scute


REGULATION

Promoter Structure

The highly complex pattern of proneural clusters in imaginal discs is constructed piecemeal, by the action on achaete and scute of site-specific, enhancer-like elements distributed along most of the AS-C (approximately 90 kb). Fragments of AS-C DNA containing these enhancers drive reporter genes in only one or a few proneural clusters. This expression is independent of the ac and sc endogenous genes, indicating that the enhancers respond to local combinations of factors (prepattern). The cross-activation between ac and sc has been thought to explain the almost identical patterns of ac and sc expression (Martinez, 1991), but cross-activation does not occur detectably between the endogenous ac and sc genes in most proneural clusters. Coexpression is accomplished by activation of both ac and sc by the same set of position-specific enhancers (Gomez-Skarmeta, 1995).

The genes araucan and caupolican code for two divergent homeodomain proteins that regulate transcription from the position-specific enhancers of ac-sc. Expression in the wing imaginal disc starts during the second larval instar at the presumptive notum region and is increased in two large areas of the presumptive lateral heminotum. From the mid-third instar, expression occurs at the presumptive distal tegula, the dorsal radium, proximal vein L1, veins L3 and L5, the allula, and the pleura. This distribution suggests that araucan and caupolican in fact establish the prepattern for proneural clusters in the wing, and interact with the position-specific enhancers to regulate ac-sc in the precise pattern displayed by these proneural clusters.

Expression of ac-sc at the presumptive vein L3 depends on enhancer sequences located 0.2-0.6 kb upstream of the scute transcriptional start. This enhancer also drives expression at the twin sensilla of the wing margin (TSM) proneural cluster, located on the proximal vein L1, a site of ara/caup expression. These sequences contain binding sites for IROC proteins. Two contiguous short stretches of DNA are revealed in a DNase1 protection assay. One of these contains the TAAT motif found in the consensus binding sites of many homeoproteins. A mutagenized enhancer fails to be expressed in both vein L3 and TSM territories (Gomez-Skarmeta, 1996). scute's regulation, with the exception of its of in activation Sex-lethal, is similar to that of achaete. Zygotic scute expression begins earlier than the expression of achaete.

Complex patterns of ac and sc expression are constructed by separable cis-controlling elements present within a large (ca. 90-kb) region. The yellow gene located 10 kb from ac has completely different expression patterns and is activated by different enhancers. Therefore, these genes may serve as a good model system for the analysis of proper enhancer-promoter recognition. Autologous recognition between genes and their respective promoters may depend on the existence of an interdomain boundary between AS-C and the yellow locus, or it may be determined by the specificity of the proteins assembled on a certain enhancer and promoter. An inversion is described that puts the yellow gene between the ac and sc genes and almost all of their cis-regulatory elements. This inversion shows only weak interference with the expression of the ac and sc genes. When the suppressor of Hairy wing-binding region of the su(Hw) insulator is deleted or inactivated by the su(Hw) mutation, the sc phenotype of the flies is practically indistinguishable from that of the wild type. The presence of the yellow gene between the AS-C enhancers and the promoters of the ac and sc genes does not interfere with ac and sc expression in most areas. This work shows, however, that it is not required that the su(Hw) insulator separate promoters from enhancers to allow inhibition of transcription by the su(Hw) protein. The presence of the su(Hw) insulator, located more than 20 kb away from the inversion, facilitates strong suppression of achaete and scute gene expression, although is does not separate the promoters from the AS-C enhancers (Golovnin, 1999).

The mechanism of direct interaction between AS-C enhancers and su(Hw) insulator is not yet clear. One possibility is that the pairing between the P elements located at the breakpoints of the inversion facilitates such interaction. However, deletions of the P elements on both sides of the inversion fail to influence the repression mediated by the su(Hw) insulator. Another possibility is that the inversion brings the su(Hw)-binding region into a close contact with the AS-C cis-regulatory elements due to changes in chromatin folding, which then leads to new long-range contacts between certain chromatin regions. As a result, the su(Hw)-mod(mdg4) complex formed on the su(Hw) insulator becomes capable of interacting directly with enhancer-bound transcription activators or with proteins responsible for enhancer-promoter interactions. The fact that the inactivation of AS-C control elements by the su(Hw)-binding region in the inversion is only partial may be explained by reversible interactions between the insulator and enhancers similar to the normal dynamic interactions observed between enhancers and promoters (Golovnin, 1999).

An endogenous Su(Hw) insulator separates the yellow gene from the Achaete-scute gene complex in Drosophila

The best characterized chromatin insulator in Drosophila is the Suppressor of Hairy wing binding region contained within the gypsy retrotransposon. Although cellular functions have been suggested, no role has been found yet for the multitude of endogenous Suppressor of Hairy wing binding sites. Two Suppressor of Hairy wing binding sites in the intergenic region between the yellow gene and the Achaete-scute gene complex are shown to form a functional insulator. Genetic analysis shows that at least two proteins, Suppressor of Hairy wing and Modifier of MDG4, required for the activity of this insulator, are involved in the transcriptional regulation of Achaete-scute (Golovnin, 2003).

To explain how the long-range activation potential of eukaryotic enhancers are restricted to the relevant target promoter, it has been proposed that eukaryotic chromatin is organized into functionally independent domains that prevent illegitimate enhancer-promoter communication. Recent publications suggest a model in which distant chromosomal binding sites of Su(Hw) are brought together by Mod(mdg4) into a small number of insulator bodies located at the nuclear periphery. In this way Su(Hw) marks the base of topologically independent looped chromatin domains. However, despite the presence of many endogenous Su(Hw) binding sites in polytene chromosomes, no specific function has been attributed to any site in a particular gene (Golovnin, 2003).

Using in vivo and in vitro assays, it has been shown that there exists a functional Su(Hw) insulator between a P-element inserted yellow gene and AS-C. At least four Su(Hw) binding sites have been shown to be required for effective enhancer blocking. It has been shown that a 125 bp fragment including only two Su(Hw) binding sites can partially block the strong yellow enhancer, while a larger 454 bp fragment including the same Su(Hw) sites completely blocks yellow enhancers. Thus, additional proteins binding to neighboring sequences are required for strong insulator action of the element between yellow and AS-C. The sequencing of the Drosophila genome shows the absence of large clusters of endogenous Su(Hw) binding sites, such as are found in the gypsy retrotransposon. It seems possible that in endogenous insulators, Su(Hw) cooperates with additional DNA-binding proteins to produce insulator activity. This assumption may also explain the absence of lethal phenotypes in the su(Hw)- background since other proteins would partly compensate for the loss of Su(Hw) function (Golovnin, 2003).

The results further confirm the initial observation of the interaction between two gypsy insulators. The two Su(Hw) binding sites in the 125 bp fragment and the gypsy insulator mutually neutralize each other's enhancer-blocking activity. Thus, the difference in the number of Su(Hw) binding sites between interacting insulators is not critical for the effective neutralization of the enhancer blocking activity (Golovnin, 2003).

Increasing the number of Su(Hw) binding sites increases insulator strength, and three copies of the 125 bp insulator block better than a single copy. How can this be reconciled with the observation that two Su(Hw) insulators neutralize one another? It is supposed that the neutralization requires the pairing between two insulators. Interaction between neighboring insulators would pre-empt their interaction with larger assemblies of Su(Hw) binding sites that have been proposed to associate together at the nuclear periphery through the Mod(mdg4) protein. Thus, for neutralization, it is supposed that the Su(Hw) binding sites must adopt a paired configuration, therefore requiring a sufficient distance between them for DNA to form a loop. In contrast, putting more Su(Hw) binding sites very close together merely ensures that enough Su(Hw) protein will be bound at any one time to produce insulator action (Golovnin, 2003).

The role of the Su(Hw) and Mod(mdg4) proteins in the expression of ASC genes becomes obvious when the normal architecture of the ASC regulatory region is altered by chromosome rearrangements. Many previously described inversions with breakpoints in the AS-C regulatory region and centric heterochromatin have weak mutant phenotypes, suggesting the presence of sequences that effectively impede the spread of heterochromatic silencing. The appearance of strong variegating repression of the ac and sc genes when the inversions are combined with loss of su(Hw) or mod(mdg4) function suggests that the Su(Hw) and Mod(mdg4) proteins are involved in the stability of the ac and sc expression (Golovnin, 2003).

In the In(1)y3p mutation, a heterochromatic breakpoint in the upstream regulatory region does not effect yellow expression suggesting that the yellow promoter is relatively resistant to heterochromatin proximity at this breakpoint. At the same time, ac and sc expression is strongly affected by su(Hw) or mod(mdg4) mutations, supporting the idea that Su(Hw) binding sites between yellow and ac block heterochromatin spreading (Golovnin, 2003).

The In(1)sc8 and In(1)scv2 inversions separate the ac and sc genes. The requirement of the Su(Hw) and Mod(mdg4) proteins for normal sc expression suggests the existence of additional Su(Hw) binding sites in the AS-C regulatory region. The strong genetic interaction between sc2 and mutations in mod(mdg4) or su(Hw) also supports the presence of additional Su(Hw) binding sites in ASC. The expression of ASC genes is regulated by a large number of enhancer-like elements. It seems reasonable that these ASC enhancers should be separated by boundary elements as was found for the 3' cis-regulatory region of Abdominal B (Abd-B), which is subdivided into a series of iab domains. Boundary elements like MCP, Fab-7 and Fab-8 separate the iab domains and protect each against positive and negative chromatin modifications induced by neighboring iab domains. The genetic results might be explained by the assumption that the Su(Hw)-Mod(mdg4) protein complex participates in formation of boundary elements between certain AS-C enhancers. The absence of noticeable changes in the wild-type AS-C gene expression on the su(Hw) or mod(mdg4) mutant background might be the consequence of the functional redundancy of the Su(Hw)-Mod(mdg4) protein complex. No clusters of potential endogenous Su(Hw) binding sites are found inside the AS-C sequence. Thus, it seems possible that Su(Hw)-Mod(mdg4) cooperates with other non-identified proteins in formation of the functional boundaries in the regulatory region of AS-C. The identification and characterization of new Su(Hw) binding sites may help in understanding the role of Su(Hw)/Mod(mdg4) in transcriptional regulation of AS-C genes and provide new insights into the mechanisms of the insulator action (Golovnin, 2003).

Charlatan, a Zn-finger transcription factor, establishes a novel level of regulation of the proneural achaete/scute genes of Drosophila

The proneural genes achaete (ac) and scute< (sc) are necessary for the formation of the external sensory organs (SOs) of Drosophila. ac and sc are expressed in proneural clusters and impart their cells with neural potential. For this potential to be realized, and the SO precursor cell (SOP) to arise within a cluster, sufficient proneural protein must accumulate in the cluster. charlatan (chn) encodes a zinc finger transcription factor that facilitates this accumulation by forming a stimulatory loop with ac/sc. Loss of function of chn decreases the accumulation of Sc in proneural clusters and partially removes notum macrochaetae, while overexpression of chn enhances ac/sc expression and the formation of extra SOs. Moreover, chn is activated by ac/sc in proneural clusters. Chn apparently stimulates ac/sc by physically interacting with the proneural cluster-specific enhancers and increasing enhancer efficiency, thus acting as a stimulator of ac/sc expression in proneural clusters. chn is also required for the proper development of the embryonic peripheral nervous system; its absence leads to loss of neurons and causes aberrant development of chordotonal organs (Escudero, 2005).

The strong genetic interaction between the LOF conditions for chn and ac/sc, together with the presumed activation of chn by ac/sc, led to an examination of whether chn might in turn stimulate ac/sc expression. Initially examined was whether the overexpression of chn affects Sc accumulation in third instar wing discs. In these discs, ac and sc are coexpressed in a stereotyped pattern of well-resolved proneural clusters from which SOPs emerge. With the MS248-Gal4 driver, UAS-chn promotes strong and generalized expression of sc in most of the domain of expression of the driver, namely, the medial and part of the lateral prospective notum. Many SOPs arose from this enlarged region of Sc accumulation, as detected by the Sens marker, consistent with the additional macrochaetae that develop on the notum of these flies. With the MS1096-Gal4 driver, which is expressed most strongly in the dorsal part of the wing anlage, there is also ectopic expression of sc and emergence of extra SOPs in the wing territory. Interestingly, expression of UAS-chn disrupts the characteristic double row expression of sc and sens at the wing margin, suggesting interference with its formation. This is also consistent with the presence of small, crumpled adult wings that carry many bristles and other types of sensilla. Overexpression of UAS-chn with the ubiquitous wing disc driver C765-Gal4 activates sc but fails to stimulate atonal, a proneural gene which is not a member of the ASC and is normally expressed in a few cells at the presumptive tegula and ventral radius. Conversely, overexpression of atonal does not stimulate chn in the wing disc (Escudero, 2005).

The expression of ac/sc in proneural clusters is controlled by a series of separable enhancer elements in the ASC. Each enhancer is responsible for expression in one or in a few proneural clusters. Thus, whether the ectopic activation of sc could be mediated by the overexpression of UAS-chn acting upon these enhancers was examined. UAS-chn strongly stimulates the activity of a construct in which the lacZ gene is under the control of the ASC L3/TSM enhancer [construct 2.3-lacZ; MS1096-Gal4 driver], which directs expression at the wing vein L3 and the twin sensilla of the wing margin proneural clusters. Similar observations were made with the dorsocentral (DC) enhancer [construct AS1.4DC=DC-lacZ; C765-Gal4 ubiquitous driver], which promotes expression in the central part of the notum. It also activates expression directed by the ANP enhancer. Since the DC-lacZ construct bears the heterologous hsp70 promoter, these data indicate that the sc endogenous promoter is dispensable for the stimulation by UAS-chn. The Ac and Sc proneural proteins are also not essential for the increased activity of the enhancers; DC-lacZ expression is strongly increased by Chn in an In(1)sc10.1 background. By contrast, the sc SOP-dedicated enhancer (SRV-lacZ construct), which is responsible for the strong accumulation of Sc in SOPs, is only clearly activated by UAS-chn (C734-Gal4 driver) in the presence of ac/sc, and this stimulation occurred in individual cells. This observation suggests that the upregulation of this enhancer results from the formation of ectopic SOPs by the UAS-chn-induced overexpression of sc, rather than from a direct effect of Chn on the enhancer. Still, the possibility remains that Chn and Sc cooperate in the activation of this enhancer (Escudero, 2005).

UAS-chn upregulates the activity of these enhancers, but it does not lead to a generalized expression of lacZ in all the domains of UAS-chn expression. These data indicate that despite the elevated activation, the enhancers are still dependent on the prepattern factors that define their spatial domains of activity. This fact was verified by the observation that the overstimulation of DC-lacZ is strongly dependent on its prepattern activator, the transcription factor Pnr. Moreover, 2.3-lacZ, which is active only in the wing pouch, is not stimulated by the overexpression of UAS-chn in the prospective notum (MS248-Gal4); this indicates that the sc promoter present in this construct was not responsive to UAS-chn (Escudero, 2005).

Next examined were mosaic wing discs to determine whether removal of chn function affects expression of sc or enhancer-lacZ constructs in proneural clusters. Homozygous chnECJ1 cells generally display reduced expression of sc or ß-galactosidase under the control of proneural enhancers, when compared with neighboring heterozygous chnECJ1/+ cells. Note however, that the expression is not completely abolished. Similar decreased expression of sc is observed by misexpressing UAS-chniS in cell clones. These effects appear to be cell-autonomous. While SOPs can still emerge from homozygous chnECJ1 cells with reduced levels of Sc, SOPs were often missing, in agreement with the partial suppression of macrochaetae observed within the chnECJ1 clones. When both homozygous and heterozygous cells were near a position where an SOP emerged, a heterozygous cell appeared to be preferentially selected. These findings clearly indicate that chn+ is required for proneural proteins to accumulate in proneural clusters at levels sufficient to ensure SOP selection. Moreover, the observation that expression of enhancer-lacZ constructs is reduced in chn- cells and increased in chn overexpressing cells indicates that the effect of chn+ is not due to an enhanced perdurance of the Sc protein, but to the increased transcription of the sc gene (Escudero, 2005).

To analyze whether Chn is a direct regulator of the ASC enhancers, the ability of the Chn protein to bind to the DC enhancer was assayed in vitro. A fragment of the Chn protein containing the five zinc fingers was produced in and purified from E. coli. The enhancer DNA was divided into six partially overlapping fragments of approximately 300 bp each, and each of them was assayed in gel retardation experiments. Only the fragment that comprised the proximal-most region of the enhancer (fragment DC6) shows binding of the Chn polypeptide. Interestingly, the DC6 fragment is included within the PB0.5DC sequence, the smallest subfragment of AS1.4DC, which still retains enhancer activity. For unclear reasons, the PB0.5DC enhancer drives expression only in the PDC SOP. Still, misexpression of UAS-chn expands this expression to many cells of the posterior notum. This suggests that the binding of Chn protein to the DC6 region of the DC enhancer may prompt its response to Chn in vivo (Escudero, 2005).

A major bristle QTL from a selected population of Drosophila uncovers the zinc-finger transcription factor Poils-au-dos, a repressor of achaete-scute

Traditional screens aiming at identifying genes regulating development have relied on mutagenesis. A new gene has been identified involved in bristle development, identified through the use of natural variation and selection. Drosophila melanogaster bears a pattern of 11 macrochaetes per heminotum. From a population initially sampled in Marrakech, a strain was selected for an increased number of thoracic macrochaetes. Using recombination and single nucleotide polymorphisms, the factor responsible was mapped to a single locus on the third chromosome, poils au dos (French for 'hairy back'), that encodes a zinc-finger-ZAD protein. The original, as well as new, presumed null alleles of poils au dos are associated with ectopic achaete-scute expression that results in the additional bristles. This suggests a possible role for Poils au dos as a repressor of achaete and scute. Ectopic expression appears to be independent of the activity of known cis-regulatory enhancer sequences at the achaete–scute complex that mediate activation at specific sites on the notum. The target sequences for Poils au dos activity were mapped to a 14 kb region around scute. In addition, pad has been shown to interact synergistically with the repressor hairy and with Dpp signaling in posterior and anterior regions of the notum, respectively (Gibert, 2005).

Expression of ac-sc in proneural clusters is regulated by independently-acting cis-regulatory enhancers. The enhancer responsible for activation of ac-sc in the cluster giving rise to the DC bristles has been characterized in detail. The activity of this enhancer in a reporter construct was examined using lacZ expression. The activity of this enhancer is modified in pad1. The domain of expression of lacZ appears wider. At the same time, the anterior limit of the cluster is retracted in a posterior direction. It is possible that this is in part due to the slight distortion of the overall shape of the notum seen in pad1 mutants. Interestingly, the ectopic bristles do not arise within the misshapen proneural cluster. They are therefore formed independently of the activity of the DC enhancer used for activation. In fact, the aDC, as well as the ectopic DC precursors, are both clearly situated outside the DC cluster. Another characterized enhancer of ac-sc, the L3-TSM enhancer involved in the formation of the sensilla on the anterior wing margin, anterior cross vein and third vein was examined and no significant modification was observed. These results suggest that poils au dos does not act through the cis-regulatory sequences controlling expression in the proneural clusters (Gibert, 2005).

To determine which regions of the AS-C are required for the formation of the ectopic bristles in pad, the pad1 mutant was placed in various ac-sc mutant backgrounds. These included several deletions generated by excision of the P-element in the line NP-6066. In(1)ac3, an inversion separating sequences located 1 kb upstream of ac, including the DC enhancer, was used, as well as Df(1)91B (which deletes 45 kb from a position 10.3 kb upstream of sc that includes ac and the DC enhancer); Df(1)115 (which deletes 7.8 kb between the positions 14.5 and 6.7 kb upstream of the scute ATG), and In(1)sc4 (an inversion with a breakpoint 7-8 kb downstream of sc). None of these rearrangements prevent formation of the ectopic bristles present in pad1. In(1)sc4 causes a loss of all scutellar bristles, because the relevant enhancer, located 40 kb downstream of sc, is translocated elsewhere and is thus not able to drive the expression of ac-sc in the scutellum. However, occasional scutellar bristles form in In(1)sc4; pad1 flies at the position normally occupied by the anterior scutellar bristle. In contrast to the rearrangements cited above, no, or very few, ectopic bristles are formed in scbald; pad1 flies. This hypomorphic sc allele carries the remains of a P element located 10 kb upstream of sc and displays a high frequency of missing SC, aDC and orbital bristles. Together, these results indicate that the target sequences are probably located in a fragment that extends 6.7 kb upstream and 7-8 kb downstream of sc (Gibert, 2005).

In order to visualize the precursors of the ectopic bristles in pad1, an antibody against Senseless, a marker of neural precursors, was used. A transgene was used driving the expression of LacZ under the control of the achaete/scute Sensory Organ Precursor enhancer (SOP-lacZ). The minimal SOP enhancer of 500 bp drives expression of lacZ exclusively in the bristle precursors and contains binding sites for Ac-Sc/Da (E boxes), as well as sites for the binding of repressors. It was observed that the precursors of ectopic bristles appear between 0 and 2 h after puparium formation. This is about the same time as the formation of the precursors for the anterior DC (aDC) bristles in wild-type flies. The posterior DC (pDC) precursors appear much earlier, around 24 to 12 h before puparium formation. In situ hybridization with a probe to sc, indicated that sc is expressed ectopically in third instar wing discs. Expression of ac was examined using an anti-Achaete antibody and is also significantly up-regulated in pad1. In both cases, the proneural clusters that give rise to the wild-type bristle precursors are clearly visible at wild-type locations, but they appear to be enlarged. In addition, many more cells express high levels of ac-sc outside the proneural clusters. These are mainly located in the future anterior and central regions of the notum, consistent with the fact that ectopic macrochaetes are found here. Weak sc expression can be detected in these areas in wild-type discs but does not give rise to sense organs. Ectopic expression in pad1 is particularly visible in the region of the presutural, DC and PSA bristles where many ectopic bristles form (Gibert, 2005).

To better visualize the regions of ectopic expression, the reporter construct EE4 containing an artificial SOP enhancer composed of four E-boxes and the binding sites for the Ac and Sc proteins was used. The EE4 construct lacks the sequences required for repression and so it is very sensitive to the levels of Ac-Sc and can be used to measure the increased amounts of Ac-Sc in the pad mutant. It was observed that expression driven by this enhancer in pad1 is significantly different from that seen in the wild type. In the wild type, it is expressed exclusively in the cells of the proneural clusters where it is present at high levels. In pad1, expression in the PSA region expands medially and expression in the DC region expands anteriorly. Some of the ectopic precursors appear within this expanded anterior region (Gibert, 2005).

Two or four bristles: Functional evolution of an Enhancer of scute in Drosophilidae

Changes in cis-regulatory sequences are proposed to underlie much of morphological evolution. Yet, little is known about how such modifications translate into phenotypic differences. To address this problem, focus was placed on the dorsocentral bristles of Drosophilidae. In Drosophila melanogaster, development of these bristles depends on a cis-regulatory element, the dorsocentral enhancer, to activate scute in a cluster of cells from which two bristles on the posterior scutum arise. A few species however, such as D. quadrilineata, bear anterior dorsocentral bristles as well as posterior ones, a derived feature. This correlates with an anterior expansion of the scute expression domain. This study shows that the D. quadrilineata enhancer has evolved, and is now active in more anterior regions. When used to rescue scute expression in transgenic D. melanogaster, the D. quadrilineata enhancer is able to induce anterior bristles. Importantly, these properties are not displayed by homologous enhancers from control species bearing only two posterior bristles. Evidence is provied that upstream regulation of the enhancer, by the GATA transcription factor Pannier, has been evolutionarily conserved. This work illustrates how, in the context of a conserved trans-regulatory landscape, evolutionary tinkering of pre-existing enhancers can modify gene expression patterns and contribute to morphological diversification (Marcellini, 2006).

Unfortunately, to date, the mechanism responsible for restricting the activity of the DC enhancer in the anterior direction has not been discovered. However, the direct input of Pnr and U-shaped (Ush), essential for the correct activity of the Dm-DCE along the dorso-lateral axis, has been extensively analyzed. In order to shed light on the ancestry and the functional conservation of the regulation by Pnr and Ush, the sequences of orthologous DCEs, as well as their relative activities in various mutant backgrounds was tested (Marcellini, 2006).

