsal signaling. These studies suggest that an anteroposterior gradient of Pelle kinase activity is sufficient to generate all known Toll-Dorsal patterning thresholds and that Twist can function as a gradient morphogen to establish at least two distinct dorsoventral patterning thresholds. How the Dorsal gradient system can be modified during metazoan evolution is discussed and it is concluded that Dorsal-Twist interactions are distinct from the interplay between Bicoid and Hunchback, which pattern the anteroposterior axis (Stathopoulos, 2002).

The snail, sim, vnd and sog expression patterns represent four different Toll-Dorsal signaling thresholds. snail is activated only by peak levels of the Dorsal gradient; sim and vnd are activated by intermediate levels, and sog is activated by the lowest levels of the gradient. These expression patterns were visualized in mutant and transgenic embryos via in situ hybridization using digoxigenin-labeled antisense RNA probes (Stathopoulos, 2002).

Dorsal target genes are essentially silent in mutant embryos that lack an endogenous dorsoventral Dorsal nuclear gradient. Mutant embryos were collected from females that are homozygous for a null mutation in the gastrulation defective (gd) gene, which blocks the processing of the Spätzle ligand and the activation of the Toll receptor. These mutants permit the analysis of ectopic, anteroposterior Dorsal and Twist gradients in 'apolar' embryos that lack dorsoventral polarity. snail, vnd, and sog are sequentially expressed along the anteroposterior axis of mutant embryos that contain a constitutively activated form of the Toll receptor (Toll10b) misexpressed at the anterior pole using the bicoid (bcd) promoter and 3' UTR. These expression patterns depend on an ectopic anteroposterior Dorsal nuclear gradient. The repression of the vnd and sog patterns at the anterior pole is probably mediated by Snail, which normally excludes expression of these genes in the ventral mesoderm of wild-type embryos (Stathopoulos, 2002).

The activated Pelle-Tor4021 kinase also directs sequential anteroposterior patterns of snail, vnd, and sog expression in gd/gd mutant embryos. As in the case of Toll10b, the activated Pelle kinase was misexpressed at the pole using the bcd 3' UTR. The snail, vnd and sog expression patterns are similar to those obtained with the Toll10b transgene. The vnd and sog expression patterns are probably repressed at the anterior pole by Snail. These results suggest that the levels of Pelle kinase activity are sufficient to determine different Dorsal transcription thresholds (Stathopoulos, 2002).

Similar experiments were carried out with a Pelle-Tor fusion gene that contains the Tor signal peptide, extracellular domain and transmembrane peptide, but lacks the amino acid substitution (Y327C) in the Tor4021 protein that induces dimerization. The Pelle-Tor fusion protein fails to induce snail expression, but succeeds in activating vnd and sog (Stathopoulos, 2002).

The twist-bcd transgene was introduced into mutant embryos that completely lack Dorsal. Without the transgene these mutants do not express twist, snail, sim, vnd or sog. Introduction of the twist-bcd transgene causes intense expression of twist in the anterior 40% of the embryo. This broad Twist gradient fails to activate snail, but succeeds in inducing weak expression of sim and somewhat stronger staining of vnd at the anterior pole. The activation of vnd in mutant embryos is comparable with the expression seen in wild-type and Tollrm9/Tollrm10 embryos. However, in both wild-type and mutant embryos the vnd pattern is transient, and lost after the completion of cellularization. These results indicate that Twist can activate dorsoventral patterning genes in the absence of Dorsal (Stathopoulos, 2002).

An anteroposterior Twist gradient generates at least two thresholds of gene activity in mutant embryos that contain decreased levels of Dorsal. High levels of Twist activate sim at the anterior pole, whereas lower levels are sufficient to induce the expression of snail in more posterior regions of embryos containing low, uniform levels of the Dorsal protein. These results demonstrate that twist gene activity is not dedicated to mesoderm formation. Instead, Twist supports expression of two regulatory genes, sim and vnd, which pattern ventral regions of the neurogenic ectoderm. The twist-bcd transgene was shown to induce weak expression of both genes even in mutant embryos that completely lack Dorsal (Stathopoulos, 2002).

snail is activated by Dorsal and Twist in cellularizing embryos. The sharp lateral limits of the snail expression pattern establish the boundary between the presumptive mesoderm and neurogenic ectoderm. It has been suggested that the crude Dorsal gradient triggers a somewhat steeper Twist gradient, and the two activators function synergistically within the snail 5' cis-regulatory DNA to establish the sharp, on/off expression pattern. Dorsal-Twist transcription synergy may provide a means for 'multiplying' the Dorsal and Twist gradients to produce the sharp snail pattern. This model suggests that both proteins must be present in a gradient to generate the sharp snail border. However, while both Dorsal and Twist are required for the activation of snail, a Twist gradient is sufficient to generate a reasonably sharp pattern of snail expression in embryos containing low, uniform levels of Dorsal. It is proposed that cooperative binding of Twist might act as a switch to regulate snail expression when the snail 5' cis-regulatory region is rendered responsive by the Dorsal activator (whether present at uniform levels or in a gradient). Therefore, the ratio of Dorsal to Twist may be important to produce the sharp lateral limits of snail expression (Stathopoulos, 2002).

This study raises some questions about the role of operator binding affinities in the specification of different transcription thresholds. The Dorsal binding sites present in the snail 5' regulatory region bind with lower affinity than the sites present in the rho lateral stripe enhancer (NEE). The analysis of a number of synthetic enhancers prompted the proposal that the activation of Dorsal target genes in the ventral mesoderm versus lateral neurogenic ectoderm depends on the affinity of Dorsal operator sites. However, the demonstration that the twist-bcd transgene can activate snail expression in Tollrm9/Tollrm10 embryos suggests that occupancy of the distal Dorsal-binding sites may not be crucial for determining whether the gene is on or off. It is conceivable that Dorsal occupies one or more sites in mutant embryos, but is unable to trigger expression in the absence of Twist. In general, 'promoter context' (combinations of regulatory factors) might be more critical for defining Dorsal transcription thresholds than the affinities of Dorsal operator sites (Stathopoulos, 2002).


snail: Biological Overview | Evolutionary Homologs | Targets of Activity and Protein Interactions | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.