Sequence alignments reveal that the DCEs are greatly variable in size and have undergone considerable turnover. Only the extremities display significant levels of similarity between all species examined. The central region is poorly conserved. The elements from D. melanogaster (1.5 kb) and D. eugracilis (2 kb) are more similar to each other than to the others, in accordance with their closer phylogenetic relationship. The enhancers from D. virilis and D. quadrilineata share a relatively large size (4.1 and 3.3 kb, respectively) and a conserved stretch of about 300 nucleotides that is absent from the D. melanogaster and D. eugracilis sequences. Putative binding sites for Pnr are present in all species. Mutation of a specific Pnr binding site severely reduces activity of the Dm-DCE. This site is embedded within a stretch of 16 nucleotides perfectly conserved between the four species. Interestingly, two other neighbouring GATA sequences can be recognised as homologous between all species. Conservation overall, however, is low, and the number, spacing, and orientation of the remaining putative Pnr binding sites are extremely variable (Marcellini, 2006).

In D. melanogaster, pnr is expressed in a broad medial domain, but activates sc in discrete proneural clusters. Expression of sc mediated by the Dm-DCE is a direct consequence of Pnr binding. DCE function is restricted dorsally through the repressor activity of Ush, which forms heterodimers with Pnr and prevents activation of sc. It was found that the activity of the Dv-DCE and the Dq-DCE in D. melanogaster is restricted to a lateral cluster of cells completely included within the expression domain of pnr. This suggests that, despite significant sequence turnover, the divergent DCEs require Pnr and are efficiently repressed dorsally by Ush. Behaviour of the DCEs was examined in the context of various mutant alleles of pnr. pnrVX4, a strong loss of function allele, pnrV1, a hypomorphic allele and pnrD1, a gain of function allele with a missense mutation that disrupts the interaction of Pnr with Ush were used. Activity of the Dm-DCE was compared with that of the Dv-DCE and that of the Dq-DCE. It was observed that the enhancers react in a similar fashion to four different mutant backgrounds. The expression domains are reduced in loss of function genotypes and expanded in gain of function genotypes (Marcellini, 2006).

This study has presented evidence that the activity of Pnr is conserved and positively regulates the DC enhancers from distantly related Drosophilidae. When assayed in D. melanogaster, the Dv-DCE and Dq-DCE are active in groups of cells completely included within the expression domain of Dm-pnr. It is significant that an essential, high-affinity Pnr binding site in the Dm-DCE is conserved in the DCEs of the other species. Note that the three conserved Pnr binding sites are clustered in a region of the DCE that is required for activity and is sufficient in D. melanogaster to direct weak expression by itself. Expression of sc mediated by the Dm-DCE is restricted dorsally through the repressor activity of Ush that associates with Pnr to prevent activation. In gain-of-function pnr alleles that are insensitive to Ush, activity of the Dv-DCE and the Dq-DCE, like the Dm-DCE, expands dorsally. Most of the open reading frame of pnr was cloned from D. quadrilineata, and it was found that, as in D. virilis, the two zinc fingers are perfectly conserved, suggesting that Dq-Pnr and Dv-Pnr may also bind Ush within their respective species. Hence, it is most likely that Pnr and Ush are direct, evolutionarily conserved regulators of the DCE within Drosophilidae. Indeed the expression domain of pnr, as well as other upstream regulators, has been found to be conserved in other families of flies. Even Pnr from the mosquito Anopheles gambiae is able to regulate ac-sc in transgenic D. melanogaster, suggesting conservation of pnr function throughout the Diptera (Marcellini, 2006).

D. quadrilineata is phylogenetically distant from D. melanogaster and displays four instead of two DC bristles. The results demonstrate that this secondary gain is partly due to evolution of the cis-regulatory sequence that drives sc expression at the DC site. A Dq-DCE-sc minigene, present in transgenic mutant D. melanogaster devoid of the endogenous DC proneural cluster of ac-sc expression, is not only able to rescue posterior bristles, but also allows development of more anterior bristles. It thus mimics the DC phenotype of D. quadrilineata itself. Expression driven by the Dq-DCE in D. melanogaster extends anteriorly in a domain that is longer and thinner. Although the Dq-DCE was not tested in D. quadrilineata itself, it is active in D. melanogaster in a domain that is similar to the DC domain of sc expression in D. quadrilineata visualized by in situ hybridisation. This suggests that the Dq-DCE autonomously reproduces an expression pattern similar to the endogenous one in D. quadrilineata. Expression of sc mediated by the Dm-DCE is restricted laterally through lack of Pnr, dorsally through the repressor activity of Ush and posteriorly through the antagonistic activity of Islet, but it is not yet known what restricts expression in an anterior direction. The anterior expansion seen with the Dq-DCE indicates that this sequence may be at least partially insensitive to whatever factors limit anterior expression driven by the Dm-DCE. Alternatively it may contain new information not present in the other species (Marcellini, 2006).

These observations demonstrate an altered response of the D. quadrilineata sequence to the upstream regulators of D. melanogaster. This response should reside in the sequence of the Dq-DCE itself that is sufficient to modify the phenotype of D. melanogaster when used to drive sc. Thus the exchange of a single, well-defined enhancer is sufficient, not only to reproduce an expression pattern, but also to partially transform a morphological trait of one species into that of another. It is proposed that a change in cis, within a pre-existing regulatory element of sc, contributed to the evolution of the bristle pattern observed in D. quadrilineata by altering the region where it is expressed (Marcellini, 2006).

The Dv-DCE, in D. melanogaster, drives expression in a larger cluster that expands predominantly in a dorsal direction. A Dv-DCE-sc minigene, however, allows the development of only two bristles positioned at the correct locations. The most likely explanation for the fact that the expanded expression driven by Dq-DCE-sc leads to additional bristles, whereas that of the Dv-DCE-sc does not, is probably linked to the different locations of the cells expressing sc. It seems that, in D. melanogaster, the region anterior to the two DC bristles is competent to produce bristles. This region is situated between the domains of expression of sr, a repressor of macrochaete development, and overlaps a band of expression of wingless (wg), a gene encoding a secreted factor that is required to maintain sc expression and to repress sr. It is possible to select for additional anterior DC bristles, but not for macrochaetes on either side of the DC row where sr is expressed but wg is not. Notably, anterior DC bristles were present in the ancestor common to D. melanogaster and D. virilis. The curved shape of the Dq-DCE-driven expression domain means that it avoids overlap with the domains of expression of sr and shows significant overlap with that of wg. Therefore only the Dq-DCE drives expression in an anterior location that is competent to produce bristles (Marcellini, 2006).

Nevertheless transgenic D. melanogaster expressing Dq-DCE-sc do not perfectly reproduce the bristle pattern of D. quadrilineata. The anterior-most DC bristle, the scapular bristle, is absent. This bristle is situated in the prescutum, anterior to the transverse suture. It may be that this difference is attributable to changes in factors that negatively or positively regulate the enhancer in trans. It is also possible that full enhancer activity requires sequences on either side of the fragment tested. Additionally, the modification of cis-regulatory elements lying elsewhere within the D. quadrilineata ac-sc complex could also have contributed to the emergence of the additional bristles. However, it is equally possible that other extraneous factors are responsible that cannot be controlled for in these experiments. For instance, it has been shown that differences in the timing of bristle precursor formation between species can influence the development of macrochaetes (Marcellini, 2006).

The two DC bristles resulting from the activity of Dv-DCE-sc are situated at exactly the correct positions despite the fact that the Dv-DCE drives expression in a cluster of cells that is larger and displaced dorsally when compared with that of D. melanogaster. Thus the fly can compensate for this degree of imprecision in sc expression at the DC site. The explanation for this probably lies in the manner in which the bristle precursors are selected from the proneural cluster. Notch-mediated lateral signalling allows the selection of only two cells destined to become precursors with the appropriate spacing. However, the choice of these cells is not random, but biased by external factors such as the repressors emc and sr, whose activity causes the precursors to arise at similar positions within the DC cluster of all individuals. Their site of origin is in fact located within the region of overlap of expression driven by the Dm-DCE and the Dv-DCE. Positioning of bristle precursors thus results from restricted expression of sc in the proneural clusters as well as other cues that constrain the choice of precursor cell. Together, these two inputs lead to a robust patterning mechanism that is resistant to mild perturbations such as the shifting of the proneural cluster observed for Dv-DCE activity (Marcellini, 2006).

The ability of poorly conserved enhancers to drive expression of reporter genes in homologous tissues when transferred between species of similar morphology has been widely documented in the literature. Where a detailed comparison of enhancer activity allowed a rigorous assessment of the degree of conservation, two different outcomes have been observed. On the one hand, transferring enhancers between related species of Drosophila (e.g., even-skipped), or of nematodes (e.g., lin-48) revealed a perfect conservation of activity, a phenomenon attributed to stabilizing selection. On the other hand, the regulatory regions exchanged between species of sea urchins (e.g., endo-16) or ascidians (e.g., Otx) did not perfectly recapitulate the endogenous expression pattern. The DCEs from D. eugracilis and D. virilis behave like the latter: they drive reporter gene expression in a cluster of cells that is not perfectly co-incident with that of the endogenous DC cluster. The slightly different expression patterns could be due to the divergent sequences, or could result from co-evolution between the enhancer and its regulatory environment. Indeed earlier experiments have hinted that co-evolution between Pnr and its target sequences may be occurring (Marcellini, 2006).

The role of the sensory macrochaetes in behaviour is not known. Many species of Acalyptrata have ancient stereotyped patterns in which the number and precise position of each bristle is invariant. The bristle patterns of the Drosophilidae are remarkably conserved, and the majority of the nearly 4,000 species have two DC bristles. The evolutionary stability of the many bristle patterns suggests a role for selective forces to maintain them. D. quadrilineata is unusual among Drosophilidae in having four or five DC bristles. The anterior-most DC bristles would allow additional positional sensory input, and it is possible that they confer a selective advantage. However, it is important to note that not all morphological change needs be driven by selection. Kimura proposed a neutral theory of molecular evolution in which mutations with null or negligible effect can become passively fixed in populations. Similarly, natural selection alone may not explain the infinite number of subtle morphological variations displayed by the many species of Drosophila described. Exploratory behaviour is an intrinsic property of biological systems, and one may therefore also speculate that evolution can proceed through a series of viable, seemingly useless, phenotypes (Marcellini, 2006).

NF-kappaB/Rel-mediated regulation of the neural fate in Drosophila

Two distinct roles are described for Dorsal, Dif and Relish, the three NF-kappaB/Rel proteins of Drosophila, in the development of the peripheral nervous system. First, these factors regulate transcription of scute during the singling out of sensory organ precursors from clusters of cells expressing the proneural genes achaete and scute. This effect is possibly mediated through binding sites for NF-kappaB/Rel proteins in a regulatory module of the scute gene required for maintenance of scute expression in precursors as well as repression in cells surrounding precursors. Second, genetic evidence suggests that the receptor Toll-8, Relish, Dif and Dorsal, and the caspase Dredd pathway are active over the entire imaginal disc epithelium, but Toll-8 expression is excluded from sensory organ precursors. Relish promotes rapid turnover of transcripts of the target genes scute and asense through an indirect, post-transcriptional mechanism. It is proposed that this buffering of gene expression levels serves to keep the neuro-epithelium constantly poised for neurogenesis (Ayyar, 2007).

The results suggest a dual role for the NF-kappaB/Rel proteins of Drosophila in the formation of SOPs. First, they could be recruited directly to the sc promoter and regulate transcription. The SOP enhancer of sc, required for auto-regulation of sc in the SOPs, contains α boxes (ACTAGA), consensus sequences for NF-kappaB/Rel. Evidence has been obtained for a role of these sequences in both activation and repression of sc. Expression of Rel-VP16, a potent transcriptional activator form of Relish, is able to ectopically activate a reporter gene containing the intact sc SOP enhancer but not one in which the α3 box is mutated. So activation in this experimental situation requires the presence of an intact α3 site. The experiment does not rule out indirect effects, so further work is required to verify whether activation is direct. It is suggested the NF-kappaB/Rel proteins participate in activation and repression of transcription of sc, a hypothesis consistent with dl, Dif and Rel mutant phenotypes of additional as well as missing bristles. Second, unexpected role is described of Rel in mRNA turnover of sc, ase and sens, neuronal genes required to specify and/or maintain the neuronal fate of SOP cells. In Rel mutants, transcripts of sc, ase and sens accumulate due to increased transcript stability. Therefore in the wild type, Relish promotes rapid mRNA turnover, presumably indirectly through an unidentified transcriptional target. A similar phenotype is observed in Toll-8 mutants, which furthermore, interact genetically with Rel mutants. Transcripts for Rel are reduced in the Toll-8 mutant suggesting a role for Toll-8 in maintaining the levels of Rel transcript. This might be the reason for the genetic interaction (Ayyar, 2007).

A number of differences are apparent between mutants of the three NF-kappaB/Rel-encoding genes of Drosophila. Mutants triply homo- or hetero-zygous have a normal complement of bristles, while single homo- or hetero-zygous animals have either additional or missing bristles. This suggests possible opposing functions for these genes. Furthermore bristle phenotypes due to loss or gain of function differ in detail between the three mutants. Together these results point to the importance of the stoichiometric relationships between the three NF-kappaB/Rel proteins and raise the possibility that different Dorsal/Dif/Relish homo- or hetero-dimers may have distinct binding sites and therefore different targets. This merits further investigation (Ayyar, 2007).

If NF-kappaB/Rel proteins both activate and repress sc, then they are expected to activate in SOP cells and repress in cells of the proneural clusters not chosen to be SOPs. Two possible ways that this could occur are discussed. First, activation in the SOP may rely on high levels of proneural protein and low levels of NF-kappaB/Rel protein; conversely repression may require low levels of proneural and high levels of NF-kappaB/Rel protein. Notch-mediated lateral inhibition results in high levels of Sc in the SOP and lower levels in surrounding cells. Toll-8 expression is excluded from SOP cells suggesting, that, if Toll-8 affects NF-kappaB/Rel activity, there would be lower levels of NF-kappaB/Rel in SOPs. NF-kappaB has been shown to activate transcription even without stimulus if IkappaB levels are low enough to allow NF-kappaB-dependent gene expression in the basal state. Interestingly, it has been shown that low levels of Dorsal can act synergistically with bHLH proteins to activate target genes in the embryo. This depends on direct association of Dorsal and bHLH proteins and cooperative binding to closely linked binding sites for the two respective proteins. Furthermore cooperative binding for Sc and Dorsal has been demonstrated. In the sc SOP enhancer one of the alpha boxes is indeed close to an E box, so perhaps high levels of Sc and low levels of NF-kappaB/Rel combine to activate transcription in the SOP. Two observations are consistent with this hypothesis: Rel-VP16 was able to ectopically activate sc-SOPE-lacZ only at sites where ac and sc are expressed and, after over-expression of NF-kappaB/Rel proteins, bristles are generally missing on the lateral notum (where Toll-8 levels are high), whereas ectopic bristles are found on the medial notum (where Toll-8 levels are low) (Ayyar, 2007).

A second means by which NF-kappaB/Rel proteins could act differently in SOP and in non-SOP cells, may be the presence/absence of co-factors. It has been shown that Dorsal can be converted from an activator to a repressor by association with the co-repressor Groucho. This bi-functionality is attributable to the fact that Dl only weakly interacts with Gro. During embryogenesis both Cut and Dead ringer bind an AT-rich silencer sequence, AT2, present in target genes of Dorsal and both Dorsal and Dead ringer bind the co-repressor Groucho and recruit it to DNA. A similar AT-rich sequence (the β box) is present in the sc SOP enhancer. Furthermore repression of sc by the E(spl) proteins, targets of Notch signalling in non-SOP cells, is already known to require the activity of Groucho (Ayyar, 2007).

Transcripts for sc, ase and sens (and GFP) accumulate in Rel and Toll-8 mutants as a result of increased transcript stability. Transcript stability correlates with the presence of a six or seven nucleotide motif in the transcribed sequence of these genes. The motif is present in sc, ase and sens, but not ac the transcription of which is unaffected in Rel mutants. The motif is almost identical to the heptamer in MyoD and Sox9 that is associated with transcript stability after inhibition of NF-kappaB/Rel signalling in C2C12 cells. A sc mutant with a truncated sc transcript lacking one of the two motifs present in the coding sequence of this gene, has a phenotype similar to Rel and Toll-8 mutants and an increase in sc mRNA. It has been suggested that increased stability of the transcripts rather than increased transcription underlies this phenotype. The presence of the heptamer is noted in a number of genes involved in sensory organ patterning suggesting possible regulation by NF-kappaB/Rel of a battery of genes in the imaginal epithelium. A similar motif is present in other vertebrate targets of NF-kappaB/Rel. Post-transcriptional regulation of target genes by NF-kappaB/Rel could therefore be an ancient feature common to Drosophila and mammals and possibly even jellyfish. It has been suggest that an unknown factor, presumably a transcriptional target of NF-kappaB/Rel, regulates messenger turnover through association with this sequence. In Rel and Toll-8 mutants the accumulated transcripts are not translated. This must be an effect of the mutants because ectopic expression in wild-type flies allows translation and ectopic bristle formation (Ayyar, 2007).

Promotion of a rapid turnover of transcripts of neuronal genes presumably does not take place in the SOPs where high levels of the protein products of these genes are required. Accordingly Toll-8 expression is extinguished in the SOPs after their formation. Factors specific to the SOP presumably allow translation of the transcripts. It is therefore suggested that high levels of Relish provided by Toll-8 in non-SOP cells might be required for post-transcriptional regulation of neuronal genes (Ayyar, 2007).

In wild-type animals expression of neuronal precursor genes such as sens and ase is restricted to SOPs where they are activated by high levels of Ac and Sc. The results suggest that they are in fact expressed over the entire neuro-epithelium but that mRNA turnover is rapid due to NF-kappaB/Rel activity. Activation of ac-sc in proneural clusters would counteract the effects of NF-kappaB/Rel to allow selection of SOPs. After selection of SOPs for the large sensory bristles is finished, Toll-8 expression is maintained in the epithelium, suggesting that high levels of NF-kappaB/Rel are still required for continued transcript turnover. Continuous buffering of neuronal gene expression presumably continues until the next round of neurogenesis that takes place after pupariation when precursors for the small bristles form. Therefore it is hypothesized that NF-kappaB/Rel plays a subtle role in maintaining steady state levels of expression of many genes required for neural development. The maintenance of low levels of expression of neuronal genes would keep the tissue poised for neurogenesis that takes place in repeated rounds. Perhaps low levels of expression of neuronal genes are characteristic of neuro-epithelia in general (Ayyar, 2007).

The hypothesis concerning the dual role of NF-kappaB/Rel in neurogenesis in Drosophila is as follows. The neuro-epithelium of the imaginal discs expresses neuronal genes. Prior to development of SOPs, high levels of Toll-8 maintain high levels of Rel and result in nuclear accumulation of NF-kappaB/Rel. Through an unknown transcriptional target(s), Relish promotes rapid turnover of neuronal transcripts by a post-transcriptional mechanism. This might be mediated by a specific sequence in the coding regions of target genes. Activation of ac and sc in proneural clusters by regulatory proteins of the notal prepattern counteracts the effects of Relish. After singling out of SOPs by Notch-mediated lateral inhibition, Toll-8 expression ceases in the SOPs. Reduced levels of signal uncover a trans-activator function for NF-kappaB/Rel that, synergistically with Sc, helps to maintain high levels of sc expression in the SOP, possibly through direct binding to consensus sequences in the sc SOP enhancer. The NF-kappaB/Rel proteins may also directly repress sc in non-SOP cells of the proneural clusters. It remains to be seen to what extent each of the three proteins participates in these two processes (Ayyar, 2007).

Transcriptional Regulation

Neurogenesis in Drosophila melanogaster starts by an ordered appearance of neuroblasts arranged in three columns (medial, intermediate and lateral) in each side (right and left) of the neuroectoderm. In the intermediate column, the receptor tyrosine kinase Egfr represses expression of proneural genes achaete and scute, and is required for the formation of neuroblasts. Most of the early function of Egfr is likely to be mediated by the Ras-MAP kinase signaling pathway, which is activated in the intermediate column, since a loss of a component of this pathway leads to a phenotype identical to that of Egfr mutants. MAP-kinase activation is also observed in the medial column where escargot (esg) and proneural gene expression are unaffected by Egfr. The homeobox gene ventral nerve system defective (vnd) is required for the expression of esg and scute in the medial column. vnd acts through the negative regulatory region of the esg enhancer that mediates the Egfr signal, suggesting vnd's role is to counteract Egfr-dependent repression. Thus, the nested expression of vnd and the Egfr activator Rhomboid is crucial to subdivide the neuroectoderm into the three dorsoventral domains (Yagi, 1998).

To investigate the involvement of Egfr in neurogenesis, mutant phenotypes of Efgr and its activator rho were examined at various stages of neurogenesis. The dorsoventral subdivision of the neuroectoderm in stage-6 embryos is detectable by expression of esg, which is expressed in the lateral and medial columns but not in the intermediate column. A loss-of-function, temperature-sensitive mutation of Egfr and a null mutation of rhomboid were used for analysis throughout this work. Egfr and rho mutations cause ectopic expression of esg in the intermediate column. Repression of esg in the intermediate column is likely to require a relatively high dose of Egfr signal. To examine the potential role of Egfr in neurogenesis, expression of the proneural genes ac and sc was carried out. These two proneural genes begin expression in the neuroectoderm of stage-7 embryos in a DV pattern of expression similar to that of esg in the previous stage. In Egfr and rho mutant embryos, ac and sc become ectopically expressed in the intermediate column. This phenotype is less penetrant and, occasionally, gaps of ac and sc expression are observed in the intermediate column. Since sc expression was similarly derepressed in Egfr mutant embryos, these phenotypes are likely to represent the near null phenotype of Egfr in the neuroectoderm. These data indicate that, in the intermediate column, the Egfr signal represses not only esg but also proneural genes, which are known to play key roles in neurogenesis (Yagi, 1998).

A study by S. D. Weatherbee (1998) is arguably the best study yet published about how gene regulation differs in homologous structures, and points to future studies for how differential gene regulation will be shown to account for the structural differences between species. The differentiation of the Drosophila haltere from the wing through the action of the Ultrabithorax (Ubx) gene is a classic example of Hox regulation of serial homology. This study reveals several features of the control of haltere development by Ubx which, in principle, are likely to apply to the Hox-regulated differential development of other serially homologous structures in other animals. The formation of margin bristles is regulated by Wingless via the induction of the proneural achaete (ac) and scute (sc) target genes and also requires the Cut transcription factor. In the haltere disc, Cut is expressed along the anterior DV boundary, whereas ac and sc are not induced. To determine if Ubx represses ac/sc activation by Wg, Ubx clones were examined. In the haltere disc, sc expression is derepressed in clones that touch or cross the anterior portion of the DV boundary. Conversely, sc expression is lost in anterior wing disc cells that ectopically express Ubx. This repression by Ubx is sensitive to the dosage of Ubx activity, since ectopic ac/sc expression is observed in Ubx/+ haltere discs. This ectopic expression corresponds with ectopic bristles found on the halteres of Ubx/+ adults. Further reductions of Ubx function in haltere discs cause greater derepression of sc on the DV boundary and a corresponding emergence of triple row bristles on the adult haltere. The haltere has several types of sense organs, including the proximally located pedicellular sensillae, which are not present on the wing. Correspondingly, sc is expressed in the presumptive pedicellar portion of the haltere disc but not in the equivalent part of the wing disc. In Ubx clones in this region of the haltere disc, sc expression is lost. Therefore, Ubx is required to positively regulate sc in this unique pattern in the haltere disc. Together with the repression of sc along the DV boundary of the haltere, these observations suggest that Ubx acts on two independent domains of the sc expression pattern, presumably via specific cis-regulatory elements controlling each aspect of sc gene expression (Weatherbee, 1998).

Ectopic expression of the scute gene in the developing haltere is sufficient to induce ectopic sensory organs. Interestingly, near the DV boundary, large bristles resembling those of the wing margin are induced, whereas in more proximal regions, sense organs form that are characteristic of the haltere. This result suggests that the repression of sensory organ formation by Ubx at the DV boundary is largely at the level of the sc gene, whereas the character of the proximal sense organs is modified by Ubx action downstream of or parallel to scute. Thus, all three outcomes outlined above are obtained in these ectopic expression experiments, which reveal that Ubx acts independently on the five genes identified as well as on genes further downstream of or parallel to these regulators in the wing patterning hierarchy (Weatherbee, 1998).

In developing organs, the regulation of cell proliferation and patterning of cell fates is coordinated. How this coordination is achieved, however, is unknown. In the developing Drosophila wing, both cell proliferation and patterning require the secreted morphogen Wingless (Wg) at the dorsoventral compartment boundary. Late in wing development, Wg also induces a zone of non-proliferating cells at the dorsoventral boundary. This zone gives rise to sensory bristles of the adult wing margin. How Wg coordinates the cell cycle with patterning has been investigated by studying the regulation of this growth arrest. Wg, in conjunction with Notch, induces arrest in both the G1 and G2 phases of the cell cycle in separate subdomains of the zone of non-proliferating cells (ZNC). The ZNC is composed of three subdomains, each about four cells wide. Cells in the central domain express wg. This domain is flanked by dorsal and ventral domains, which, in the anterior compartment, express Achaete and Scute. Cells in the ZNC stop proliferating 30 h before most of the other cells in the disc but re-enter the cell cycle for two or three divisions after pupariation. This arrest is seen by an absence of cells in the S phase of mitosis. The domain architecture of the ZNC is suggested by the expression of string and the G2 cyclins A and B. In the anterior compartment, cells in the dorsal and ventral domains do not express STG messenger RNA but accumulate high leves of G2 cyclins in the cytoplasm. Since Stg is required for mitosis and Stg and the G2 cyclins are degraded at cell division, these patterns are indicative of arrest in G2. In contrast, in the central domain CycA and CycB proteins are undetectable, but STG mRNA is expressed. This indicates that these cells may be arrested in G1. G1 arrest may be due to inactivation of dE2F, a factor required to activate the transcription of genes needed for DNA replication (Johnston, 1998).

Loss of wingless function during disc development abolishes both the G1 and G2 arrests and allows string expression in the anterior dorsal and ventral domains. Four observations suggest that the proneural genes achaete and scute regulate the G2 arrest of the ZNC:

  1. ac and sc are expressed in the stg-negative, G-2 arrested cells, but not in G1-arrested cells.
  2. Loss of Wg activity results in loss of expression of ac and sc.
  3. Ectopic Wg or activated Arm expands the domain of stg-negative, Ac-positive cells.
  4. Expression of ac and sc in the ZNC is extinguished just before re-entry into the cell cycle, after pupariation.

Together, these results indicate that Wg induces G2 arrest in two subdomains by inducing the proneural genes achaete and scute, which downregulate the mitosis-inducing phosphatase String (Cdc25). Notch activity creates a third domain by preventing arrest at G2 in wg-expressing cells, resulting in their arrest in G1. To test whether Notch directly regulates the G1 arrest, discs were constructed lacking Wg activity, but expressing activated Notch in the ZNC. These discs do not form a ZNC at all. Thus, in the absence of Wg activity, Notch is not sufficient to induce a G1 arrest. It is noted that the string promoter contains putative Ac/Sc-binding sites, indicating that these basic helix-loop-helix proteins can repress string expression directly (Johnston, 1998).

The Bar homeobox genes function as latitudinal prepattern genes in the developing Drosophila notum. In Drosophila notum, the expression of achaete-scute proneural genes and bristle formation have been shown to be regulated by putative prepattern genes expressed longitudinally. The two Bar locus genes may belong to a different class of prepattern genes expressed latitudinally: it is suggested that the developing notum consists of checker-square- like subdomains, each governed by a different combination of prepattern genes. BarH1 and BarH2 are coexpressed in the anterior-most notal region and regulate the formation of microchaetae within the region of BarH1/BarH2 expression through activating achaete-scute. Presutural macrochaetae formation also requires Bar gene activity. Bar gene expression is restricted in dorsal and posterior regions by Decapentaplegic signaling, while the ventral limit of the expression domain of Bar genes is determined by wingless, whose expression is under the control of Decapentaplegic signaling (Sato, 1999).

Genetic analysis of bristle loss in hybrids between Drosophila melanogaster and D. simulans provides evidence for divergence of cis-regulatory sequences in the achaete-scute gene complex

The two closely related species of Drosophila, D. melanogaster and D. simulans, display an identical bristle pattern on the notum, but hybrids between the two are lacking a variable number of bristles. The loss is temperature-dependent and evidence is provided for two periods of temperature sensitivity. A first period of heat sensitivity occurs during larval development and corresponds to the time when the prepattern of expression of genes is established. The products of these genes activate achaete-scute in the proneural clusters, preceding bristle precursor formation. A second period of cold sensitivity corresponds to the time of emergence of the bristle precursor cells and the maintenance of their neural fate, a process requiring high levels of Achaete-Scute. Expression of achaete-scute at these two critical periods depends on cis-regulatory elements of the achaete-scute complex (AS-C). The differences between males, which have only one copy of the X-linked AS-C from D. simulans, and females, which have copies from both parental species, have been compared, together with the effects of crossing in different rearrangements of the D. melanogaster AS-C that delete regulatory and/or coding sequences. Evidence indicates that bristle loss in the hybrids may result from a decrease in the level of transcription at the AS-C and argues that interaction between trans-acting factors and cis-regulatory elements within the AS-C have diverged between the two species (Skaer, 2000).

An exogenous supply of Scute delivered with a heat shock construct can rescue missing bristles. Animals grown at 18°C were heat shocked for 3 h between 12 and 24 h BPF. There is a significant recovery of bristles (a total loss of 23% bristles in experimental flies compared to 38% in controls. All bristle types show some rescue from this treatment though to varying extents. Effects of heat shock at different times before or after pupariation were examined. The best rescue was obtained from heat shocks applied close to the time of formation of the precursors for each bristle. For example, the APA and PSC precursors form early between 24 and 12 h before pupariation. These bristles show some rescue from early heat shocks but a much greater rescue from heat shocks given 6-12 h before pupariation. They were not rescued by heat shock after pupariation. In contrast the precursor for the PPA bristle forms later, just after pupariation. This bristle is rescued after heat shock at all stages before pupariation but the greatest rescue is seen at pupariation itself and some rescue is still possible after pupariation. It is concluded that an exogenous supply of Scute can effect some rescue of the bristles in the hybrid (Skaer, 2000).

The EGF receptor and N signalling pathways act antagonistically in Drosophila mesothorax bristle patterning

An early step in the development of the large mesothoracic bristles (macrochaetae) of Drosophila is the expression of the proneural genes of the achaete-scute complex (AS-C) in small groups of cells (proneural clusters) of the wing imaginal disc. This is followed by a much increased accumulation of AS-C proneural proteins in the cell that will give rise to the sensory organ, the SMC (sensory organ mother cell). This accumulation is driven by cis-regulatory sequences, SMC-specific enhancers, that permit self-stimulation of the achaete, scute and asense proneural genes. Negative interactions among the cells of the cluster, triggered by the proneural proteins and mediated by the Notch receptor (lateral inhibition), block this accumulation in most cluster cells, thereby limiting the number of SMCs. In addition, proneural proteins trigger positive interactions among cells of the cluster that are mediated by the Epidermal growth factor receptor (Egfr) and the Ras/Raf pathway. These interactions, which are termed 'lateral co-operation', are essential for macrochaetae SMC emergence. Activation of the Efgr/Ras pathway appears to promote proneural gene self-stimulation mediated by the SMC-specific enhancers. Excess Egfr signaling can overrule lateral inhibition and allow adjacent cells to become SMCs and sensory organs. Thus, the Egfr and Notch pathways act antagonistically in notum macrochaetae determination (Culí, 2001).

The earliest stage in macrochaetae development is the formation of the proneural clusters of ac-sc expression. Accumulation of Sc in cells of proneural clusters located at the more central positions of the wing disc decreases upon reduction of the level of Egfr signaling. The effect is cell-autonomous, which indicates that reception of the signal is important for cells to express sc properly. In contrast, more marginally located clusters, like the notopleural or scutellar, are unmodified or slightly enhanced under conditions of insufficient Egfr signaling. It is known that expression of ac-sc in different proneural clusters depends on separate, functionally independent enhancers which are thought to respond to local, specific combinations of transcription factors (prepattern). The different, spatially restricted effects of the insufficiency of Egfr function may thus be due to interference in the deployment or function of particular factors expressed in the affected area. Interestingly, the expression of the homeobox genes of the iroquois complex, necessary for the expression of ac-sc in many notum proneural clusters, is especially sensitive to the expression of the Vein Egfr ligand in the central region of the notum. Alternatively, since Egfr function is a well known requisite for growth and patterning of imaginal discs, the reduced expression of sc may be due to a more general impairment of the patterning of the central area of the disc (Culí, 2001).

The data support a key role for Egfr signaling in the emergence of the notum macrochaetae SMCs from proneural clusters. Indeed, expression of the Egfr inhibitory ligand Aos exclusively in proneural clusters, a condition that permits essentially wild-type Sc accumulation in these clusters, almost completely suppresses the appearance of SMCs and SOs. SMC emergence is also impaired in discs from heat-treated temperature sensitive Egfr larvae and in clones of cells expressing UAS-rafDN2.1. Moreover, when the cells that accumulate RafDN2.1 occupy positions where SMCs normally appear, wild-type neighboring cells give rise to displaced SMCs. This phenomenon is reminiscent of and in accordance with the observation, made with mosaic individuals, that when the position of a dorsocentral bristle is in ac minus territory, this bristle does not develop, but a nearby ac plus cell can give rise to a dorsocentral bristle displaced from its wild-type position. The cell-autonomous effect of RafDN2.1 indicates that reception of the Egfr signal, mediated by the Ras/Raf/MAP kinase cassette, is essential for notum macrochaetae SMC determination. This was further substantiated by the cell autonomous induction of SMCs and bristles in clones of cells overexpressing a constitutively activated form of Ras. Taken together, these results indicate that reception of the Egfr signal promotes sc expression and SMC determination (Culí, 2001).

In the notum anlagen the expression of rho/ve occurs mainly in proneural clusters and this expression is dependent on ac-sc. Rho/ve facilitates the processing of Spitz, an activating ligand of Egfr. The soluble, active form of Spitz promotes ectopic sc expression and SMC emergence. Hence, these data suggest that, in proneural clusters, Ac-Sc promote expression of rho/ve, which by activating Spitz, would stimulate Egfr signaling in the cells of the cluster. (The Vein Egfr ligand probably does not specifically act in proneural clusters, because many of these lie outside of its expression domain). It is thus proposed that Egfr mediates a mutual positive signaling among cells of the proneural cluster, which promotes SMC emergence by probably reinforcing ac-sc expression. This positive signaling is called lateral cooperation. Evidently, this does not exclude an autocrine activation of the Egfr pathway in the cells that express AS-C proteins, but the lateral cooperation hypothesis is favored since it is well established in other systems that the Egfr pathway is used mainly for intercellular communication. This signaling should facilitate the acquisition of the SMC state by one or a few cells of a proneural cluster (Culí, 2001).

The SMC state is associated with greatly increased levels of proneural protein. These are accomplished by the self-stimulation of ac, sc and ase mediated by AS-C enhancers that activate these genes specifically in the cells that become SMCs. Since Ras1V12 elicits the expression of both sc and SRV-lacZ, it is proposed that, in the extant proneural clusters, the SMC-specific enhancers are targets of Egfr signaling. Unidentified effector(s) of the Egfr/Ras pathway should facilitate the self-stimulation of the proneural genes mediated by the SMC-specific enhancers by, possibly, binding to these enhancers. Conclusive evidence in support of this role requires the identification of the signaling effector(s) and of their interaction with the enhancer. Interestingly, overexpression of the effector Pointed P1 promotes development of many extra macrochaetae on the notum and putative Ets-domain binding sites have been identified in the sc and ase SMC enhancers (GTGGAAAT and ACGGAAAC, respectively) (Culí, 2001).

Egfr-mediated lateral cooperation should tend to activate the SMC-specific enhancers in many cells of the proneural clusters. This, however, is prevented by N signaling, which is activated by Ac and Sc in the cells of the cluster. This signaling, by means of the bHLH proteins of the E(spl)-C, blocks the ac-sc-ase self-stimulatory loop promoted by the SMC-specific enhancers. However, within a proneural cluster the cells of the proneural field accumulate greater amounts of Ac-Sc proteins. As it has been hypothesized that cells that signal the most are the least inhibited by their neighbors, eventually, a cell of the proneural field will be released from the inhibitory loop and its levels of E(spl)-C bHLH protein will become minimal. This cell will turn on the ac-sc-ase self-stimulation and become an SMC. The SMC signals maximally to its neighbors and prevents them from following the same fate (lateral inhibition). These results add to this scenario the requirement for Egfr-mediated signaling for one cell of the proneural field to turn on the ac-sc-ase self-stimulatory loops and become an SMC. According to this model, Ac-Sc activate both the N-and Egfr-mediated signaling pathways, with their SMC-suppressing and SMC-promoting abilities, respectively, and both signaling systems appear to act on the same SMC-specific enhancers (Culí, 2001).

Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila

If Senseless is required for proneural expression, ectopic expression of Sens may induce proneural gene expression. Indeed, ectopic expression of Sens using the dpp-GAL4 driver causes robust expression of Sens in the expected wing stripe. This expression causes the formation of numerous bristles and sensilla campaniforma in the adult wing in proximity of the third wing vein where dpp is normally expressed. Similarly, ectopic expression of Sens in the leg disc causes many supernumerary bristles in the sternopleural area as well as in more distal portions of the leg. Ectopic bristles are observed with all UAS-sens reporters. Some UAS-sens transgenes driven by dpp-GAL4 cause very severe tufting in the adult notum, wings, and legs, and loss of tissues in other portions of imaginal discs, e.g., wing margins and distal leg structures. It is concluded that ectopic expression of Sens is sufficient to initiate ectopic external sensory organ development (Nolo, 2000).

To determine the molecular cascade underlying the formation of the extra external sensory organs, wing discs of UAS-sens; dpp-GAL4 larvae were stained with anti-Scute antibodies. Ectopic Sens expression causes ectopic activation of Scute and Asense. Hence, Sens is able to activate proneural gene expression. This provides a molecular basis for the generation of additional external sensory organs, since ectopic proneural gene expression has previously been shown to be sufficient to induce ectopic PNS organ formation (Nolo, 2000).

If Sens induces proneural gene expression and proneural genes are required for Sens production, a super-additive or synergistic interaction between sens and proneural genes may occur. Therefore, the weakest UAS-sens transgene (C1) was expressed in combination with an UAS-scute and an UAS-atonal transgene under the control of dpp-Gal4. Overexpression of Scute or Atonal alone causes a relatively mild phenotype with relatively few extra bristles. Scute expression induces Sens expression, but the expression levels of Sens are lower than those induced by dpp-Gal4; UAS-sens. Ectopic expression of Sens with the dpp-Gal4 driver causes a stronger phenotype when compared to ectopic expression of Scute or Atonal. However, simultaneous overexpression of Sens and Scute or Atonal causes severe tufting, including in many areas where Scute, Atonal, or Sens, when expressed individually, does not normally cause ectopic bristles. These areas do correspond to areas where the dpp-Gal4 driver has previously been shown to be expressed. It is therefore concluded that sens and the proneural genes can interact in a synergistic fashion (Nolo, 2000).

Tramtrack co-operates to prevent inappropriate neural development in Drosophila

Each sensory organ of the Drosophila peripheral nervous system is derived from a single sensory organ precursor cell (SOP). These originate in territories defined by expression of the proneural genes of the Achaete-Scute complex (AS-C). Formation of ectopic sensilla outside these regions is prevented by transcriptional repression of proneural genes. The BTB/POZ-domain transcriptional repressor Tramtrack (Ttk) co-operates in this repression. Ttk is expressed ubiquitously, except in proneural clusters and SOPs. Ttk over-expression represses proneural genes and sensilla formation. Loss of Ttk enhances bristle-promoting mutants. Using neural repression as an assay, functional domains of Ttk have been dissected, confirming the importance of the Bric-a-brac-Tramtrack-Broad complex (BTB) motif. The Ttk BTB domain is a protein-protein interaction motif mediating tetramer formation (Badenhorst, 2002).

The ablation of SOPs is caused by the repression of proneural genes. Ectopic expression of Ttk69 under the control of a heat-shock promoter inhibits achaete and scute transcription. Accumulation of Asense protein is also blocked. Over-expression of Ttk88 also perturbs achaete, scute and asense expression showing that both isoforms of Ttk can repress the AS-C. Significantly, though, the extent of repression is lower. This could reflect differences in protein stability of the two isoforms. Both are targeted for ubiquitin-dependent proteolysis. However, Ttk69, unlike Ttk88, is post-translationally modified by the small ubiquitin-like molecule dSmt3. This modification has been shown to protect IkappaBalpha from ubiquitin-dependent degradation (Badenhorst, 2002).

Ttk blocks SOP recruitment by repressing transcription of the proneural genes. In the developing PNS, Ttk completely inhibits achaete and asense expression and blocks part of the scute expression profile. Surprisingly, in the embryonic central nervous system (CNS), Ttk over-expression only represses asense but has no effect on achaete. Inspection of the promoters of the proneural genes reveals that the immediate 5' promoter region of asense contains many clustered consensus Ttk69-binding sites, suggesting that Ttk inhibits asense by directly repressing the proximal promoter. In contrast, the upstream promoter region of achaete does not contain large numbers of consensus sites. A cluster of Ttk69-recogntion sites is found downstream of achaete. It is conceivable that specific repression of achaete in the PNS is achieved by blocking PNS-specific enhancers while not affecting regulatory elements required for expression in the CNS. The existence of separate enhancers directing expression of achaete and scute in the CNS and PNS has been inferred from deletions and inversions that affect subsets of the achaete expression profile (Badenhorst, 2002).

Prospero, targeting scute, acts as a binary switch between self-renewal and differentiation in Drosophila neural stem cells

Stem cells have the remarkable ability to give rise to both self-renewing and differentiating daughter cells. Drosophila neural stem cells segregate cell-fate determinants from the self-renewing cell to the differentiating daughter at each division. This study shows that one such determinant, the homeodomain transcription factor Prospero, regulates the choice between stem cell self-renewal and differentiation. The in vivo targets of Prospero have been identified throughout the entire genome. Prospero represses genes required for self-renewal, such as stem cell fate genes and cell-cycle genes. Surprisingly, Prospero is also required to activate genes for terminal differentiation. In the absence of Prospero, differentiating daughters revert to a stem cell-like fate: they express markers of self-renewal, exhibit increased proliferation, and fail to differentiate. These results define a blueprint for the transition from stem cell self-renewal to terminal differentiation (Choksi, 2006).

To identify sites within the Drosophila genome to which Prospero binds, use was made of an in vivo binding-site profiling technique, DamID. DamID is an established method of determining the binding sites of DNA- or chromatin-associated proteins. Target sites identified by DamID have been shown to match targets identified by chromatin immunoprecipitation (ChIP). DamID enables binding sites to be tagged in vivo and later identified on DNA microarrays. In brief, the DNA or chromatin-binding protein of interest is fused to an Escherichia coli adenine methyltransferase (Dam), and the fusion protein is expressed in vivo. The DNA-binding protein targets the fusion protein to its native binding sites, and the Dam methylates local adenine residues in the sequence GATC. The sequences near the protein-DNA interaction site are thereby marked with a unique methylation tag, over approximately 2-5 kilobase pairs (kb) from the binding site. The tagged sequences can be isolated after digestion with a methylation-sensitive restriction enzyme, such as DpnI (Choksi, 2006).

Dam was fused to the N terminus of Prospero, and transgenic flies were generated. The fusion protein is expressed from the uninduced minimal Hsp70 promoter of the UAS vector, pUAST, as high levels of expression of Dam can result in extensive nonspecific methylation and cell death. As a control for nonspecific Dam activity, animals expressing Dam alone were generated. To assess the sites to which Prospero binds during neurogenesis, genomic DNA was extracted from stage 10-11 embryos, approximately 4-7 hr after egg laying (AEL), expressing either the Dam-Prospero fusion protein or the Dam protein alone. The DNA was digested with DpnI and amplified by PCR. DNA from Dam-Prospero embryos was labeled with Cy3, and control DNA with Cy5. The samples were then cohybridized to genomic microarrays. Microarrays were designed that tile the entire euchromatic Drosophila genome. A 60 base oligonucleotide was printed for approximately every 300 bp of genomic DNA, resulting in roughly 375,000 probes on a single array (Choksi, 2006).

Log-transformed ratios from four biological replicates (two standard dye configurations plus two swapped dye configurations) were normalized and averaged. Regions of the genome with a greater than 1.4-fold log ratio (corresponding to approximately a 2.6-fold enrichment) of Dam-Prospero to the control over a minimum of four adjacent genomic probes were identified as in vivo Prospero binding sites. Using these parameters, a total of 1,602 in vivo Prospero binding sites were identified in the Drosophila genome. This work demonstrates that it is possible to map in vivo binding sites across the whole genome of a multicellular organism (Choksi, 2006).

Prospero is known to regulate the differentiation of photoreceptors in the adult eye, and recently sites have been characterized to which Prospero can bind upstream of two Rhodopsin genes, Rh5 and Rh6. A variant of the Prospero consensus sequence is found four times upstream of Rh5 and four times upstream of Rh6. Prospero was shown to bind this sequence in vitro, by band shift assay, and also by a 1-hybrid interaction assay in yeast. In addition, deletion analysis demonstrated that the consensus sequence is required for the Pros-DNA interaction both in vivo and in vitro. It was found that 67% of in vivo binding sites contain at least one Prospero binding motif. Combining in vivo binding-site data with searches for the Prospero consensus sequence reveals 1,066 distinct sites within the Drosophila genome to which Prospero binds during embryogenesis (Choksi, 2006).

A total of 730 genes have one or more of the 1,066 Prospero binding sites located within 1 kb of their transcription unit. Statistical analyses to determine GO annotation enrichment on the members of the gene list that had some associated annotation (519) was performed by using a web-based set of tools, GOToolbox. Using Biological Process (GO: 0008150) as the broadest classification, a list was generated of overrepresented classes of genes (Choksi, 2006).

The three most significant classes of genes enriched in the list of putative Prospero targets are Cell Fate Commitment, Nervous System Development, and Regulation of Transcription. Utilizing GO annotation, it was found that nearly 41% of all annotated neuroblast fate genes (11 of 27) are located near Prospero binding sites and that approximately 9% of known cell-cycle genes are near Prospero binding sites. These include the neuroblast genes achaete (ac), scute (sc), asense (ase), aPKC, and mira and the cell-cycle regulators stg and CycE. In addition, it was found that the Drosophila homolog of the mammalian B lymphoma Mo-MLV insertion region 1 (Bmi-1) gene, Posterior sex combs, is located near a Prospero binding site. Bmi-1 is a transcription factor that has been shown to regulate the self-renewal of vertebrate hematopoetic stem cells. It is concluded that Prospero is likely to regulate neuroblast identity and self-renewal genes as well as cell-cycle genes directly, repressing their expression in the GMC (Choksi, 2006).

Prospero enters the nucleus of GMCs, and its expression is maintained in glial cells but not in neurons . Therefore the list of targets was searched for genes annotated as glial development genes. Prospero binds near 45% of genes involved in gliogenesis. Among the glial genes, it was found that the master regulator of glial development, glial cells missing (gcm), and gilgamesh (gish), a gene involved in glial cell migration, are both near Prospero binding sites and are likely directly activated by Prospero in glia (Choksi, 2006).

In summary, Prospero binds near, and is likely to regulate directly, genes required for the self-renewing neural stem cell fate such as cell-cycle genes. It was also found that Prospero binds near most of the temporal cascade genes: hb, Kruppel (Kr), nubbin (nub/pdm1), and grainyhead (grh) and to genes required for glial cell fate. The in vivo binding-site mapping experiments are supportive of a role for Prospero in regulating the fate of Drosophila neural precursors by directly controlling their mitotic potential and capacity to self-renew (Choksi, 2006).

The Drosophila ventral nerve cord develops in layers, in a manner analogous to the mammalian cortex. The deepest (most dorsal) layer of the VNC comprises the mature neurons, while the superficial layer (most ventral) is made up of the mitotically active, self-renewing neuroblasts. Neuroblast cell-fate genes and cell-cycle genes are normally expressed only in the most ventral cells, while Prospero is found in the nucleus of the more dorsally lying GMCs. If in GMCs, Prospero normally acts to repress neuroblast cell-fate genes and cell-cycle genes, then in a prospero mutant, expression of those genes should expand dorsally. Conversely, ectopically expressed Prospero should repress gene expression in the neuroblast layer.

The neuroblast genes mira, ase, and insc and the cell cycle genes CycE and stg show little or no expression in differentiated cells of wild-type stage 14 nerve cords. Expression of these neuroblast-specific genes was examined in the differentiated cells layer of prospero embryos and it was found that they are derepressed throughout the nerve cord of mutant embryos. mira, ase, insc, CycE, and stg are all ectopically expressed deep into the normally differentiated cell layer of the VNC. To check whether Prospero is sufficient to repress these genes, Prospero was expressed with the sca-GAL4 driver, forcing Prospero into the nucleus of neuroblasts. Prospero expression is sufficient to repress mira, ase, insc, CycE, and stg in the undifferentiated cell layer of the VNC. These data, combined with the Prospero binding-site data, demonstrate that Prospero is both necessary and sufficient to directly repress neuroblast genes and cell-cycle genes in differentiated cells. This direct repression of gene expression is one mechanism by which Prospero initiates the differentiation of neural stem cells (Choksi, 2006).

Having shown that Prospero directly represses genes required for neural stem cell fate, it was asked whether Prospero also directly activates GMC-specific genes. Alternatively, Prospero might regulate a second tier of transcription factors, which are themselves responsible for the GMC fate. Of the few previously characterized GMC genes, it was found that Prospero binds to eve and fushi-tarazu (ftz). In the list of targets several more GMC genes were expected to be found, but not genes involved in neuronal differentiation, since Prospero is not expressed in neurons. Surprisingly, however, it was foudn 18.8% of neuronal differentiation genes are located near Prospero binding sites (Choksi, 2006).

To determine Prospero's role in regulating these neuronal differentiation genes, in situ hybridization was carried out on prospero mutant embryos. Prospero was found to be necessary for the expression of a subset of differentiation genes, such as the adhesion molecules FasciclinI (FasI) and FasciclinII (FasII), which have roles in axon guidance and/or fasciculation. Netrin-B, a secreted protein that guides axon outgrowth, and Encore, a negative regulator of mitosis, also both require Prospero for proper expression. Therefore, in addition to directly repressing genes required for neural stem cell self-renewal, Prospero binds and activates genes that direct differentiation. These data suggest that Prospero is a binary switch between the neural stem cell fate and the terminally differentiated neuronal fate (Choksi, 2006).

To test to what extent Prospero regulates the genes to which it binds, genome-wide expression profiling was carried out on wild-type and prospero mutant embryos. While the DamID approach identifies Prospero targets in all tissues of the embryo, in this instance genes regulated by Prospero were assayed in the developing central nervous system. Small groups of neural stem cells and their progeny (on the order of 100 cells) were isolated from the ventral nerve cords of living late stage 12 embryos with a glass capillary. The cells were expelled into lysis buffer, and cDNA libraries generated by reverse transcription and PCR amplification. cDNA libraries prepared from neural cells from six wild-type and six prospero null mutant embryos were hybridized to full genome oligonucleotide microarrays, together with a common reference sample. Wild-type and prospero mutant cells were compared indirectly through the common reference (Choksi, 2006).

In the group of Prospero target genes that contain a Prospero consensus sequence within 1 kb of the transcription unit, 91 show reproducible differences in gene expression in prospero mutants. Seventy-nine percent of these genes (72) exhibit at least a 2-fold change in levels of expression. Many of the known genes involved in neuroblast fate determination and cell-cycle regulation (e.g., asense, deadpan, miranda, inscuteable, CyclinE, and string) show increased levels in a prospero mutant background, consistent with their being repressed by Prospero. Genes to which Prospero binds, but which do not contain an obvious consensus sequence, are also regulated by Prospero: CyclinA and Bazooka show elevated mRNA levels in the absence of Prospero, as does Staufen, which encodes a dsRNA binding protein that binds to both Miranda and to prospero mRNA (Choksi, 2006).

Expression of genes required for neuronal differentiation is decreased in the prospero mutant cells, consistent with Prospero being required for their transcription. These include zfh1 and Lim1, which specify neuronal subtypes, and FasI and FasII, which regulate axon fasciculation and path finding (Choksi, 2006).

The stem cell-like division of neuroblasts generates two daughters: a self-renewing neuroblast and a differentiating GMC. Prospero represses stem cell self-renewal genes and activates differentiation genes in the newly born GMC. In the absence of prospero, therefore, neuroblasts should give rise to two self-renewing neuroblast-like cells (Choksi, 2006).

The division pattern of individual neuroblasts was studied in prospero mutant embryos by labeling with the lipophilic dye, DiI. Individual cells were labeled at stage 6, and the embryos allowed to develop until stage 17. S1 or S2 neuroblasts were examined, as determined by their time of delamination. Wild-type neuroblasts generate between 2 and 32 cells, producing an average of 16.2 cells. Most of the clones exhibit extensive axonal outgrowth. In contrast, prospero mutant neuroblasts generate between 8 and 51 cells, producing an average of 31.8 cells. Moreover, prospero mutant neural clones exhibit few if any projections, and the cells are smaller in size. Thus, prospero mutant neuroblasts produce much larger clones of cells with no axonal projections, suggesting that neural cells in prospero mutants undergo extra divisions and fail to differentiate (Choksi, 2006).

Recently it was shown, in the larval brain, that clones of cells lacking Prospero or Brat undergo extensive cell division to generate undifferentiated tumors. Given that Prospero is nuclear in the GMC but not in neuroblasts, the expanded neuroblast clones in prospero mutant embryos might arise from the overproliferation of GMCs: the GMCs lacking Prospero may divide like neuroblasts in a self-renewing manner. It is also possible, however, that neuroblasts divide more frequently in prospero mutant embryos, giving rise to supernumerary GMCs that each divide only once. To distinguish between these two possibilities, the division pattern of individual GMCs was followed in prospero mutant embryos (Choksi, 2006).

S1 or S2 neuroblasts were labeled with DiI as before. After the first cell division of each neuroblast, the neuroblast was mechanically ablated, leaving its first-born GMC. All further labeled progeny derive, therefore, from the GMC. Embryos were allowed to develop until stage 17, at which time the number of cells generated by a single GMC was determined (Choksi, 2006).

To determine whether mutant GMCs are transformed to a stem cell-like state, stage 14 embryos were stained for the three neuroblast markers: Miranda (Mira), Worniu (Wor), and Deadpan (Dpn). In wild-type embryos at stage 14, the most dorsal layer of cells in the VNC consists mostly of differentiated neurons. As a result, few or none of the cells in this layer express markers of self-renewal. Mira-, Wor-, and Dpn- expressing cells are found on the midline only or in lateral neuroblasts of the differentiated cell layer of wild-type nerve cords. In contrast, a majority of cells in the differentiated cell layer of stage 14 prospero mutant embryos express all three markers: Mira is found cortically localized in most cells of the dorsal layer of prospero nerve cords; Wor is nuclear in most cells of mutant VNCs; Dpn is ectopically expressed throughout the nerve cord of prospero mutants (Choksi, 2006).

Expression of neuroblast markers in the ventral-most layer of the nerve cord (the neuroblast layer), to exclude the possibility that a general disorganization of cells within the VNC contributes to the increased number of Mira-, Wor-, and Dpn-positive cells in the dorsal layer. The number of neuroblasts in a prospero mutant embryo is normal in stage 14 embryos, as assayed by Wor, Dpn, and Mira expression. Thus, the increased expression of neuroblast markers in prospero mutants is the result of an increase in the total number of cells expressing these markers in the differentiated cell layer. It is concluded that prospero mutant neuroblasts divide to give two stem cell-like daughters. GMCs, which would normally terminate cell division and differentiate, are transformed into self-renewing neural stem cells that generate undifferentiated clones or tumors (Choksi, 2006).

Therefore, Prospero directly represses the transcription of many neuroblast genes and binds near most of the temporal cascade genes: hb, Kruppel (Kr), nubbin (nub/pdm1), and grainyhead (grh), which regulate the timing of cell-fate specification in neuroblast progeny. Prospero maintains hb expression in the GMC, and it has been suggested that this is through regulation of another gene, seven-up (svp). Prospero not only regulates svp expression directly but also maintains hb expression directly. In addition, Prospero maintains Kr expression and is likely to act in a similar fashion on other genes of the temporal cascade. Intriguingly, Prospero regulates several of the genes that direct asymmetric neuroblast division (baz, mira, insc, aPKC). aPKC has recently been shown to be involved in maintaining the self-renewing state of neuroblasts (Choksi, 2006).

Prospero initiates the expression of genes necessary for differentiation. This is particularly surprising since prospero is transcribed only in neuroblasts, not in GMCs or neurons. Prospero mRNA and protein are then segregated to the GMC. Prospero binds near eve and ftz, which have been shown to be downstream of Prospero, as well as to genes required for terminal neuronal differentiation, including the neural-cell-adhesion molecules FasI and FasII. Prospero protein is present in GMCs and not neurons, suggesting that Prospero initiates activation of neuronal genes in the GMC. The GMC may be a transition state between the neural stem cell and the differentiated neuron, providing a window during which Prospero functions to repress stem cell-specific genes and activate genes required for differentiation. There may be few, or no, genes exclusively expressed in GMCs (Choksi, 2006).

Prospero acts in a context-dependent manner, functioning alternately to repress or activate transcription. This implies that there are cofactors and/or chromatin remodeling factors that modulate Prospero's activity. In support of this, although Prospero is necessary and sufficient to repress neuroblast genes, forcing Prospero into the nuclei of neuroblasts is not sufficient to activate all of the differentiation genes to which it binds (Choksi, 2006).

Neuroblasts decrease in size with each division throughout embryogenesis. By the end of embryogenesis, they are similar in size to neurons. A subset of these embryonic neuroblasts becomes quiescent and is reactivated during larval life: they enlarge and resume stem cell divisions to generate the adult nervous system. Neuroblasts in prospero mutant embryos divide to produce two self-renewing daughters but still divide asymmetrically with respect to size, producing a large apical neuroblast and a smaller basal neuroblast-like cell. The daughter may be too small to undergo more than three additional rounds of division during embryogenesis. prospero mutant cells eventually stop dividing, and a small number occasionally differentiate. This suggests that there is an inherent size limitation on cell division. The segregation of Brat, or an additional cell fate determinant, to the daughter cell may also limit the potential of the prospero mutant cells to keep dividing (Choksi, 2006).

The Prox family of atypical homeodomain transcription factors has been implicated in initiating the differentiation of progenitor cells in contexts as varied as the vertebrate retina, forebrain, and lymphatic system. Prospero/Prox generally regulates the transition from a multipotent, mitotically active precursor to a differentiated, postmitotic cell. In most contexts, Prox1 acts in a similar fashion to Drosophila Prospero: to stop division and initiate differentiation (Choksi, 2006).

It is proposed that Prospero/Prox is a master regulator of the differentiation of progenitor cells. Many of the vertebrate homologs of the Drosophila Prospero targets identified in this study may also be targets of Prox1 in other developmental contexts. Prospero directly regulates several genes required for cell-cycle progression, and it is possible that Prox1 will regulate a similar set of cell-cycle genes during, for example, vertebrate retinal development. In addition, numerous Prospero target genes have been identified whose orthologs may be involved in the Prox-dependent differentiation of retina, lens, and forebrain precursors (Choksi, 2006).

germ cell-less acts to repress transcription during the establishment of the Drosophila germ cell lineage

During early Drosophila and C. elegans development, the germ cell precursors undergo a period of transcriptional quiescence. Germ cell-less (Gcl), a germ plasm component necessary for the proper formation of 'pole cells', the germ cell precursors in Drosophila, is required for the establishment of this transcriptional quiescence. While control embryos silence transcription prior to pole cell formation in the pole cell-destined nuclei, this silencing does not occur in embryos that lack Gcl activity. The failure to establish quiescence is tightly correlated with failure to form the pole cells. Furthermore, Gcl can repress transcription of at least a subset of genes in an ectopic context, independent of other germ plasm components. These results place Gcl as the earliest gene known to act in the transcriptional repression of the germline. Gcl's subcellular distribution on the nucleoplasmic surface of the nuclear envelope (Jongens, 1994) and its effect on transcription suggest that it may act to repress transcription in a manner similar to that proposed for transcriptional silencing of telomeric regions (Leatherman, 2002).

gcl is required to repress transcription during the establishment of the germ cell lineage. To determine if this activity is dependent or independent of other germ plasm components, the effect of ectopically localizing Gcl on transcription was examined. Replacement of the 3'UTR of the gcl transcript with the 3'UTR of bicoid results in the anterior localization of gcl mRNA and protein to the anterior pole of the embryo. In these 'hgb' embryos, a slightly variable but consistent decrease was found in the intensity of H5 staining (H5 is a monoclonal antibody that recognizes a phosphorylated form of RNA polymerase II that is associated with active transcription) in the anterior nuclei compared to control embryos throughout the syncytial blastoderm stage, and this decrease indicates that Gcl is sufficient to repress transcription ectopically. However, the anterior expression of Gcl clearly does not lead to complete silencing of the anterior nuclei, since some H5 staining persists (Leatherman, 2002).

The reduced H5 staining observed in the anterior of the hgb embryos could be due to global partial repression of all genes, or it could result from a specific subset of genes being severely repressed while others are unaffected. To distinguish between these possibilities, the expression was examined of specific genes whose expression pattern includes the anterior of the embryo, including sisA, sisB (scute), tailless, huckebein, hunchback, and knirps. These genes are all independently activated by maternally contributed factors, so any effects on their transcription are likely to be direct rather than a consequence of an earlier defect. By using in situ hybridization, it was found that the early anterior expression domains of sisA, sisB, tailless, and huckebein are severely repressed in all of the hgb embryos examined, but no effect was seen on hunchback and knirps expression. These data suggest that the transcriptionally repressive effect of Gcl is not global, but rather specific to a subset of genes. Gcl is also present in a variety of tissues later in development, at times when transcription is active, which further suggests a non-global mode of silencing (Leatherman, 2002).

Mitotic G2-arrest is required for neural cell fate determination in Drosophila

In the wing discs of Drosophila, the mechanosensory precursor cells are singled out from clusters of cells blocked at the G2 phase of the cell cycle. This mitotic quiescence and the selection of the precursors are under strict spatio-temporal control. G2 cells were forced to enter mitosis by overexpression of string, the Drosophila homolog of the cdc25 gene. Premature entrance in the cell cycle is associated with a loss of precursor cells. Precursors are lost consecutively to a transcriptional down-regulation of the determinant proneural achaete/scute genes. This down-regulation results from an over-activation of the Enhancer of Split genes, known as effectors of the Notch signalling pathway. It is concluded that exit from the cell cycle is required for proper neural cell fate determination (Nègre, 2003).

Thus, forcing G2 arrested cells into mitosis results in a loss of adult sense organs. The corresponding precursors are also lost. This result was obtained by using two distinct transgenic systems to control the timing and spatial location of stg-overexpression. In both cases, precursors are not selected because ac/sc proneural expression is repressed. This repression occurs at a transcriptional level. Noteworthy is the fact that bristles are lost using either the sca-Gal4 driver to overexpress stg, or the klu-Gal4 driver; this demonstrates that overexpression of stg not only prevents the early accumulation of Ac/Sc (klu-Gal4 driver), but can also downregulate Ac/Sc after the levels of these proteins have started to rise (sca-Gal4 driver). Thus, it is concluded that the arrest in G2 is necessary for proper determination of precursor cells. The complexity of the 5' regulatory sequences of stg indicates that this mitotic regulator might itself integrate information from patterning genes. For instance, the regulatory regions of the stg gene possess putative recognition sites for Achaete and Scute transcription factors. Here, it has been shown that stg can itself control the expression of developmental genes. The effect of stg on cell determination is unlikely to be direct, however, since the only known function of stg is to dephosphorylate the CDK1- cyclin B mitotic kinase. Future genetic approaches may reveal whether or not String has other biochemical targets (Nègre, 2003).

After stg overexpression using the klu-Gal4 driver, it was observed that E(Spl) expression is maintained in proneural regions in absence of Ac/Sc. It was also observed that stg can cause accumulation of the E(Spl) bHLH genes outside of proneural clusters, in a cell-autonomous mode. Maintenance of expression of E(Spl), a transcriptional repressor of the ac/sc expression, is relevant. It can functionally justify the loss of precursor cells. Nevertheless, it has been reported that E(Spl) transcription is dependent on the ac-sc genes in the proneural clusters. One explanation could be that deregulation of the cell cycle directly or indirectly increases transcription of the E(Spl) genes by modifying activity of upstream activators of the E(Spl) expression. Considering this hypothesis, E(Spl) should sometimes be expressed in incorrect positions compared to its wild-type expression. On the contrary, because E(Spl) genes are expressed at the exact positions for proneural clusters, it is suggested that forcing cell cycle more likely affects E(Spl) expression at a post-translational level rather than at a transcriptional level. In the mutants, initial transcription of E(Spl) genes would still have been dependent on Ac/Sc, which begin to accumulate in proneural domains. But, it is known that at least E(Spl) m5, m7 and m8 isoforms contain a PEST-rich motif that harbors an invariant Serine residue, which is phosphorylated by the casein kinase II. Casein kinase II is a ubiquitous serine/threonine kinase whose activity fluctuates with cell cycle progression. Phosphorylation usually regulates protein stability via activation of PEST motifs. Modification in the phosphorylation status of some E(Spl) proteins could exhibit a longer half-life in vivo, thus leading to their predominance over the proneural proteins, and therefore to an inhibition of neurogenesis. In other words, premature entry in the cell cycle would introduce an external bias in the highly dynamic process that opposes the antagonistic E(Spl) and Ac/Sc proteins and which normally occurs in cells of proneural clusters. It would confer an advantage to E(Spl) over proneural activity and would explain persistence of E(Spl) proteins after proneural products have disappeared (Nègre, 2003).

Altogether, these results suggest that proneural competence can only develop in mitotically arrested cells. The programmed incompatibility between cell cycling and proneural product accumulation may have several general, and not mutually exclusive, functional correlates. In proneural clusters, keeping cells together in a continuous group may be necessary. Indeed, cell interactions could be required to maintain Ac/Sc levels via indirect autoregulation through cell- cell signalling. Furthermore, a G2 arrest may be necessary to preserve a balance between the levels and/or activities of E(Spl) and Ac/Sc products that could directly or indirectly be dependent on post-transductional modifications. The relative strength of the signal impinging on a given cell determines whether products of the proneural genes or products of the E(Spl) become finally predominant. Changing the cell cycle phase could disrupt this equilibrium. Finally, divisions that underly normal cell proliferation and those involved in the fixed lineage of the precursor cell, make different demands on the cytoskeletal machinery. The asymmetric divisions of the precursor cell are strictly controlled in orientation and in time. These controls are presumably essential to realize a correct lineage. A period of mitotic quiescence may give the precursor cell the time and/or conditions required to reorganize its cytoskeleton in order to shift to an asymmetric mode of division. Although a quiescent period systematically precedes the emergence of neural precursors, re-entry into mitosis is independently controlled in the precursor and the surrounding epidermis. This suggests that quiescence is a necessary step preceding the lineage of the precursor. Moreover, the decision of the precursor to enter in its lineage is made independently of the mitotic state of its surrounding cells (Nègre, 2003).

In this study, causal relationship has been demonstrated to exist between cell cycle and neural determination in an endogenous system: the Drosophila wing imaginal discs, in which E(Spl) effectors of the Notch pathway behave as integrative sensors of the cell cycle status (Nègre, 2003).

Recruitment of the proneural gene scute to the Drosophila sex-determination pathway

In flies, scute (sc) works with its paralogs in the achaete-scute-complex (ASC) to direct neuronal development. However, in the family Drosophilidae, sc also has acquired a role in the primary event of sex determination, X chromosome counting, by becoming an X chromosome signal element (XSE) -- an evolutionary step shown here to have occurred after sc diverged from its closest paralog, achaete (ac). Two temperature-sensitive alleles, scsisB2 and scsisB3, which disrupt only sex determination, were recovered in a powerful F1 genetic selection; these alleles were used to investigate how sc was recruited to the sex-determination pathway. scsisB2 revealed 3' nontranscribed regulatory sequences likely to be involved. The scsisB2 lesion abolished XSE activity when combined with mutations engineered in a sequence upstream of all XSEs. In contrast, changes in Sc protein sequence seem not to have been important for recruitment. The observation that the other new allele, scsisB3, eliminates the C-terminal half of Sc without affecting neurogenesis and that scsisB1, the most XSE-specific allele previously available, is a nonsense mutant, would seem to suggest the opposite, but housefly Sc is shown to be able to substitute for fruit fly Sc in sex determination, despite lacking Drosophilidae-specific conserved residues in its C-terminal half. Lack of synergistic lethality among mutations in sc, twist, and dorsal argue against a proposed role for sc in mesoderm formation that had seemed potentially relevant to sex-pathway recruitment. The screen that yielded new sc alleles also generated autosomal duplications that argue against the textbook view that fruit fly sex signal evolution recruited a set of autosomal signal elements comparable to the XSEs (Wrischnik, 2003).

Thus a lesion in a new sex-specific allele led to an analysis of a cis-acting regulatory region downstream of the transcription unit that is likely to help drive the extremely early expression specifically required for XSE function. Strong functional synergism was observed between a deletion of this 3' sequence and lesions engineered in a heptameric regulatory sequence upstream of sc as potentially important for XSE evolution (Wrischnik, 2003).

The recovery of two new mutations, scutesisB2 and scutesisB3, that affect only sex determination, stimulated experiments that not only constrain speculation about how this member of a neuronal patterning gene complex acquired a key role in sex determination, but also point to specific regulatory information likely to have been involved. This study also sheds light on the molecular nature of some older scute mutants and on the effects of temperature and autosomal genes on X chromosome counting (Wrischnik, 2003).

The discovery that houseflies have ac showed that the duplication event that separated ac and sc occurred long before sc acquired a role in X chromosome counting. Thus, a change in the mechanism of sex determination does not appear to have been a factor driving that duplication event. The question of whether the partial functional redundancy that exists between sc and ac in neurogenesis was relevant to recruitment remains open. Notwithstanding that redundancy, Ac and Sc proteins have unique protein sequence identities that extend across species regardless of whether those species use sc as a sex signal (Wrischnik, 2003).

The discovery that eliminating the C-terminal half of Sc strongly interferes with sex determination but not bristle formation led to a search for other indications that the distal half of Sc might have become uniquely specialized for sex determination. Residues were found that clearly distinguish Sc in fly species that use it as a sex signal (the family Drosophilidae) from Sc in those that do not (other higher Diptera such as the housefly); however, the significance of this fact was undermined by the observation that the frequency of such residues was no higher for Sc than for the closely related proteins Ac and L'sc, which seem to not have important roles in X chromosome counting. Direct evidence that these Drosophilidae-specific conserved Sc protein sequences were not an important factor in the evolution of its sex determination was given by the demonstration that Sc from the housefly could substitute for D. melanogaster Sc in a transgenic assay for sex-determination activity. The fact that melanogaster Ac substituted only poorly for melanogaster Sc in the same assay showed that conserved residues distinguishing these two paralogs in all species examined are likely to be important for sex-determination function, but those differences evolved before sc became an XSE (Wrischnik, 2003).

Sc and Ac behave differently in their ability to regulate Sxl, but the biological significance of the transgene results presented in this study is far more certain because the proteins whose sex-determination activities were compared were produced at the wild-type time, place, and level. Moreover, large numbers of independent transgene lines were assayed, all of which had been backcrossed many generations to a standard line to ensure similar genetic backgrounds. Meaningful comparisons can be made in sex-determination signal studies only when genetic background is carefully controlled. The large differences in XSE activity that was observed among transgene lines show that chromosomal position effects can have a significant influence on gene expression even prior to the blastoderm stage (Wrischnik, 2003).

Given that the C-terminal half of Sc protein seems to not be uniquely devoted to sex determination, one might ask whether the sex-determination-specific mutant phenotype of scsisB3 can be explained simply by the hypothesis that loss of this region reduces all sc activities to the same extent, but the minimum activity that suffices for normal neurogenesis is very much lower than that for sex determination. Greater sensitivity of sex determination to disruption would not be surprising in view of the striking gene dose sensitivity that is an intrinsic part of X chromosome counting and the fact that ac seems likely to take up part of the slack for proneural targets when sc activity is reduced. The nearly normal bristle phenotype of the duplicated nonsense mutant allele scsisB1 supports the view that low levels of sc activity do suffice for neurogenesis but not sex determination. Nevertheless, a strong genetic argument can be made that loss of the C-terminal half of the protein does preferentially interfere with sex-determination activity, not just with general function. The sensitive emc suppression assay of sc proneural activity showed that even scsisB3, the more mutant of the two new alleles and the one that eliminates the C terminus, must be at least 50% as active as the wild type in this respect, while the female-lethal phenotype of both new alleles shows that they must have considerably < 50% of normal XSE activity, since a deletion of sc has no dominant-lethal female-specific effect. The selective forces that have shaped and maintained the distal half of Sc protein are simply likely to be too subtle to be apparent in the functional assays used in this study -- a caveat for anyone hoping to make functional predictions regarding mutant phenotype from striking patterns of sequence conservation (Wrischnik, 2003).

This study provides the first direct evidence that the heptamer sequence CAGGTAG found clustered upstream of all scute and other XSEs is functionally relevant to sex determination. The importance of this sequence might have been underestimated had the strong interaction between heptamer knockout mutations and deletion of 3' regulatory sequences not been observed. Further study will reveal whether these synergistic 5' and 3' lesions are truly specific for sex determination, affecting only preblastoderm stage expression of sc. The fact that the scsisB2 lesion had no effect on neurogenesis favors specificity (Wrischnik, 2003).

Enhancer-promoter communication mediated by Chip during Pannier-driven proneural patterning is regulated by Osa

The GATA factor Pannier activates proneural achaete/scute (ac/sc) expression during development of the sensory organs of Drosophila through enhancer binding. Chip bridges Pannier with the (Ac/Sc)-Daughterless heterodimers bound to the promoter and facilitates the enhancer-promoter communication required for proneural development. This communication is regulated by Osa, which is recruited by Pannier and Chip. Osa belongs to Brahma chromatin remodeling complexes, and this study shows that Osa negatively regulates ac/sc. Consequently, Pannier and Chip also play an essential role during repression of proneural gene expression. This study suggests that altering chromatin structure is essential for regulation of enhancer-promoter communication (Heitzler, 2003).

ChipE is a viable allele of Chip that is associated with a point mutation in the LIM-interacting domain (LID), which specifically reduces interaction with the bHLH proteins Ac, Sc, and Da. As a consequence, the ChipE mutation disrupts the functioning of the proneural complex encompassing Chip, Pnr, Ac/Sc, and Da. A homozygous ChipE mutant shows thoracic cleft and loss of the DC bristles, similar to loss of function pnr alleles (Heitzler, 2003).

To identify new factors that regulate this proneural complex, a screen was performed for second-site modifiers of the ChipE phenotypes. One allele of osa (osaE17) was found among the putative mutants. OsaE17 corresponds to a loss-of-function allele, and homozygous embryos die with normal cuticle patterning. Both osaE17 and null alleles of osa (osa616 or osa14060) enhance the cleft but suppress the loss of DC bristle phenotypes of ChipE flies. Indeed, ChipE flies with only one copy of osa+ (ChipE;osa616/+) are weak and sterile but show wild-type DC bristle pattern (Heitzler, 2003).

These genetic interactions suggest that Osa can antagonize the function of Pnr. Moreover, overexpressed Osa (+/UAS-osa;Gal4-pnrMD237/+) induces a thoracic cleft and the loss of DC bristles similar to the loss-of-function pnr alleles. In contrast, loss-of-function osa alleles display an excess of DC bristles similar to overexpressed Pnr. For example, (osa14060/+), (osa616/+), and (osaE17/+) flies exhibit respectively 2.35 ± 0.12, 2.38 ± 0.12, and 2.43 ± 0.17 DC bristles per heminotum (Oregon wild-type flies have 2.00 DC bristles/heminotum). Furthermore, transallelic combination of osa14060 with the hypomorphic osa4H (osa4H/osa14060) accentuates the excess of DC bristles compared with (osa14060/+). (osa4H/osa14060) flies display 4.17 ± 0.19 DC bristles per heminotum. In contrast, (osa4H/osa4H) flies display 2.50 ± 0.11 DC bristles per hemithorax. The development of the extra DC bristles revealed by phenotypic analysis was compared with the positions of the DC bristle precursors detected with a LacZ insert, A101, in the neuralized gene that exhibits staining in all sensory organs. In (osa14060/osa4H) discs, additional DC precursors are observed that lead to the excess of DC bristles. The pnrD alleles encode Pnr proteins carrying a single amino acid substitution in the DNA binding domain that disrupts interaction with the U-shaped (Ush) antagonist. Consequently, PnrD constitutively activates ac/sc, leading to an excess of DC bristles. This excess is accentuated when osa function is simultaneously reduced (pnrD1/osa616) (Heitzler, 2003).

Since osa shows genetic interactions with trithorax group genes encoding components of the Brm complex like moira (mor) and brm, whether mutations in mor and brm suppress the ChipE phenotype was investigated. Loss of one copy of brm+ in (ChipE; brm2/+) flies suppresses the lack of DC bristles observed in ChipE flies, similar to loss of one copy of osa+. This shows that brm and osa both act during Pnr-dependent patterning, in agreement with the fact that they have been shown to be associated in the Brm complex. In contrast, reducing the amount of Mor by half [(ChipE;mor1/+) flies] is not sufficient to modify the ChipE phenotype. This does not definitely exclude the possibility that mor is directly or indirectly involved, via the Brm complex, in Pnr-dependent patterning (Heitzler, 2003).

The complete osa open reading frame of 2715 amino acids and the intronic splicing signals were PCR amplified from genomic DNA prepared from homozygous embryos (osaE17 and osa14060) and homozygous first instar larvae (osa4H). For osa14060 and osa4H, the sequence analysis revealed a single mutation in the N terminus that causes a glutamine to stop codon substitution. The conceptual translation of osa14060 leads to a truncated Osa protein lacking both functional domains, whereas Osa4H retains the ARID domain but lacks the C-terminal EHD. Wild-type osa function is necessary for patterning of the DC bristles. Although osaE17 behaves as a stronger allele than osa14060 and osa4H, molecular identity of the mutation is unknown. Hence, the osaE17 phenotype may result from a mutation in regulatory sequences that affects osa expression (Heitzler, 2003).

It has been shown that a complex containing Pnr, Chip, and the (Ac/Sc)-Da heterodimer activates proneural expression in the DC proneural cluster and promotes development of the DC macrochaetae. Osa and Pnr/Chip have antagonistic activities during development because loss of osa function (osa4H and osa14060) displays additional DC bristles. However, since the current study reveals that osa genetically interacts with pnr and Chip, it was asked whether Osa physically interacts with the Pnr and Chip proteins. Immunoprecipitations of protein extracts made from Cos cells cotransfected with expression vectors for tagged Osa and either Pnr or tagged Chip were immunoprecipitated. Because Osa is a large protein, several expression vectors encoding contiguous domains of Osa were used. Osa coimmunoprecipitates with Pnr and Chip and can be detected on Western blots with appropriate antibodies. The interactions appear to require the overlapping domains Osa E (His1733/Glu2550) and Osa F (Ala2339/Ala2715) corresponding to the EHD. Enhancer-promoter communication during proneural activation and development of the DC bristles requires regulatory sequences scattered over large distances and appears to be negatively regulated by interaction of Pnr and Chip with Osa through the EHD. Interestingly, the EHD is not conserved in yeast. In yeast, the UAS sequences are generally close to the promoter and there is no requirement for long-distance interactions. This observation could support the idea that the EHD is essential for long-distance enhancer-promoter communication. Alternatively, yeast may just lack proteins like Chip or Pnr (Heitzler, 2003).

The DNA-binding domain and the C-terminal region are essential for the function of Pnr during development of the DC sensory organs. The pnrVX1 and pnrVX4 alleles (collectively pnrVX1/4) are characterized by frameshift deletions that remove two C-terminal alpha-helices and result in reduced proneural expression and loss of DC bristles (Heitzler, 2003).

The molecular interactions between Osa and PnrD1 and between Osa and PnrVX1 were investigated. PnrD1 protein interacts with the EHD as efficiently as wild-type Pnr. In contrast, the physical interaction is disrupted when the C terminus of Pnr encompassing the alpha-helices is removed. Because the C terminus of Pnr is required for the Pnr-Osa interaction in transfected cells extracts, the abilities of in vitro translated 35S-labeled Osa domains to bind to GST-CTPnr attached to glutathione-bearing beads were investigated. Only Osa E and Osa F interact with the C terminus of Pnr. The interaction between Chip and Osa was examined, and it was found that Osa associates with the N-terminal homodimerization domain of Chip, and is also required for the interaction between Chip and Pnr. Furthermore, Osa E and Osa F also bind to immobilized GST-Chip. Deletion of the alpha helix H1 disrupts the interactions between Pnr and Osa. Interestingly, the same deletion also disrupts the interaction with Chip. Therefore, the functional antagonism between Chip and Osa during neural development may result from a competition between these proteins for association with Pnr. Alternatively, the deletion of H1 may affect the overall structure of the C terminus of Pnr and disrupt the physical interactions with Chip and Osa. To discriminate between these hypotheses, immunoprecipitations of protein extracts containing a constant amount of Pnr, a constant amount of the tagged Osa E domain, and increasing concentrations of Chip were performed. Pnr immunoprecipitates with immunoprecipitated tagged Osa E and the amount of Pnr immunoprecipitated increases in the presence of increasing concentrations of Chip. The presence of increasing amounts of Chip does not inhibit the Osa-Pnr interaction as would be expected if Osa and Chip were to compete for binding to Pnr. In contrast, it suggests that Chip and Pnr act together to recruit Osa and to target its activity and possibly the activity of the Brm complex to the ac/sc promoter sequences (Heitzler, 2003).

Using expression vectors encoding contiguous domains of Osa, it was shown that the EHD of Osa mediates interactions with Pnr and Chip. Because the EHD is lacking in the truncated Osa14060 and Osa4H, it is hypothesized that the loss of interaction with Pnr and Chip are responsible for the excess of DC bristles observed in osa4H and osa14060 (Heitzler, 2003).

To investigate whether these interactions between Osa, Pnr, and Chip function in vivo during DC bristle development, the effects of both loss of function and overexpression of osa were examined on the activity of a LacZ reporter whose expression is driven by a minimal promoter sequence of ac fused to the DC enhancer (transgenic line DC:ac-LacZ). It was found that expression of the LacZ transgene is increased in osa14060/osa4H wing discs when compared with the wild-type control. For overexpression experiments, the UAS/GAL4 system was used, using as a driver the pnrMD237 strain that carries a GAL4-containing transposon inserted in the pnr locus (driver: pnr-Gal4). This insert gives an expression pattern of Gal4 indistinguishable from that of pnr. It was found that overexpressed Osa leads to a strong reduction of LacZ staining in the DC area, consistent with the lack of DC bristles. Thus, overexpressed Osa represses activity of the ac promoter sequences required for DC ac/sc expression and development of the DC bristles. It has been previously reported that wingless expression is also required for patterning of the DC bristles. However, the repressing effect of Osa on development of the DC bristles is unlikely to be the result of an effect of Osa on wingless expression because overexpressed Osa driven by pnrMD237 has no effect on the expression of a LacZ reporter inserted into the wingless locus. Thus, Osa acts through the DC enhancer of the ac/sc promoter sequences to repress ac/sc and neural development (Heitzler, 2003).

ChipE disrupts the enhancer-promoter communication and strongly affects expression of the LacZ reporter driven by the ac promoter linked to the DC enhancer. Because null alleles of osa suppress the loss of DC bristles displayed by ChipE, the consequences of reducing the dosage of osa was examined in ChipE flies. The expression of the LacZ reporter is not affected in ChipE flies when Osa concentration is simultaneously reduced (Heitzler, 2003).

In conclusion, Pnr function during proneural patterning is regulated by interaction with several transcription factors. Pnr function is negatively regulated by Ush, which interacts with its DNA-binding domain. Chip associates with the C terminus of Pnr, bridging Pnr at the DC enhancer with the AC/Sc-Da heterodimers bound at the proneural promoters, thus activating proneural gene expression. The current study reveals that Pnr function can also be regulated by interaction with Osa. Thus, Osa activity is specifically targeted to ac/sc promoter sequences and the binding of Osa therefore has a negative effect on Pnr function, leading to reduced expression of the proneural ac/sc genes. Osa belongs to Brm complexes, which are believed to play an essential role during chromatin remodeling necessary for gene expression. For example, in vitro transcription experiments with nucleosome assembled human beta-globin promoters have shown that the BRG1 and BAF155 subunits of the mammalian SWI/SNF homolog are essential to target chromatin remodeling and promote transcription initiation mediated by GATA-1. In contrast to what was observed in vitro, the current results suggest that in vivo the SWI/SNF complexes can also act to remodel chromatin in a way that represses transcription. Alternatively, the observed repression of proneural genes may simply define a novel function of Osa, independent of chromatin remodeling (Heitzler, 2003).

pannier, which regulates ac-sc, encodes two structurally related isoforms that are differentially expressed during Drosophila development and display distinct functions during thorax patterning

pannier encodes a GATA transcription factor that is involved in various biological processes, including heart development, dorsal closure during embryogenesis as well as neurogenesis and regulation of wingless (wg) expression during imaginal development. This study demonstrates that pnr encodes two highly related isoforms that share functional domains but are differentially expressed during development. Moreover, two genomic regions of the pnr locus are described that drive expression of a reporter in transgenic flies in patterns that recapitulate essential features of the expression of the isoforms, suggesting that these regions encompass crucial regulatory elements. These elements contain, in particular, sequences mediating regulation of expression by Decapentaplegic (Dpp) signaling, during both embryogenesis and imaginal development. Analysis of pnr alleles reveals that the isoforms differentially regulate expression of both wg and proneural achaete/scute (as/sc) targets during imaginal development. Pnr function has been demonstrated to be necessary both for activation of wg and, together with U-shaped (Ush), for its repression in the dorsal-most region of the presumptive notum. Expression of the isoforms define distinct longitudinal domains and, in this regard, it is shown that the dual function of pnr during regulation of wg is achieved by one isoform repressing expression of the morphogen in the dorsal-most region of the disc while the other laterally promotes activation of the notal wg expression. This study provides novel insights into pnr function during Drosophila development and extends knowledge of the roles of prepattern factors during thorax patterning (Fromental-Ramain, 2008).

Focus was placed on reporter expression in the wing disc where pnr is necessary for the development of thoracic macrochaetae. A DNA fragment, 15.7 kilobases (kb) in length and including the 5′ untranslated sequences of exon 1 (construct A15.7), directs expression of lacZ in the dorsal-most domain of the disc. The 15.7 kb DNA fragment was dissected by 5′-end deletion, it was observed that the genomic sequences contain two distinct regions responsible for reporter expression. The 3.2 kb DNA fragment adjacent to pnr (construct E3.2) drives expression of the reporter along the A/P border of the notal region of the disc where Dpp is expressed, and also in a central cluster of cells. Expression remains similar in lines carrying the reporter under the control of the 9.3 kb fragment (construct C9.3), suggesting that the supplementary 6.1 kb DNA fragment does not contain essential regulatory sequences. When the DNA fragment inserted upstream of the reporter is the 12 kb fragment (construct B12), lacZ expression is reinforced in comparison of expression seen with lines carrying construct C9.3. Expression of the reporter fully covers dorsal domain of the disc when the promoter sequences include the distal DNA fragment (construct A15.7). Thus, a second domain responsible for expression in the disc appears to be located in the distal region of construct A15.7 (Fromental-Ramain, 2008).

It is concluded that reporter expression depends on activity of two domains, a proximal one located in the 3.2 kb fragment adjacent to pnr (construct E3.2) and a distal one corresponding to the 5′-end of construct A15.7. These observations are reinforced by the fact that both the distal fragment (construct H6.4) and the proximal fragment (construct J1.8) inserted in front of an heterologous hsp43 (heat shock protein43) minimal promoter direct reporter expression in the wing disc. In contrast, the intervening fragment (construct I6.1) does not promote expression when placed in front of this heterologous promoter (Fromental-Ramain, 2008).

Interestingly, the location of the two domains suggests that they may correspond to alternate promoters of the pnr isoforms. Indeed, sequence analysis of the pnr locus and characterization of the mRNAs expressed during development led to the prediction that pnr may encode two isoforms. Isoform-α (pnr-α) encodes the Pnr protein as it has been identified, whereas the putative isoform-β (pnr-β) encodes a truncated version of the Pnr-α protein, lacking the 52 N-terminal amino acids. However, Pnr-α and Pnr-β share functional domains and the N-terminus of Pnr-α does not contain any obvious functional signature. In vitro experiments revealed that both Pnr-α and -β associate with Ush and equivalently activate a reporter driven by promoter sequences including GATA sites in a cultured cell line (Fromental-Ramain, 2008).

Several reports have implicated Pnr as a key transcriptional regulator during expression of both ac/sc and wg in the presumptive notum. The current study extends previous work and importantly demonstrates that Pnr function is achieved by two structurally related isoforms with distinct expression domains. Moreover, the isoforms display distinct transcriptional activities, including antagonism during regulation of wg expression (Fromental-Ramain, 2008).

Identification of the isoforms led to revisiting the role of pnr during regulation of ac/sc and ush targets in the wing disc. Both overexpressed pnr-α and overexpressed pnr-β lead to activation of proneural expression and development of ectopic sensory bristles suggesting that the isoforms may act as subunits of the multiprotein proneural complex as it has been previously identified. However, the current analysis of the pnrV1 and pnrGal4 alleles do not argue in favor of such a model during regulation of ac/sc expression. Both the reduced pnr-β expression associated with homozygous pnrGal4 animals and the increased pnr-α expression observed in homozygous pnrV1 animals exhibit a loss of DC bristles and impaired proneural expression at the DC site of the wing/thorax discs. As the domains of isoform expression stay the same in mutants animals, this suggest that the mutant phenotypes result from antagonistic activities of the Pnr proteins. This hypothesis is reinforced by the observation that proneural expression is reduced in both (pnrGal4/+) and (pnrV1/+) animals and is totally abolished in homozygous mutant animals. Thus, proneural expression at the DC site of the imaginal disc relies on the stoichiometry between Pnr-α/Pnr-β. Additional evidence is provided by molecular analysis of the vertebrate complex, homologous to the proneural complex encompassing Pnr, Chip and the heterodimer (Ac/Sc)-Da. Indeed, the vertebrate hematopoietic-specific complex contains only one GATA molecule, that does not support the notion that both the Pnr-α and Pnr-β isoforms simultaneously belong to the Drosophila complex necessary for ac/sc activation during Pnr-driven proneural development (Fromental-Ramain, 2008).

Previous analysis have shown that ush expression is also regulated by Pnr. ush expression is abolished in the dorsal-most domain of (pnrVX6/pnrV1) disc. Since the (pnrVX6/pnrV1) combination was predicted to correspond to a loss of pnr function, it was postulated that Pnr mediates activation of notal ush expression. It has also been reported that ush expression is lost in (pnrD1/pnrV1) disc, except at the A/P border of the notal region. Since pnrD1 encodes a mutant protein carrying a single amino acid exchange in the DNA binding domain that disrupts interaction with the negative regulator Ush, it was hypothesized that the (Pnr-Ush) complex serves as a transcriptional activator of ush expression. However, the current analysis revealed a strong induction of pnr-α expression at the A/P border of the disc while pnr-β expression is not modified. Hence, expression of the (PnrD1-α) protein is induced at the A/P border in (pnrD1/pnrV1) discs and it is suggested that Pnr-α-Ush is involved in the repression of ush expression. Moreover, it is also suggested that the ush expression depends on the stoichiometry between Pnr-α and Pnr-β since ush expression is abolished in the dorsal-most domain of the pnrD1/pnrV1 discs outside the A/P border. The pnrV1/pnrD1 combination is consequently characterized by ectopic sensory bristles and increased proneural expression in the DC area (Fromental-Ramain, 2008).

Pnr is involved in regulation of both the ac/sc and ush targets during neural development and the stoichiometry of the isoforms is a crucial determinant during regulation of gene expression. These characteristics may explain the paradoxical observations that increased pnr-α expression in homozygous pnrV1 displays reduced ac/sc expression and loss of DC bristles whereas overexpressed pnr-α in (pnrGal4/UAS pnr α) leads to activated ac/sc expression and additional macrochaetae. The DC enhancer would require lower Pnr-α concentration for repression than the notal ush enhancer, probably reflecting different affinities of the binding sites for the Pnr-α-Ush effector. At low concentration, the Pnr-α-Ush heterodimer antagonizes Pnr-β activity, leading to reduced ac/sc expression at the DC site and loss of DC bristles. Overexpressed pnr-α mediates repression of ush, leading to reduced concentration of the Pnr-α-Ush heterodimer and consequently, ac/sc expression at the DC site results from activating Pnr-β. Hence, overexpressed pnr-α displays ectopic sensory organs. In contrast, overexpressed pnr-β would repress pnr-α involved together with Ush in repression of ac/sc and would also directly activate proneural expression to promote development of ectopic sensory organs. Both overexpressed pnr-α or pnr-β activates proneural expression, leading to ectopic sensory organs but they act by distinct mechanisms. During activation of proneural expression, overexpressed pnr-β appears to directly stimulate ac/sc through binding to their regulatory sequences whereas overexpressed pnr-α indirectly acts in repressing ush expression (Fromental-Ramain, 2008).

The present data highlight the merit of revisiting pnr function during development since pnr isoforms are expressed in domains that define a novel subdivision of the wing disc. The biological significance of the subdivision is of critical importance since the isoforms exhibit antagonistic activities during regulation of targets genes. A challenging issue will be to understand how the Pnr isoforms molecularly interact with the regulatory sequences of the target genes ac/sc, ush and wg. Sequence analysis revealed that the DC enhancer contains several Pnr binding sites and some of them are involved in regulation of ac/sc expression during neural development (Garcia-Garcia, 1999). These binding sites may correspond to targets for Pnr-β and (Pnr-α)-Ush complexes. Mutagenesis of the Pnr binding sites would be required to understand how the isoforms interact with the regulatory element to antagonistically regulate proneural expression, to clarify the role of Ush during regulation of Pnr target genes, and to resolve the question on how upon dimerization Ush can convert Pnr from an activator to a repressor (Fromental-Ramain, 2008).

Drosophila dLMO-PA isoform acts as an early activator of achaete/scute proneural expression

The Drosophila bHLH proneural factors Achaete (Ac) and Scute (Sc) are expressed in clusters of cells (proneural clusters), providing the cells with the potential to develop a neural fate. Mediodorsal proneural patterning is mediated through the GATA transcription factor Pannier (Pnr) that activates ac/sc directly through binding to the dorsocentral (DC) enhancer of ac/sc. Besides, the Gfi transcription factor Senseless (Sens), a target of Ac/Sc, synergizes with ac/sc in the presumptive sensory organ precursors (SOPs). This study investigated, through new genetic tools, the function of dLMO (Beadex), the Drosophila LIM only transcription factor that was already known to control wing development. dLMO gene encodes two isoforms, dLMO-RA and dLMO-RB. dLMO null and dLMO-RA deletions have similar phenotypes, lacking thoracic and wing margin sensory organs (SO), while dLMO-RB deletion has normal SOs. At early stages, dLMO-RA is expressed in proneural clusters, however later it is excluded from the SOPs. dLMO functions as a Pnr coactivator to promote ac/sc expression. In the late SOPs, where dLMO-PA is not expressed, Pnr participates to the Sens-dependent regulation of ac/sc. Taken together these results suggest that dLMO-PA is the major isoform that is required for early activation of ac/sc expression (Asmar, 2008).

The lack of dLMO protein leads to very distinctive phenotypes. The mutant animals are not able to fly, they have a short life span and show an abnormal gait behaviour. In addition, they show a discreet bristle phenotype. In Drosophila, there are two paralogous LMO factors, dLMO and CG5708. These genes are expressed in the CNS where redundancy is not excluded. However CG5708 is not expressed in the wing discs and presumptive SOPs. Therefore it is concluded that the mild phenotype observed for the adult PNS in dLMO mutants, is not attributed to gene redundancy. dLMO encodes two distinct isoforms, dLMO-PA and -PB, which only differ from their N-terminus. Only dLMO-RA is broadly expressed in the notum, and contributes to the PNS phenotype. dLMO function is also critical in the developing central nervous system for the activity of the ventral lateral neurons, LNvs. It is highly probable that dLMO-RB has some subtle biological activities in the brain, where it has a specific pattern (Asmar, 2008).

In vertebrate, multiproteic complexes composed by GATA-1, LMO2, Ldb-1 and the bHLHs E47 and SCL, are required for normal differentiation of haematopoietic cells. The current results highlight several evidences in favour of dLMO as a GATA coactivator in Drosophila . (1) A genetic synergism exists between pnr and dLMO null alleles. (2) dLMO modulates the activity of a DC:ac-lacZ reporter, the model target of Pnr, in vivo. Loss of function dLMO mutants show reduced level of the DC:ac-lacZ expression, whereas in gain-of-function dLMO mutants the DC:ac-lacZ expression is increased. (3) dLMO-PA isoform directly interact with Pnr in GST pull down assay. Therefore it is concluded that dLMO might enhance the proneural activity of Pnr through direct interaction with the GATA factor. Consistently, dLMO expression overlaps with the dorsal-most domain of Pnr during third instar larval stages. Though Pnr controls the development of both DC and SC bristles, dLMO null alleles affect only DC bristles. dLMO expression, that overlaps both SC and DC proneural clusters in the notum, is significantly weaker in the SC region, suggesting that regulation of proneural ac/sc expression is differentially sensitive and responds to local combinations of transcription factors. These data support previously published studies demonstrating that the proneural activity of Pnr is prominently repressed in the SC region by the LIM-HD transcription factor Isl (Asmar, 2008).

At later stages, dLMO expression is excluded from the corresponding SOP and its derivative cells. In contrast, the proneural factor Sens, that plays an important role for sensory organ specification, is first broadly expressed in proneural clusters at low levels where it functions as a repressor of ac/sc, and then later, is expressed at high levels in the presumptive SOPs, where it acts as a transcriptional activator that directly interacts and synergizes with the proneural proteins, Ac and Sc. It has been shown that both Gfi-1 and GATA-1, the mammalian ortholog of Sens and Pnr respectively, are essential for development of the closed related erythroid and megakaryocytic lineages. The Sens/Pnr interaction is evolutionary conserved in Drosophila neurogenesis. It is suggestd that Pnr could participate to the Sens-dependent positive autoregulation of Ac/Sc in late SOPs where dLMO is not expressed. The synergism between Pnr and Sens would need more detailed investigations. Taken together, these studies have shown dLMO-PA as a co-activator for Pnr during the establishment of proneural fields and revealed another level of proneural ac/sc regulation during late neurogenesis in the Drosophila PNS (Asmar, 2008).

Targets of Activity

Genes regulated by Scute are similar to those regulated by Achaete, with the exception of Scute's regulation of Sex-lethal.

Scute and Achaete bind to the consensus E box sequence CANNTG, activating transcription in Enhancer of split, m7 and m8 of the Enhancer of split complex and Bearded and scabrous (Singson, 1994). This is the defining process in selection by lateral inhibition of a single sensory organ precursor from each proneural cluster in imaginal disc neurogenesis. achaete, scute, and lethal of scute, together with ventral nervous system defective, act synergistically to specify the neuroectodermal expression of Enhancer of split complex genes. Autoregulatory interactions of E(spl)-C genes contribute to this regulation (Kramatschek, 1994).

Bearded is activated by the proneural genes. Several genes are direct downstream targets of achaete-scute activation, as judged by the following criteria: the genes are expressed in the proneural clusters (PNCs) of the wing imaginal disc in an ac-sc-dependent manner; (2) the proximal promoter regions of all of these genes contain one or two high-affinity ac-sc binding sites, which define the novel consensus GCAGGTG(T/G)NNNYY, and (3) where tested, these binding sites are required in vivo for PNC expression of promoter-reporter fusion genes. Interestingly, these ac-sc target genes, including , Enhancer of split m7, Enhancer of split m8, and scabrous, are all known or believed to function in the selection of a single SOP from each PNC, a process mediated by inhibitory cell-cell interactions. Thus, one of the earliest steps in adult peripheral neurogenesis is the direct activation by proneural proteins of genes involved in restricting the expression of the SOP cell fate. Brd bristle phenotypes are dependent on ac/sc function, and Brd transcript accumulation within wing disc proneural clusters likewise requires ac/sc activity. Brd promoter, containing the novel sequence described above. is directly activated in proneural clusters by bHLH protein complexes that include ac and sc. However, in contrast to ac and sc, there is generally no clear elevation of Brd transcript in presumptive SOPs (Leviten, 1997).

It is now clear that E(spl)-C gene expression is totally dependent on lateral inhibition and the Notch pathway acting through Suppressor of Hairless. If this is true, then the role of Achaete, Scute, and VND in the transcriptional activation of E(spl)-C genes is currently unclear. Perhaps Achaete, Scute and VND activate proneural genes which in turn could activate E(spl)-C genes.

The transcription of neurogenic gene Delta is regulated by AS-C genes. A region in the Delta promoter drives Delta expression in clusters of neurectodermal cells preceding and during neuroblast segregation (Haenlin, 1994).

Although ac and sc have similar patterns of expression, deletion of either gene removes specific subsets of sensory organs. This specificity is traceable to the peculiar regulation of ac and sc expression. These genes are first activated in complementary spatial domains in response to different cis-regulatory sequences. Each gene product then stimulates expression of the other gene, thus generating similar patterns of expression. Therefore, removal of one gene leads to the absence of both proneural gene products and sensory organs in the sites specified by its cis-regulatory sequences (Martinez, 1991).

Scute (SisterlessB) targets sex lethal

Three X-linked genes have been identified: scute, sisterless-a and runt. These determine the initial functional state of Sex lethal in the soma. Using pole cell transplantation, it has been found that germ cells simultaneously heterozygous for sc, sis-a, and < I> runt and deficient in Sxl, will develop into functional oocytes when transplanted into wild-type female hosts. Thus genes sc, sis-a and run, though needed to activate Sxl in the soma, seem not to be required to activate Sxl in the germ line (Granadino, 1993).

In D. melanogaster, a set of ‘X:A numerator genes,’ which includes sisterlessA (sisA ), determines sex by controlling the transcription of Sex-lethal (Sxl). sisA was characterized from D. pseudoobscura and D. virilis and the timing of sisA and Sxl expression was studied with single cell-cycle resolution in D. virilis, both to guide structure-function studies of sisA and to help understand sex determination evolution. D. virilis sisA is shown to shares 58% amino acid identity with its D. melanogaster ortholog. The identities confirm sisA as an atypical bZIP transcription factor. Although D. virilis sisA can substitute for D. melanogaster sisA, the protein is not fully functional in a heterologous context. One aim of this study was to use DNA sequence conservation to identify potential regulatory regions that allow genes to function as X:A numerator elements. The heptomeric sequence CAGGTAG, which is conserved in all three sisA genes examined here, is a promising candidate. It appears in pairs less than 200 bp upstream of the transcription start site, not only for sisA, but also for sisB (scute) and Sxl. These three genes have in common an unusually early onset of expression that allows the embryo to establish X-chromosome dosage compensation by the time general transcription begins. Perhaps this sequence provides for such an early start of transcription. Taken together, these data indicate that the same primary sex determination mechanism exists throughout the genus Drosophila (Erickson, 1998).

For Drosophila flies, sexual fate is determined by the X chromosome number. The basic helix-loop-helix protein product of the X-linked sisterlessB (sisB or scute) gene is a key indicator of the X dose and functions to activate the switch gene Sex-lethal in female (XX), but not in male (XY), embryos. Zygotically expressed sisB and maternal daughterless proteins are known to form heterodimers that bind E-box sites and activate transcription. SISB-Da binding at Sxl was examined by using footprinting and gel mobility shift assays and SISB-Da was found to bind numerous clustered sites in the establishment promoter SxlPe. Surprisingly, most SISB-Da sites at SxlPe differ from the canonical CANNTG E-box motif. These noncanonical sites have 6-bp CA(G/C)CCG and 7-bp CA(G/C)CTTG cores and exhibit a range of binding affinities. The noncanonical sites can mediate SISB-Da-activated transcription in cell culture. P-element transformation experiments show that these noncanonical sites are essential for SxlPe activity in embryos. Together with deletion analysis, the data suggest that the number, affinity, and position of SISB-Da sites may all be important for the operation of the SxlPe switch. Comparisons with other dose-sensitive promoters suggest that threshold responses to diverse biological signals have common molecular mechanisms, with important variations tailored to suit particular functional requirements (Yang, 2001).

Deletion analysis has suggested that two subsegments within the 1.4-kb promoter account for most SxlPe enhancer activity. An upstream segment (-1.4 to -0.8 kb) contributes to the strength of the promoter but is not essential for sex specificity. A proximal segment, including the start site and 390 upstream base pairs, drives a low-level, nonuniform female-specific expression. The sequence conservation between SxlPe in D. melanogaster and Drosophila subobscura correlates well with the functional analysis. There is extensive sequence identity in the proximal region, with more limited matches in the distal segment, and no detectable similarity in the similarly sized central spacer segment. Within the proximal 390 bp, the sequences of all six B/Da binding sites are perfectly conserved. In the distal region, E-box sites 7 and 8 are conserved. Interestingly, while the sequence of site 9 is not conserved, another low-affinity B/Da site, CAGCTTG, is present in the equivalent position in D. subobscura (Yang, 2001 and references therein).

A critical question for sex determination is as follows: how can SxlPe sense the twofold difference in male and female SIS and Runt concentrations and translate that into a strong all-or-nothing response? At some level, SxlPe expression must be related to sex-specific differences in binding site occupancy. This is true whether dose sensitivity arises from cooperative DNA binding, competition with negative regulators, or from the sum of multiple independent interactions between the sex signal elements and the transcription machinery. It appears that sex-specific control of SxlPe occurs largely through the activity of two regulatory regions: a central segment located between 1.4 and -0.8 kb, responsible primarily for promoter strength, and a proximal element, -390 to +44 bp, largely responsible for sex specificity. While these regions appear most important, sequences beyond -1.4 kb also contribute to the promoter, as inferred from the stronger lacZ expression from larger promoter fusions and by the ability of upstream sequences to partially substitute for the loss of the central -1.4 to -0.8 kb region (Yang, 2001).

The 10 B/Da sites identified in vitro are located in the central and proximal promoter elements. In addition, the sequence predicts 11 likely B/Da binding sites of high or moderate binding affinity located in the distal region between -1.6 and -3.7 kb, raising the possibility that there may be 21 or more B/Da sites in the functional SxlPe region. Given a 39% GC content, random sequence would predict only 2.7 matches to the B/Da consensus at SxlPe, suggesting that many of these predicted sites are functional binding sequences. Overall, there is a striking positional gradient of predicted binding affinities of the B/Da sites, with the moderate-affinity sites clustered proximally and the highest-affinity sites positioned distally. The asymmetric distribution of high- and moderate-affinity sites hints that the distal sites may be occupied at both high and low B/Da concentrations, with full occupancy of the proximal sites occurring only in XX embryos. This suggests a model in which the on or off response of SxlPe to X-chromosome dose occurs primarily within the proximal X-counting region (XCR), with the distal segments providing an augmentation function that enhances transcription only when the female-specific XCR complex forms. It is unlikely that the distal high-affinity sites titrate B/Da from the XCR in males, because B/Da is in enormous excess over the Sxl binding sites (Yang, 2001).

The proneural proteins Atonal and Scute regulate neural target genes through Different E-Box binding sites

For a particular functional family of basic helix-loop-helix (bHLH) transcription factors, there is ample evidence that different factors regulate different target genes but little idea of how these different target genes are distinguished. The contribution was investigated of DNA binding site differences to the specificities of two functionally related proneural bHLH transcription factors required for the genesis of Drosophila sense organ precursors (Atonal and Scute). The proneural target gene, Bearded, is regulated by both Scute and Atonal via distinct E-box consensus binding sites. By comparing with other Ato-dependent enhancer sequences, an Ato-specific binding consensus that differs from the previously defined Scute-specific E-box consensus was defined, thereby defining distinct EAto and ESc sites. These E-box variants are crucial for function: (1) tandem repeats of 20-bp sequences containing EAto and ESc sites are sufficient to confer Atonal- and Scute-specific expression patterns, respectively, on a reporter gene in vivo; (2) interchanging EAto and ESc sites within enhancers almost abolishes enhancer activity. While the latter finding shows that enhancer context is also important in defining how proneural proteins interact with these sites, it is clear that differential utilization of DNA binding sites underlies proneural protein specificity (Powell, 2004).

Ato and Sc must interact with distinct DNA binding sites in vivo. In the target genes analyzed in this study, residues immediately flanking the 6-bp core E box allow the definition of distinct EAto and ESc consensus binding sites for Ato/Da and Sc/Da, respectively. It can be deduced that these variant E boxes consist of half sites, with Sc, Ato, and Da contacting GCAG, AWCAK, and STGK, respectively (proneural core sites underlined). Striking affirmation of binding site differences is provided by the common target gene Brd, which is regulated by Ato and Sc in a modular fashion via distinct E boxes in different enhancers. These E-box variations are crucial for function. They are sufficient to confer proneural protein-specific expression patterns on a GFP reporter gene in isolation from other enhancer sequences. Moreover, interchanging ESc and EAto sites within proneural enhancers almost abolishes enhancer activity and so is almost equivalent to destroying the E box. This shows that the correct proneural regulation of target genes requires the presence of a specific E-box binding site in combination with the selective ability to interact with factors bound to other sites within these enhancers (Powell, 2004).

In vivo DNA binding site differences underlie proneural specificity. Yet, paradoxically, evidence from misexpression and protein structure-function studies has strongly suggested that the target gene specificities of Ato and Sc (and their vertebrate homologues) result from specific interactions with protein cofactors and not from intrinsic differences in how proneural proteins contact DNA. For instance, DNA-contacting residues are shared between the proteins, and consequently, as show in this study, Ato/Da and Sc/Da have identical DNA binding properties in vitro. One way to reconcile these observations is that protein-protein interactions with cofactors may induce DNA binding specificity in proneural proteins by modifying the conformation of the DNA-contacting residues of the bHLH domain. It is also possible that DNA binding itself is not selective in vivo but that occupancy of different DNA binding sites triggers productive or unproductive conformational changes in the proneural proteins that influence their interaction with cofactor proteins. The favored view is that specific cofactor interactions will induce distinctive DNA binding affinities; the conformational changes induced by each may be subtle individually but may be interdependent and mutually reinforcing (Powell, 2004).

Significantly, ato can rescue mutations of its mouse orthologue, Math1, and vice versa, suggesting that DNA site preferences will be conserved among vertebrate orthologues. A number of functional E boxes have been characterized in vertebrate neural-specific genes, and in two cases the interacting bHLH protein is likely to be an Ato orthologue: an autoregulatory site in the Math1 promoter (TCAGCTGG) and a proposed Xath5 site in the 3 nAChr promoter (ACAGCTGG). Thus, in these cases the E boxes match EAto in the 5 flanking base (Powell, 2004).

For correct enhancer function, proneural proteins must interact differentially with other DNA binding factors. Although E-box consensus differences underlie specificity, enhancer context is usually also crucial for this specificity to be manifest. In swapping EAto and ESc sequences between the sc and ato autoregulatory enhancers, in only one case was a corresponding 'swap' in enhancer specificity observed: Ato could be made to regulate the sc-SMC-E enhancer via an EAto site. Otherwise, alteration of E-box flanking bases resulted in a severe loss of enhancer activity. This suggests that recruiting a different proneural protein cannot alone change the function of an enhancer. Correct proneural target enhancer function requires a combination of the correct E-box sequence and the ability to interact with other factors bound to the enhancer. This is reminiscent of the cooperative interaction between MyoD and MEF2 in myogenesis and of interaction between Sc/Da and Pannier/Chip to activate ac in a specific part of the thorax. For the Ato enhancer a requirement for cooperative interaction between Ato/Da and the ETS protein Pointed, bound to a site adjacent to the EAto site has been shown (zur Lage, submitted, cited in Powell, 2004). Similarly, neurogenin 2 interacts with LIM factors during the activation of subtype-specific target genes. The finding that EAto and ESc sites encode much specificity in artificial enhancers suggests that tandem E boxes remove the requirement for interaction with factors bound to other DNA sites, perhaps because cooperative binding between proneural proteins themselves is then sufficient and may even allow the recruitment of cofactors by protein interactions alone. Interestingly, the converse situation may also occur: for both the ato and sc enhancers, there is a low level of expression remaining after swapping of E boxes. This suggests that the original bHLH protein can be recruited to the 'wrong' E-box sequence, inefficiently, by interaction with cofactors. A basis for this can be found with MyoD, where interaction with Sp1 allows MyoD to bind to a nonideal site in the human cardiac alpha-actin promoter (Powell, 2004 and references therein).

Another indication of the importance of enhancer context is that parent enhancers support patterns different from those of the isolated E boxes, at least in the case of Ato. [ato-E1]7-GFP is widely expressed in Ato-specific regions in the embryo, whereas the parent ato-FCO-E enhancer is limited to a small subset of chordotonal SOPs (zur Lage, submitted cited in Powell, 2005). In discs, ato-E1 drives expression relatively poorly in FCO precursors compared with ato-FCO-E. TAKR86C is even more extreme: the TAKR86C enhancer is normally active only in a single embryonic chordotonal precursor (the P cell), but the TAKR86C-E2 site drives Ato-dependent expression in the larval and adult eye and not in the P cell. Clearly, the parent enhancers must have other regulatory inputs that restrict expression (Powell, 2004).

Despite the importance of enhancer context and interaction with other factors, the ESc and EAto sequences support strikingly specific expression patterns when taken out of their enhancers. All tandem repeat E-box constructs tested were activated almost exclusively during PNS neurogenesis, despite the presence of some 24 class A factors in Drosophila. None were activated during CNS neurogenesis, myogenesis, or mesoderm formation, even though AS-C proteins function during the former two processes. In the case of two sites, sc-E1 and ato-E1, expression is remarkably consistent, with regulation solely by Ato or Sc, respectively, in PNS neurogenesis; the sites alone must contain all of the information necessary for specific recognition. It is remarkable that ato-E1 does not respond in vivo to the Ato-related protein Cato or Amos, even though the latter has a basic region almost identical to that of Ato and might be expected to have the same DNA binding properties. The main exception to this specificity is the presence of expression in embryonic ectodermal stripes. These resemble muscle attachment sites, suggesting recognition by the Ato superfamily member Delilah. The conclusion is that tandem duplications can overcome the need for DNA binding sites for other factors. Cooperative binding of proneural proteins may negate the need for cofactor interactions, or, as suggested above, cooperative binding may allow the recruitment of cofactors directly (Powell, 2004).

There are dramatic differences between the two Ato sites tested. Unlike ato-E1, the TAKR86C-E2 site drives expression in only a subset of Ato locations; it appears to be photoreceptor specific despite containing a good class A core E-box match (CAGGTG). This opens up the possibility that there may be different subtypes of Ato binding sites. The spatially restricted recognition of TAKR86C-E2 also implies that cellular context is important in how different sites are recognized. One may speculate, for instance, that eye-specific DNA binding properties of Ato may be conferred by interaction with PAX6 proteins. Interestingly, diversity of E-box expression patterns correlates with variability in the consensus sequences. The ESc consensus sequence (based on some 23 sites) is less variable than the Ato/Da consensus, even though the latter is based on only three sites. It is suggested that regulatory fine-tuning by E-box variation is more important for Ato target genes than for Sc target genes (Powell, 2004).

In summary, the E-box sequences and their flanking bases contain impressively sufficient information for regulation by specific proneural proteins. However, there is further complexity: at least the two Ato sites tested support different patterns and have a different relationship with their parent enhancers. Subtle variations in regulation by proneural proteins may therefore contribute to variations in target gene expression; indeed, there may be no such thing as a typical target site or target gene. This may also be true for common target genes: despite the modular regulation of Brd, the possibility is not ruled out that within the spectrum of proneural E boxes there are some sites that are jointly recognized by Sc and Ato in vivo and that this would be another mechanism for regulating common target genes (Powell, 2004).

phyllopod is a target gene of proneural proteins in Drosophila external sensory organ development

Proneural basic helix-loop-helix (bHLH) proteins initiate neurogenesis in both vertebrates and invertebrates. The Drosophila Achaete (Ac) and Scute (Sc) proteins are among the first identified members of the large bHLH proneural protein family. phyllopod (phyl), encoding an ubiquitin ligase adaptor, is required for ac- and sc-dependent external sensory (ES) organ development. Expression of phyl is directly activated by Ac and Sc. Forced expression of phyl rescues ES organ formation in ac and sc double mutants. phyl and senseless, encoding a Zn-finger transcriptional factor, depend on each other in ES organ development. These results provide the first example that bHLH proneural proteins promote neurogenesis through regulation of protein degradation (Pi, 2004).

In phyl2-null mutant clones, adult ES organs are absent, and this defect is caused by a failure in SOP specification. In phyl2/phyl4 hypomorphic mutants, most ES organs are also absent, and expression of two SOP markers, ase-lacZ and the A101 enhancer trap line, are strongly compromised. However, Sens is expressed in single, selected SOPs at 12-14 h after puparium formation (APF), suggesting a defect in SOP differentiation, but not in SOP selection in phyl hypomorphic mutants (Pi, 2004).

Ac expression, which is initially in proneural clusters and restricted in SOPs at 12-14 APF in wild type, was examined. However, in phyl2/phyl4 mutants, Ac expression is not only detected in SOPs, but also weakly in SOP-neighboring cells. Ac expression in SOP-neighboring cells is later diminished at 16-18 APF. This result suggests that lateral inhibition is partially affected. To test this, E(spl)m8-lacZ was used as a reporter to monitor Notch signaling. Although E(spl)m8-lacZ is strongly expressed in a proneural pattern in wild type, the expression is abolished in phyl2/phyl4 mutants, suggesting that activation of the Notch pathway in the SOP-neighboring cells is compromised in phyl mutants (Pi, 2004).

In wild-type ES organ development, Sens staining appears in two SOP-daughter cells at 16-18 h APF and in four daughter cells at 24-28 h APF. In phyl2/phyl4 mutants, Sens is still maintained mostly in single cells even at 24-28 h APF. In wild-type animals, SOPs express elevated levels of the cell-cycle regulator Cyclin E (CycE). In phyl2/phyl4 mutants, SOPs fail to express a higher level of CycE, suggesting a failure in cell cycle progression. The SOPs and SOP daughter cells of ES organs express cut, a selector gene in the determination of ES organ identity. In phyl2/phyl4 mutants when SOP differentiation has been arrested, Cut expression is absent. Taken together, these data indicate that Phyl is required for gene expression in SOP differentiation and lateral inhibition, for SOP cell cycle progression and for ES organ identity (Pi, 2004).

Ac and Sc are bHLH transcriptional activators, and Ac/Da and Sc/Da heterodimers bind specifically to the E boxes CAG(G/C)TG with high affinity and CACGTG with low affinity. Within the 4.1-kb phyl promoter region, there are four such E boxes (E1-E3, CAGCTG; E4, CACGTG). Three phyl reporter genes were constructed by fusing 4.1-, 3.4-, and 2.2-kb promoter regions of phyl to GFP, and all three reporters show similar expression patterns with difference in the GFP signal intensities (the 4.1-kb promoter being the strongest and 2.2-kb being the weakest). For example, the 3.4-kb region is sufficient to drive GFP expression in embryonic SOPs, SOPs of the late third-instar larval wing and leg discs, and SOPs in early pupal nota. These phyl-GFP reporter genes are also expressed in the proneural clusters at earlier stages in both wing discs and pupal nota (Pi, 2004).

To test whether these promoter regions are sufficient for phyl in vivo function, phyl4.1-ORF and phyl3.4-ORF rescue constructs were made by fusing the 4.1- and 3.4-kb promoter regions, respectively, to the phyl ORF. The phyl1/phyl2 mutants die at late embryonic or first-instar larval stages. However, both phyl4.1-ORF and phyl3.4-ORF are sufficient to rescue the viability of phyl1/phyl2 animals to the adult stage, with well developed ES organs on the notum. The inabilities to fully rescue the viability and ES organ number of phyl1/phyl2 are caused by insufficient expression levels of the transgenes, as suggested by the fact that two copies of phyl3.4-ORF further improve the viability of the phyl1/phyl2 mutants to 77% and increase the bristle number to 110 ± 7. Hypomorphic phyl4/phyl2245 mutants, which display a greatly reduced number of ES organs on the notum, are completely rescued by two copies of phyl3.4-ORF. Therefore, all of these results show that both 4.1- and 3.4-kb regions of the phyl promoter contain sufficient temporal and spatial information in regulating phyl expression (Pi, 2004).

Whether activity of the 3.4-kb promoter region is regulated by ac and sc was tested. sc10-1 is a compound mutation in which both ac and sc are inactivated. Expressions of phyl3.4-GFP in sc10-1 wing discs and pupal nota are abolished. In contrast, when sc is misexpressed by dpp-GAL4 at the anterior/posterior boundary of the wing disc, phyl3.4-GFP is strongly activated in this region. Similar results are also observed for phyl4.1-GFP. Therefore, these results clearly show that proneural genes ac and sc are necessary and sufficient to activate phyl promoter activity (Pi, 2004).

To test whether Ac and Sc directly regulate phyl expression, all four E boxes in the 3.4-kb promoter region were mutated to make the phyl3.4DeltaE-GFP. The expression of phyl3.4DeltaE-GFP in the SOPs of ES organs in late third-instar wing and leg discs and in pupal nota is strongly reduced when compared to the expression of phyl3.4-GFP. When the GFP intensity was quantified in the anterior wing margin SOPs, E box mutations in the 3.4-kb promoter region contribute to a 50% reduction. In contrast, the expression level of phyl3.4Delta E-GFP in the SOPs of chordotonal (CH) organs promoted by the proneural gene ato is comparable to that of phyl3.4-GFP. These results indicate that the phyl promoter is activated by Ac and Sc through these four E boxes. To test the in vivo significance of the four E boxes, the rescue abilities were compared between phyl3.4-ORF and phyl3.4DeltaE-ORF. Although phyl3.4-ORF can rescue phyl1/phyl2 to the adult stage, phyl3.4DeltaE-ORF-rescued animals only survive to the third-instar larval stage. The abilities of phyl3.4DeltaE-ORF to rescue the viability and the notal ES organ of phyl4/phyl2245 mutants are strongly reduced to 36 ± 11% and 67 ± 12, respectively. Many of the rescued ES organs show abnormal configuration such as double hair/double socket, which is a phenotype frequently observed in hypomorphic phyl mutants. Therefore, these results suggest that these four E boxes are required for full phyl promoter activity in SOPs (Pi, 2004).

In sc10-1 flies, phyl expression is diminished and ES organ development is disrupted. It was asked whether forced expression of phyl can functionally substitute for the absence of ac and sc activities. Misexpression of phyl by Eq-GAL4 in sc10-1 flies efficiently rescues ES organ formation, to a level similar to that rescued by misexpression of the proneural gene sc. The rescued ES organs by phyl are arranged in a pattern similar to that of the wild-type flies; the ES organs are aligned in rows and well separated. SOP-specific expressions of neu-LacZ (A101), ase-LacZ, Sens, and Cut, as well as expression of E(spl)m8-LacZ, are restored. As a comparison, sens, whose expression also depends on ac and sc was misexpressed by Eq-GAL4; sens poorly rescues sc10-1 in ES organ formation, although sens is more effective than phyl and sc in inducing ES organs in wild-type background. Therefore, these results suggest that phyl is able to execute the developmental program of ES organs in the absence of proneural genes ac and sc.

Ac and Sc activate the bHLH gene ase in SOPs to promote SOP differentiation. Misexpression of ase or another bHLH gene lethal of scute (l'sc) is capable of generating ES organs independent of ac and sc. Whether phyl can rescue ES organ formation in the absence of all four bHLH genes, ac, sc, ase, and l'sc, in scB57 mutant clones, was tested. Although, in a control experiment, misexpression of sc can rescue the ES organ formation in scB57 mutant clones, misexpression of phyl fails to rescue. From this result, it is inferred that phyl requires ase (and/or l'sc) in inducing ES organ formation (Pi, 2004).

The promoter analysis suggests that phyl expression in SOPs might be activated by factors other than Ac and Sc. Within the 4.1-kb promoter region, eight putative Sens-binding sites (AAATCA, S box) were identified, with three sites distributed within the 3.4-kb proximal region and five sites in a cluster located in a very distal region. Whether Sens plays a role in phyl activation in SOPs was tested, using phyl4.1-GFP as a reporter. At 10-12 h APF, phyl4.1-GFP is expressed in dorsoventral stripes along the notum in a pattern analogous to early Ac and Sc expression patterns. At 15 h APF, phyl4.1-GFP expression is restricted in SOPs. In sensE2-null clones, phyl4.1-GFP is expressed in dorsoventral stripes, and this expression is quickly restricted to single SOPs at 16 h APF, identical to that in wild-type tissue. At 20 h APF, when wild-type SOPs have divided to two daughter cells, phyl4.1-GFP expression in sensE2 clones is still maintained in single SOPs, and mostly in two cells at 23 h APF when wild-type cells are in GFP-positive clusters containing three or four cells. Therefore, these results suggest that, in the absence of sens activity, SOP development is delayed, but phyl4.1-GFP expression is minimally affected (Pi, 2004).

To determine the contribution of Sens binding sites to phyl expression, the 3.4-kb phyl promoter region (whose expression pattern is analogous to the 4.1-kb promoter in both wild-type and sens mutant background) was tested. The phyl3.4DeltaS-GFP reporter with all three S boxes mutated expresses little difference in the GFP pattern and intensity when compared to phyl3.4-GFP. However, the reporter with mutations in all four E boxes and three S boxes (phyl3.4DeltaES-GFP) enhances GFP intensity by 20% when compared to phyl3.4DeltaE-GFP with mutations only in four E boxes. This 20% increase in GFP intensity reflects an increase in the phyl activity in vivo because phyl3.4DeltaES-ORF shows stronger abilities than phyl3.4E-ORF in rescuing both the viability and the ES organ number of phyl4/phyl2245 flies. Therefore, these data suggest that these S boxes play a negative role in regulation of phyl activity (Pi, 2004).

To test whether phyl regulates sens expression, Sens protein expression was examined in phyl mutants. In phyl2-null clones, Sens expression was almost diminished in all stages examined, including the single-SOP stage, the two-cell stage and the four-cell stage, suggesting that phyl is required for Sens expression in ES organ development (Pi, 2004).

To analyze the functional relationship between phyl and sens further, rescue experiments were performed. Misexpression of sens by Eq-GAL4 fails to induce ES organ formation in phyl2 mutant clones. Similarly, ES organ formation induced by phyl misexpression is blocked in sensE2 mutant clones. This result suggests that although Sens expression depends on phyl activity, Sens and Phyl function in parallel to promote ES organ development (Pi, 2004).

It is concluded that phyl is a non-bHLH gene that can functionally substitute for proneural bHLH genes to execute neural developmental program. This ability of phyl is also manifested from the analysis of phyl loss-of-function phenotypes: sens and ase, required for SOP differentiation, are inactivated, and in addition, neuralized (A101 insertion locus), implicated in the activation and E(spl)-m8 in the transduction of the Notch pathway, is not expressed. Furthermore, SOP cell division, a prerequisite step to generate distinct daughter cells for constructing a complete ES organ, is blocked in phyl mutants. This defect likely reflects a role for phyl in controlling cell cycle progression, because CycE expression in SOPs maintains at a basal level. Therefore, although SOPs have been selected from proneural clusters in phyl hypomorphs, they are associated with several defects as described (Pi, 2004).

Studies of proneural genes have shown that ac and sc promote ES organ identity, whereas ato promotes CH organ identity. cut is the selector gene to specify the ES organ identity; in its absence ES organs are transformed into CH organs and misexpression of cut transforms CH organs into ES organs. The absence of Cut expression in phyl mutants suggests that specification of ES organ identity may be through a regulation of cut expression by Phyl. Although phyl is expressed in SOPs for both ES and CH organs, it was found that, in phyl2/phyl4 and phyl1/phyl4 mutants, A101 expression in leg CH organ precursors remained normal. Also, misexpression of phyl fails to rescue ato mutants in CH organ formation. These results suggest that phyl mediates functions of ac and sc only in ES organ development (Pi, 2004).

One well characterized function of Phyl is to bring the Ttk protein to the ubiquitin-protein ligase Sina for degradation. During SOP development, phyl is expressed in SOPs, and Ttk is expressed ubiquitously except in the SOPs and the proneural clusters. Genetic studies among phyl, sina, and ttk suggest that phyl and sina promote ES organ development by antagonizing ttk activity. Ttk contains a BTB/POZ domain and functions as a transcriptional repressor. Therefore, degradation of Ttk can lead to the derepression of SOP-specific genes. These studies suggest that degradation of a general transcriptional repressor plays a crucial role in regulating gene expression in different aspects of neural precursor differentiation (Pi, 2004).

Genetic programs activated by proneural proteins in the developing Drosophila PNS

Neurogenesis depends on a family of proneural transcriptional activator proteins, but the 'proneural' function of these factors is poorly understood, in part because the ensemble of genes they activate, directly or indirectly, has not been identified systematically. A direct approach to this problem has been undertaken in Drosophila. Fluorescence-activated cell sorting was used to recover a purified population of the cells that comprise the 'proneural clusters' from which sensory organ precursors of the peripheral nervous system (PNS) arise. Whole-genome microarray analysis and in situ hybridization was then used to identify and verify a set of genes that are preferentially expressed in proneural cluster cells. Genes in this set encode proteins with a diverse array of implied functions, and loss-of-function analysis of two candidate genes shows that they are indeed required for normal PNS development. Bioinformatic and reporter gene studies further illuminate the cis-regulatory codes that direct expression in proneural clusters (Reeves, 2005).

The PNC cells that express the proneural genes achaete (ac) and scute (sc) comprise only a small fraction of the wing imaginal disc of the late third-instar Drosophila larva. It is anticipated that this might frustrate attempts to characterize PNC-specific gene expression in unfractionated wing discs (e.g., by comparison of wild-type and ac-sc mutant tissue). Accordingly, PNC cells were purified by using fluorescence-activated cell sorting (FACS). As a PNC-specific marker, a GFP reporter was chosen representing the Bearded family gene E(spl)m4. m4 is strongly and specifically expressed in PNCs, and a cis-regulatory module has been identified sufficient to recapitulate this activity. Wing imaginal discs were dissected from late third-instar larvae carrying the m4-GFP transgene and dissociated in trypsin-EDTA; cells with fluorescence greater than that of w1118 control cells (GFP-positive cells) and cells with fluorescence comparable to the control (GFP-negative cells) were recovered separately by FACS (Reeves, 2005).

Transcripts from several genes known to be expressed in domains of the wing disc outside of PNCs (en, hh, and twi) were found to be greatly depleted in the GFP-positive cell population. These negative controls provide further evidence of successful separation of PNC cells from other disc cells (Reeves, 2005).

Since the microarray data clearly associates expression of known genes preferentially with the expected cell populations, 43 candidates not known to be expressed in wing imaginal discs were chosen for further analysis. Candidate genes for which cDNA clones were available from the Drosophila Gene Collection were favored. The selected genes exhibit a wide variety of GFP+/GFP- expression ratios in the microarray data, and their products have a broad spectrum of predicted functions (Reeves, 2005).

In situ hybridization was employed as a secondary screening method, both to verify that candidate genes selected from these microarray data are expressed in wing imaginal discs, and to determine their specific patterns of transcript accumulation. The wing disc expression patterns observed can be sorted into three major classes: PNC patterns, SOP patterns, and overlapping patterns. Five of the 43 selected candidate genes exhibit a complete PNC pattern of expression, while 3 other candidates are expressed in subsets of PNCs; phyl is expressed in the SOP and in a subset of non-SOP cells in each PNC. An unexpected 18 candidates are expressed in the presumptive SOP cells of the wing disc. Fourteen of these SOP genes are expressed in a complete pattern of SOPs, whereas the remaining four are expressed either late in SOP development or in subsets of SOPs. The existence of the latter group suggests that the cell sorting strategy made it possible to identify genes that are expressed preferentially in just a few cells of the wing disc. Overall, 27 (63%) of the tested candidates were found to display PNC- or SOP-specific expression patterns. This is likely to be an underestimate of the true success rate of the microarray analysis, since 23 genes known to be expressed in these patterns are not included in the statistic, though they were reidentified in the screen (Reeves, 2005).

In addition to those expressed specifically in PNCs and SOPs, a small group of candidate genes was found that is expressed in patterns that overlap PNCs but appears to be distinct from them. Detection of this class of genes is an important confirmation of the efficacy and unbiased nature of the experimental approach (Reeves, 2005).

Patterned expression of the proneural genes ac and sc defines the PNCs for most external sensory bristles in adult Drosophila, and ac-sc function is required for PNC and SOP gene expression, as well as for specification of the SOP cell fate. Fifteen of the genes identified by the combined cell sorting/microarray approach also require proneural gene function for their expression. In an ac sc proneural mutant background, transcript accumulation from members of both the PNC (CG11798, CG32434/loner, edl, PFE) and SOP (CG3227, CG30492, CG32150, CG32392, Men, qua) classes is lost from PNCs that require ac-sc function. This result is further evidence that the approach has identified bona fide PNC genes, and it demonstrates that expression of these ten genes is, directly or indirectly, downstream of the bHLH activators encoded by ac and sc. The data further show that the PNC-specific imaginal disc expression of the previously studied genes mira, phyl, rho, Spn43Aa, and Traf1 is likewise downstream of proneural gene function (Reeves, 2005).

The identification of sets of genes comprising the genetic programs deployed in PNCs and SOPs by the action of proneural proteins offers a powerful opportunity to investigate the regulatory organization of these programs. Specifically, it was of interest to find out (1) which genes are directly activated by proneural regulators, and which indirectly, and (2) the nature of the cis-regulatory sequences and their cognate transcription factors that distinguish PNC- versus SOP-specific target gene expression. This analysis was initiated by examining potential regulatory sequences of several of the genes that have been identified for the presence of conserved, high-affinity proneural protein binding sites of the form RCAGSTG. The initial approach was to ask whether evolutionarily conserved clusters of these binding sites identify cis-regulatory modules of the appropriate specificity. To date, this strategy has proven very successful. Genomic DNA fragments bearing proneural protein binding site clusters associated with CG11798, edl, Traf1, CG32434/loner, and rho confer PNC-specific activity on a heterologous promoter, while similar modules from CG32150, mira, and PFE drive SOP-specific expression. In three cases, double labeling with the SOP marker anti-Hindsight (Hnt) reveals that PNC-specific expression of the reporter gene includes the SOP as well as the non-SOP cells. Mutation of the proneural protein binding sites in four of the enhancer-bearing fragments severely reduces (CG11798) or abolishes (CG32150, edl, Traf1) reporter gene expression in PNCs/SOPs. Such results indicate that these genes are indeed direct targets of activation by proneural proteins in vivo (Reeves, 2005).

Holometabolous insects like Drosophila carry out two major phases of PNS neurogenesis, one in embryogenesis to form the larval PNS, and a second in the late larval and early pupal stages to construct the adult PNS. Many known genes participate in both phases. Accordingly, it was of interest to determine whether genes identified as being expressed in imaginal disc PNCs or SOPs are also expressed in the developing larval PNS. In situ hybridization reveals that, among others, the PNC genes CG11798 and CG32434/loner and the SOP genes CG3227, CG32150, and CG32392 are indeed expressed in embryonic PNCs and SOPs, respectively (Reeves, 2005).

To determine whether this combined cell sorting/microarray/in situ hybridization approach had indeed identified gene functions required for proper PNS development, loss-of-function alleles of two loci, CG11798 and CG3227, were generated. These were chosen because (1) transcript accumulation from both genes was detected in the primordia of both the larval and adult PNSs; (2) both genes encode proteins with conserved domains; and (3) mobilizable P element transposon insertions were available adjacent to these genes (Reeves, 2005).

CG11798 is predicted to encode a probable transcription factor with four zinc finger domains. Loss-of-function alleles of the gene were generated by mobilizing KG03781, a P element located immediately downstream. A precise excision of the P transposon and two partial deletions of the CG11798 coding region were recovered and characterized by sequencing. Deletions 19E and 34E are both homozygous lethal during early larval stages, and both confer clear defects in the development of the larval PNS. 19E causes the loss or misplacement of sensory neurons marked by mAb 22C10 and sensory organ accessory cells marked by anti-Prospero (αPros). Deletion 34E confers an even more severe PNS phenotype and removes or misplaces many more 22C10-positive and Pros-positive sensory organ cells in each hemisegment. The difference in the severity of the 19E and 34E mutant phenotypes may be due to the fact that the latter deletes a larger portion of the CG11798 coding region, including the codons for the four zinc fingers. As a control genotype, use was made of the precise excision (PE) derivative of the KG03781 transposon insertion. No PNS mutant phenotype was detected in homozygous PE embryos, demonstrating that the defects observed in the 19E and 34E deletion homozygotes do not result from a second-site mutation on the original KG03781 chromosome. The results of complementation tests led to the conclusion that CG11798 corresponds to the previously described charlatan (chn) locus (Reeves, 2005).

To generate loss-of-function alleles of CG3227, the P element transposon KG07404, inserted just upstream of the gene, was mobilized. Imprecise excision created two deletions, 23B and 23I. Homozygosity for either results in nearly complete lethality before adulthood. Mosaic adult flies carrying FLP/FRT-generated mutant clones exhibit a severe PNS defect in which most mechanosensory bristles within the clonal territory not only lack shaft structures but also bear multiple socket structures, suggestive of shaft-to-socket cell fate transformations. The major defects observed in sensory structures in both the larval and adult PNSs prompted giving CG3227 the new name insensitive (insv) (Reeves, 2005).

insv is predicted to encode a protein containing a conserved C-terminal domain of unknown function called DUF1172. DUF1172 was first recognized in the vertebrate NAC1 proteins, transcription factors that also contain BTB/POZ protein-protein interaction domains. Alignment of arthropod and vertebrate DUF1172s reveals that the domain is large (approximately 125 amino acids) and contains a highly conserved central region of alternating polar/charged residues and nonpolar residues. This is the first described loss-of-function phenotype for a gene encoding a DUF1172 domain protein (Reeves, 2005).

Several known or potential components of signaling pathways were uncovered in this analysis as exhibiting either PNC- or SOP-specific expression. These include genes encoding a putative G protein-coupled receptor (CG31660), a receptor tyrosine kinase (Ror), a regulator of G protein signaling (loco), and a modulator of Ets protein activity (edl). Earlier studies have linked both G protein function and Ras/MAPK signaling to the development of Drosophila sensory bristles, but much remains to be learned about their roles in this process. These findings suggest functions in PNS development for both known and previously uncharacterized signaling pathway components (Reeves, 2005).

Perhaps surprisingly, the data indicate the PNS-specific expression in imaginal discs of several genes predicted to encode metabolic enzymes, including a uridine phosphorylase (CG6330), a maleylacetoacetate isomerase (CG9363), and a malate dehydrogenase (Men). Exceptional metabolic requirements or signaling activities in developing sensory organs may underlie these observations (Reeves, 2005).

Loss-of-function analysis of two genes identified by the cell sorting/microarray/in situ hybridization approach, one expressed in PNCs (CG11798/chn) and one in SOPs (CG3227), confirms that they are indeed required for normal PNS development in Drosophila. Deletion mutations of CG3227 (insensitive) cause severe defects in the specification and differentiation of sensory organ cells in the adult PNS, as assayed in mosaic clones. Particularly prevalent is an apparent transformation of the shaft cell to the fate of its sister, the socket cell; this is the same phenotype conferred by loss-of-function mutations in N pathway antagonists such as Hairless and numb. The definition of a loss-of-function phenotype for a DUF1172 gene should prove valuable in investigating the in vivo function of this uncharacterized protein domain (Reeves, 2005).

Certain SOP-specific genes, exemplified by sens and phyl, are required for the execution of the SOP fate itself. insv, by contrast, represents a distinct class of SOP gene, required not for the fate of this cell, but for the specification and/or differentiation of one or more of its progeny. Thus, SOP-specific (or, more generally, precursor-specific) gene expression can serve the same function as maternal gene expression -- providing gene products essential to the development of descendants. It is anticipated that a number of the SOP genes identified will prove to act similarly (Reeves, 2005).

The function of proneural bHLH proteins in Drosophila PNS development is complex, since they not only activate in SOPs genes that promote the neural precursor cell fate (e.g., ac and sc themselves, sens and phyl); they also activate in non-SOPs genes involved in inhibiting this fate (e.g., genes of the Enhancer of split Complex). The nature of the cis-regulatory 'codes' (combinations of transcription factor binding sites) that distinguish the PNC versus SOP expression specificities is of particular interest. One code has been identified for the expression of N-responsive genes in the non-SOP cells of the PNC that consists of binding sites for the proneural proteins plus sites for the N-activated transcription factor Suppressor of Hairless (Su(H)). Importantly, none of the PNC modules identified in this study includes a conserved high-affinity Su(H) site, yet at least three of them do mediate direct transcriptional activation by the proneural proteins. Moreover, the expression driven by these new PNC modules includes the SOP, whereas the 'Su(H) plus proneural' code directs expression that excludes it. These findings indicate the existence of at least one novel code for PNC expression, and of a heretofore hypothetical class of genes -- ones that are directly regulated by the proneural proteins in PNCs/SOPs but are evidently not activated in response to N-mediated lateral inhibitory signaling, perhaps because they are not involved in the inhibitory process (Reeves, 2005).

The proneural genes were first identified by their function in the ectoderm in specifying neural cell fates, and they have been studied almost exclusively in that context in both vertebrates and invertebrates. However, it has become clear that these genes function as well in the other two germ layers. The Drosophila proneural gene lethal of scute (l'sc) is required to specify the fates of muscle progenitor cells in the embryonic mesoderm, and the same gene (and probably also sc) is required for the adult midgut precursor (AMP) cell fate in the embryonic endoderm. In both of these nonectodermal settings, a striking parallel with neurogenesis is seen in the manner in which proneural genes function in close association with the N pathway to select individual precursor cells. In the mesoderm, l'sc is deployed in 'pro-muscle clusters' from which single muscle progenitors emerge by N-mediated 'lateral inhibition'; in the endoderm, where proneural gene expression is initially uniform, AMPs are spaced apart from each other by N signaling in a manner very reminiscent of the spacing of microchaete bristles on the adult thorax. The mouse proneural protein Atoh1 (Math1) has been shown to be required for the specification of nonneural secretory cell precursors in the intestinal epithelium. Thus, proneural transcription factors are not dedicated specifiers of neural cell fates; rather, they appear to be very effective in first conferring on a group of cells the potential to adopt a particular cell fate and then promoting the selection of an individual committed progenitor from within that group. This suggests the existence of a 'core' set of genes that function downstream of the proneural proteins in all such contexts, with other sets of genes contributing to context-dependent (e.g., germ layer-specific) programs. Further investigation of the genes identified in this study should permit a test of this intriguing hypothesis (Reeves, 2005).

Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).

The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).

In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).

Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).

Specificity of Atonal and Scute bHLH factors: analysis of cognate E box binding sites and the influence of Senseless

The question of how proneural bHLH transcription factors recognize and regulate their target genes is still relatively poorly understood. It has been shown that Scute (Sc) and Atonal (Ato) target genes have different cognate E box motifs, suggesting that specific DNA interactions contribute to differences in their target gene specificity. This study shows that Sc and Ato proteins (in combination with Daughterless) can activate reporter gene expression via their cognate E boxes in a non-neuronal cell culture system, suggesting that the proteins have strong intrinsic abilities to recognize different E box motifs in the absence of specialized cofactors. Functional comparison of E boxes from several target genes and site-directed mutagenesis of E box motifs suggests that specificity and activity require further sequence elements flanking both sides of the previously identified E box motifs. Moreover, the proneural cofactor, Senseless, can augment the function of Sc and Ato on their cognate E boxes and therefore may contribute to proneural specificity (Powell, 2008).

The proneural proteins exhibit very precise specificity in activation of different neurogenesis programmes. It has been suggested that utilization of different E-box motifs as binding sites may partly underlie this specificity. This was based on the finding that E boxes from Sc- and Ato-specific target genes conform to different consensus motifs. This study found further support for observation. In a cell culture assay, artificial enhancers of concatemers of EAto or ESc sequences generally show specific activation by Ato or Sc proteins, respectively. Nevertheless, the results also show that E box activity and specificity depends on complex features of the DNA surrounding the proneural-specific motifs both in cell culture and in vivo. The task of predicting by sequence analysis how proneural proteins regulate targets remains formidable (Powell, 2008).

Transcription factor activity depends on a complex interplay of interactions with DNA and with other protein factors, including those bound to other sites within the enhancer. To concentrate on the role that proneural protein interaction with E-box binding sites plays in specificity, synthetic enhancers of concatemers of E-box-containing sequences were studied in a cell culture reporter gene assay. A previous study of Ato or Sc-specific enhancers relied on the analysis of expression patterns produced in transgenic flies carrying GFP reporter gene constructs. In that study, specific regulation by Sc or Ato was inferred indirectly from patterns of GFP expression. This study showed that much of this inferred specificity is also seen in a cell culture reporter gene assay, strongly supporting the conclusion that Ato and Sc directly use different E box motifs. Thus, in general, the specificity of E box response (ratio of response to Sc and Ato) could be predicted from matches to ESc or EAto motifs identified previously. In most cases, this specificity also corresponded to the specificity of the native enhancer from which the E box was taken. An interesting exception is sens-E1: while this E box is proposed to respond to both Ato and Sc in vivo, it responds slightly better to Sc than to Ato in culture, which is more consistent with its ESc motif. It will be important to determine what other enhancer features allow such an E box to function as a common target of Ato and Sc in vivo (Powell, 2008).

Importantly, E box specificity is achieved without the appropriate cellular and developmental context of neurogenesis: S2 cells are embryonic, non-neural cells of likely hematopoietic origin and are not expected to contain neural-specific factors. The results therefore indicate that proneural factors have intrinsic ability to use different E box motifs without the need for interactions with neural specific cofactors. The ESc and EAto motifs differ most notably in the bases immediately flanking the 5' end of the 6-bp core sequence (NG vs. AW). There is evidence from the crystal structure of the MyoD bHLH domain–DNA complex that protein contacts are made with bases in this position, suggesting that similar direct contacts may influence E box utilization by proneural proteins. The basic region amino acids making these contacts (R110, R117 and E118) are conserved in the proneural proteins, but in Ato the arginines are separated by three amino acids (LAA, equivalent to MyoD KAA) that are absent in Sc. Thus despite the apparent conservation of DNA-contacting residues, one might predict strong differences in how the proneural proteins interact with the flanking nucleotides. SPR analysis shows Ato/Da to bind to ato-E1 and sc-E1 with similar affinity. Rather than affecting E box affinity, it is possible that subtle differences in binding contacts may cause conformational effects that affect the transactivation ability of the proneural protein (Powell, 2008).

The above results point to the importance of distinct Ato and Sc E box motifs for proneural specificity. Several findings, however, demonstrate that these motifs are heavily dependent on the wider DNA context. For instance, the E(spl)mγ-E2(C4 > G), sens-E1 and sc-E1 binding sites show very large differences in activity in cell culture, even though they have identical perfect ESc motifs at their core (gCAGGTGt). The effect of DNA context is also seen in the general inability, in the cell culture assay, to swap the proneural specificities of sc-E1 and ato-E1 by mutating the immediate 5' flanking bases of the core E box. Such changes generally result in loss of E box activity rather than a clear change in specificity. These results indicate that the ESc and EAto motifs are generally not sufficient for activity or specificity in the cell culture assay and that the surrounding DNA context is important (even within the short 20-bp sequences used) (Powell, 2008).

Interestingly, in some circumstances specificity could be manipulated more successfully in vivo: (sc-E1 GG > AA)6-GFP transgenic flies showed GFP expression consistent with strongly reduced activation by Sc and a gain of activation in some specific locations by Ato. However, this mutated motif did not respond to ectopically expressed Ato, perhaps suggesting that improved specificity in vivo results from cofactors expressed in locations of endogenous Ato expression and function (Powell, 2008).

Overall, the results above show that further sequences on both flanks of the ESc and EAto box motifs are also important for specificity and activity. One possibility is that the 20-bp DNA sequences used to construct the concatemers may include flanking sequences that interact with other protein factors to influence proneural specificity. Such adjacent sites have been identified for some mouse proneural E box binding sites. Moreover, in its native enhancer, ato-E1 is adjacent to an Ets-domain transcription factor binding site (although this site is mutated in the constructs used in this study). However, such cofactors would need to be expressed in S2 cells. Moreover, although the flanking sequences of the ato-E1 and sc-E1 sites are strongly conserved among Drosophila species, no obvious shared sequence motifs were found in the 5' and 3' flanks of known Drosophila E boxes that might be cofactor binding sites. Whilst there is a potential POU factor binding sequence 5' of the ato-E1 site, no members of the Drosophila POU family appear to be expressed during early neurogenesis. Alternatively, the further flanking bases may influence bHLH heterodimer interaction either through direct contacts or through indirect conformational effects. It is interesting that 3' bases appear important as these may be predicted to affect Da interaction. It is notable that the Da homologue, E2A, has different half-site preferences when bound to Twi or MyoD (Powell, 2008).

The specificity of E-box concatemer constructs is generally more complete in vivo than in the S2 luciferase assay -- notably proneural proteins can generally activate non-cognate E boxes to some extent in cell culture but not in vivo. One possibility is that the intrinsic specificity of proneural proteins must normally be enhanced by interaction with cofactors that are not present in S2 cells. In the cell culture assay, at high proneural levels it was found that Sens enhanced proneural activity in a general manner. None of the constructs tested contain Sens binding motifs, so it is likely that enhancement occurs in a DNA-binding independent manner via protein–protein interactions. At low proneural concentrations, however, the effect of Sens enhancement becomes selective. For many of the constructs tested, Sens only enhanced the activity of proneural proteins for concatemers consisting of their cognate E box. It is suggested that proneural–Sens interaction may enhance the specificity of proneural–E box interaction. Thus, this is an interesting case in which proneural specificity can be influenced by a common cofactor, rather than requiring interaction with different subtype-specific cofactors. It remains to be determined whether Sens would enhance specificity on native enhancers as well as concatemer constructs. Moreover, it seems unlikely that Sens is a specificity factor for all proneural target genes. However, the results are consistent with Sens acting as a specificity cofactor in certain contexts -- such as the proneural autoregulatory enhancers active in SOPs where there are high levels of Sens and proneural proteins present. Other non-DNA binding proneural protein interactors, such as Chip may have a similar effect in other contexts (Powell, 2008).

The effect of Sens could be explained by two models. First, interaction of a proneural protein with a specific E-box motif may give rise to a specific conformation which results in an increased affinity for Sens protein. Alternatively, the Sens–proneural protein interaction may alter the proneural bHLH domain conformation thereby increasing its affinity for its cognate binding site (i.e., an induced fit model). Indeed, variation in MyoD bHLH protein DNA sequence preferences have been previously observed to be the result of effects on basic region conformation arising because of binding partner differences or amino acid composition of the basic region. In this view, proneural specificity relies on a combination of cognate DNA sequence recognition and protein–protein interactions. Important future work will be the identification of the amino acid residues of Ato and Sc necessary for their interaction with Sens and the determination of whether these influence DNA recognition (Powell, 2008).

Protein Interactions

Like achaete and lethal of scute, scute is active when complexed to Daughterless and inactive when complexed to Extramachrochaete. Scute forms dimers with maternally derived Daughterless in early blastoderm (Deshpande, 1995). In imaginal discs, emc loss-of-function alleles develop extra sensilla and a corresponding display of Scute protein in a large number of cells. These cells appear to arise from those that in the wild type already express Scute RNA. Therefore, EMC is a suppressor of Scute function whose action may take place post-transcriptionally (Cabrera, 1994).

The simultaneous reduction in the levels of Dorsal and any one of several helix-loop-helix (HLH) proteins results in severe disruptions in the formation of mesoderm and neuroectoderm. The area of twist and snail expression in the presumptive mesoderm is severely reduced in dl-da double heterozygotes. The same is true in dorsal ac-sc double heterozygotes. Certain triple heterozygous combinations essentially lack mesoderm as a result of a block in ventral furrow formation during gastrulation [Image]. HLH proteins that have been implicated previously in sex determination and neurogenesis (daughterless, achaete, and scute) are required for the formation of these embryonic tissues. Evidence suggests that DL-HLH interactions involve the direct physical association of these proteins in solution mediated by the rel and HLH domains (Gonzalez-Crespo, 1993).

The basic HLH domain of the proteins coded for by the Enhancer of split and achaete-scute complexes differ in their ability to form homo- and heterodimers. The bHLH domains of E(spl)C proteins m5, m7 and m8 interact with bHLH domains of the Achaete and scute Proteins. These bHLH domains form an interaction network which may represent the molecular mechanism whereby the competent state of proneural genes is maintained until the terminal determination to neuroblast identity occurs (Gigliani, 1996).

Neural fate specification in Drosophila is promoted by the products of the proneural genes, such as those of the achaete-scute complex, and is antagonized by the products of the Enhancer of split [E(spl)] complex, hairy, and extramacrochaetae. Since all these proteins bear a helix-loop-helix (HLH) dimerization domain, their potential pairwise interactions were investigated using the yeast two-hybrid system. The fidelity of the system was established by its ability to closely reproduce the already documented interactions among Daughterless, Achaete, Scute, and Extramacrochaetae. The seven E(spl) basic HLH proteins can form homo- and heterodimers inter-se with distinct preferences. A subset of E(spl) proteins (MB and M5) can heterodimerize with Da, another subset (M3) can heterodimerize with proneural proteins, and yet another (Mbeta, Mgamma and M7) with both, indicating specialization within the E(spl) family. Hairy displays no interactions with any of the HLH proteins tested. It does interact with the non-HLH protein Groucho, which itself interacts with all E(spl) basic HLH proteins, but with none of the proneural proteins or Da. An investigation was carried out of the structural requirements for some of these interactions, using site-specific and deletion mutagenesis. Deletion analysis of M3 and Scute is consistent with their interaction being mediated by their respective bHLH domains. The dependence of the E(spl)-activator HLH interactions on the HLH domain is nicely reflected in the fact that the functional grouping of the E(spl) proteins correlates well with the amino acid sequences of their bHLH domains, e.g., M5 and M8 have highly similar bHLH regions, different from those of the M7/Mbeta/ and Mgamma group, which also display high intragroup similarity. The strong interactions observed between E(spl) proteins and proneural proteins might lead one to hypothesize the E(spl) proteins act like Extramachrochaetae, i.e., by sequestering HLH activators. This is unlikely, since residual activities of E(spl) proteins with mutated basic domains have only weak residual activities (Alifragis, 1997).

Two modes of recruitment of E(spl) repressors onto target genes

The decision of ectodermal cells to adopt the sensory organ precursor fate in Drosophila is controlled by two classes of basic-helix-loop-helix transcription factors: the proneural Achaete (Ac) and Scute (Sc) activators promote neural fate, whereas the E(spl) repressors suppress it. E(spl) proteins m7 and mgamma are potent inhibitors of neural fate, even in the presence of excess Sc activity and even when their DNA-binding basic domain has been inactivated. Furthermore, these E(spl) proteins can efficiently repress target genes that lack cognate DNA binding sites, as long as these genes are bound by Ac/Sc activators. This activity of E(spl)m7 and mgamma correlates with their ability to interact with proneural activators, through which they are probably tethered on target enhancers. Analysis of reporter genes and sensory organ (bristle) patterns reveals that, in addition to this indirect recruitment of E(spl) onto enhancers via protein-protein interaction with bound Ac/Sc factors, direct DNA binding of target genes by E(spl) also takes place. Irrespective of whether E(spl) are recruited via direct DNA binding or interaction with proneural proteins, the co-repressor Groucho is always needed for target gene repression (Giagtzoglou, 2003).

E(spl) proteins interact selectively with proneural ones in a yeast two-hybrid assay; E(spl)m7 and mgamma interact with Ac, Sc and Da, whereas mdelta interacts with none. Tests with mutant E(spl) proteins indicate that some activity of E(spl) proteins other than their direct DNA binding ability is most important in target gene repression. In the light of these results, it is possible that the ability of E(spl) proteins to interact with activator bHLH proteins might underlie the ability of the former to repress target genes in the absence of direct DNA binding and enhance their potency in neural fate suppression. The question arises as to how interaction with proneural proteins might help realize this potent repressive activity: do E(spl) proteins sequester proneural activators off the target DNA or do they use the proneural complexes as tethers to bind to DNA? A way to approach the question of whether a repressor works on or off DNA uses a fusion of a strong transcriptional activation domain (VP16) to a repressor; this is tested for its ability to activate transcription, which can only happen if the VP16 domain is tethered to the DNA. If, however, the repressor works by sequestering activators off DNA, the VP16-tagged repressor should still be able to repress (rather than activate) target genes (Giagtzoglou, 2003).

A hybrid E(spl)m7VP16 protein was expressed in wing disks and its effect on EE4-lacZ was assayed. In both pnr-Gal4 and omb-Gal4 expression domains, strong activation of EE4-lacZ was observed, suggesting that E(spl)m7VP16 is somehow tethered to this artificial enhancer. Rather than being ubiquitous, activation by E(spl)m7VP16 was patterned in a way that strongly resembles the proneural pattern, suggesting that E(spl)m7VP16 is tethered to EE4-lacZ via proneural complexes. To demonstrate this, the same effector-reporter combination was assayed in both loss-of-function and gain-of-function backgrounds for proneural genes. sc10-1 is a null allele for both ac and sc, the only proneural proteins expressed in the wing disk. In sc10-1 wing disks, EE4-lacZ was not expressed and could not be activated by E(spl)m7VP16. In the converse experiment, ectopic Sc was supplied by co-expressing UAS-sc with UAS-m7VP16; in this case, the pattern of EE4-lacZ activation was broadened to encompass the whole expression domain and was not restricted to proneural clusters. It therefore appears that it is the availability and spatial distribution of proneural proteins that determines the pattern of activation of EE4-lacZ by E(spl)m7VP16. The simplest way to account for this finding is to propose that E(spl)m7VP16 is recruited onto DNA using the proneural complexes (and not some other DNA-bound factor) as tethers. This was confirmed by testing the ability of two other E(spl)VP16 variants: E(spl)mgammaVP16 and mdeltaVP16. Whereas the former behaves identically to E(spl)m7VP16, E(spl)mdeltaVP16 has no effect on EE4-lacZ expression. The inability of E(spl)mdeltaVP16 to become recruited onto EE4-lacZ is attributed to its inability to interact with the proneural protein-tethering factors (Giagtzoglou, 2003).

Enhancer-promoter communication mediated by Chip during Pannier-driven proneural patterning is regulated by Osa

The GATA factor Pannier activates proneural achaete/scute (ac/sc) expression during development of the sensory organs of Drosophila through enhancer binding. Chip bridges Pannier with the (Ac/Sc)-Daughterless heterodimers bound to the promoter and facilitates the enhancer-promoter communication required for proneural development. This communication is regulated by Osa, which is recruited by Pannier and Chip. Osa belongs to Brahma chromatin remodeling complexes, and this study shows that Osa negatively regulates ac/sc. Consequently, Pannier and Chip also play an essential role during repression of proneural gene expression. This study suggests that altering chromatin structure is essential for regulation of enhancer-promoter communication (Heitzler, 2003).

ChipE is a viable allele of Chip that is associated with a point mutation in the LIM-interacting domain (LID), which specifically reduces interaction with the bHLH proteins Ac, Sc, and Da. As a consequence, the ChipE mutation disrupts the functioning of the proneural complex encompassing Chip, Pnr, Ac/Sc, and Da. A homozygous ChipE mutant shows thoracic cleft and loss of the DC bristles, similar to loss of function pnr alleles (Heitzler, 2003).

To identify new factors that regulate this proneural complex, a screen was performed for second-site modifiers of the ChipE phenotypes. One allele of osa (osaE17) was found among the putative mutants. OsaE17 corresponds to a loss-of-function allele, and homozygous embryos die with normal cuticle patterning. Both osaE17 and null alleles of osa (osa616 or osa14060) enhance the cleft but suppress the loss of DC bristle phenotypes of ChipE flies. Indeed, ChipE flies with only one copy of osa+ (ChipE;osa616/+) are weak and sterile but show wild-type DC bristle pattern (Heitzler, 2003).

These genetic interactions suggest that Osa can antagonize the function of Pnr. Moreover, overexpressed Osa (+/UAS-osa;Gal4-pnrMD237/+) induces a thoracic cleft and the loss of DC bristles similar to the loss-of-function pnr alleles. In contrast, loss-of-function osa alleles display an excess of DC bristles similar to overexpressed Pnr. For example, (osa14060/+), (osa616/+), and (osaE17/+) flies exhibit respectively 2.35 ± 0.12, 2.38 ± 0.12, and 2.43 ± 0.17 DC bristles per heminotum (Oregon wild-type flies have 2.00 DC bristles/heminotum). Furthermore, transallelic combination of osa14060 with the hypomorphic osa4H (osa4H/osa14060) accentuates the excess of DC bristles compared with (osa14060/+). (osa4H/osa14060) flies display 4.17 ± 0.19 DC bristles per heminotum. In contrast, (osa4H/osa4H) flies display 2.50 ± 0.11 DC bristles per hemithorax. The development of the extra DC bristles revealed by phenotypic analysis was compared with the positions of the DC bristle precursors detected with a LacZ insert, A101, in the neuralized gene that exhibits staining in all sensory organs. In (osa14060/osa4H) discs, additional DC precursors are observed that lead to the excess of DC bristles. The pnrD alleles encode Pnr proteins carrying a single amino acid substitution in the DNA binding domain that disrupts interaction with the U-shaped (Ush) antagonist. Consequently, PnrD constitutively activates ac/sc, leading to an excess of DC bristles. This excess is accentuated when osa function is simultaneously reduced (pnrD1/osa616) (Heitzler, 2003).

Since osa shows genetic interactions with trithorax group genes encoding components of the Brm complex like moira (mor) and brm, whether mutations in mor and brm suppress the ChipE phenotype was investigated. Loss of one copy of brm+ in (ChipE; brm2/+) flies suppresses the lack of DC bristles observed in ChipE flies, similar to loss of one copy of osa+. This shows that brm and osa both act during Pnr-dependent patterning, in agreement with the fact that they have been shown to be associated in the Brm complex. In contrast, reducing the amount of Mor by half [(ChipE;mor1/+) flies] is not sufficient to modify the ChipE phenotype. This does not definitely exclude the possibility that mor is directly or indirectly involved, via the Brm complex, in Pnr-dependent patterning (Heitzler, 2003).

The complete osa open reading frame of 2715 amino acids and the intronic splicing signals were PCR amplified from genomic DNA prepared from homozygous embryos (osaE17 and osa14060) and homozygous first instar larvae (osa4H). For osa14060 and osa4H, the sequence analysis revealed a single mutation in the N terminus that causes a glutamine to stop codon substitution. The conceptual translation of osa14060 leads to a truncated Osa protein lacking both functional domains, whereas Osa4H retains the ARID domain but lacks the C-terminal EHD. Wild-type osa function is necessary for patterning of the DC bristles. Although osaE17 behaves as a stronger allele than osa14060 and osa4H, molecular identity of the mutation is unknown. Hence, the osaE17 phenotype may result from a mutation in regulatory sequences that affects osa expression (Heitzler, 2003).

It has been shown that a complex containing Pnr, Chip, and the (Ac/Sc)-Da heterodimer activates proneural expression in the DC proneural cluster and promotes development of the DC macrochaetae. Osa and Pnr/Chip have antagonistic activities during development because loss of osa function (osa4H and osa14060) displays additional DC bristles. However, since the current study reveals that osa genetically interacts with pnr and Chip, it was asked whether Osa physically interacts with the Pnr and Chip proteins. Immunoprecipitations of protein extracts made from Cos cells cotransfected with expression vectors for tagged Osa and either Pnr or tagged Chip were immunoprecipitated. Because Osa is a large protein, several expression vectors encoding contiguous domains of Osa were used. Osa coimmunoprecipitates with Pnr and Chip and can be detected on Western blots with appropriate antibodies. The interactions appear to require the overlapping domains Osa E (His1733/Glu2550) and Osa F (Ala2339/Ala2715) corresponding to the EHD. Enhancer-promoter communication during proneural activation and development of the DC bristles requires regulatory sequences scattered over large distances and appears to be negatively regulated by interaction of Pnr and Chip with Osa through the EHD. Interestingly, the EHD is not conserved in yeast. In yeast, the UAS sequences are generally close to the promoter and there is no requirement for long-distance interactions. This observation could support the idea that the EHD is essential for long-distance enhancer-promoter communication. Alternatively, yeast may just lack proteins like Chip or Pnr (Heitzler, 2003).

The DNA-binding domain and the C-terminal region are essential for the function of Pnr during development of the DC sensory organs. The pnrVX1 and pnrVX4 alleles (collectively pnrVX1/4) are characterized by frameshift deletions that remove two C-terminal alpha-helices and result in reduced proneural expression and loss of DC bristles (Heitzler, 2003).

The molecular interactions between Osa and PnrD1 and between Osa and PnrVX1 were investigated. PnrD1 protein interacts with the EHD as efficiently as wild-type Pnr. In contrast, the physical interaction is disrupted when the C terminus of Pnr encompassing the alpha-helices is removed. Because the C terminus of Pnr is required for the Pnr-Osa interaction in transfected cells extracts, the abilities of in vitro translated 35S-labeled Osa domains to bind to GST-CTPnr attached to glutathione-bearing beads were investigated. Only Osa E and Osa F interact with the C terminus of Pnr. The interaction between Chip and Osa was examined, and it was found that Osa associates with the N-terminal homodimerization domain of Chip; Osa was found to be required for the interaction between Chip and Pnr. Furthermore, Osa E and Osa F also bind to immobilized GST-Chip. Deletion of the alpha helix H1 disrupts the interactions between Pnr and Osa. Interestingly, the same deletion also disrupts the interaction with Chip. Therefore, the functional antagonism between Chip and Osa during neural development may result from a competition between these proteins for association with Pnr. Alternatively, the deletion of H1 may affect the overall structure of the C terminus of Pnr and disrupt the physical interactions with Chip and Osa. To discriminate between these hypotheses, immunoprecipitations of protein extracts containing a constant amount of Pnr, a constant amount of the tagged Osa E domain, and increasing concentrations of Chip were performed. Pnr immunoprecipitates with immunoprecipitated tagged Osa E and the amount of Pnr immunoprecipitated increases in the presence of increasing concentrations of Chip. The presence of increasing amounts of Chip does not inhibit the Osa-Pnr interaction as would be expected if Osa and Chip were to compete for binding to Pnr. In contrast, it suggests that Chip and Pnr act together to recruit Osa and to target its activity and possibly the activity of the Brm complex to the ac/sc promoter sequences (Heitzler, 2003).

Using expression vectors encoding contiguous domains of Osa, it was shown that the EHD of Osa mediates interactions with Pnr and Chip. Because the EHD is lacking in the truncated Osa14060 and Osa4H, it is hypothesized that the loss of interaction with Pnr and Chip are responsible for the excess of DC bristles observed in osa4H and osa14060 (Heitzler, 2003).

To investigate whether these interactions between Osa, Pnr, and Chip function in vivo during DC bristle development, the effects of both loss of function and overexpression of osa were examined on the activity of a LacZ reporter whose expression is driven by a minimal promoter sequence of ac fused to the DC enhancer (transgenic line DC:ac-LacZ). It was found that expression of the LacZ transgene is increased in osa14060/osa4H wing discs when compared with the wild-type control. For overexpression experiments, the UAS/GAL4 system was used, using as a driver the pnrMD237 strain that carries a GAL4-containing transposon inserted in the pnr locus (driver: pnr-Gal4). This insert gives an expression pattern of Gal4 indistinguishable from that of pnr. It was found that overexpressed Osa leads to a strong reduction of LacZ staining in the DC area, consistent with the lack of DC bristles. Thus, overexpressed Osa represses activity of the ac promoter sequences required for DC ac/sc expression and development of the DC bristles. It has been previously reported that wingless expression is also required for patterning of the DC bristles. However, the repressing effect of Osa on development of the DC bristles is unlikely to be the result of an effect of Osa on wingless expression because overexpressed Osa driven by pnrMD237 has no effect on the expression of a LacZ reporter inserted into the wingless locus. Thus, Osa acts through the DC enhancer of the ac/sc promoter sequences to repress ac/sc and neural development (Heitzler, 2003).

ChipE disrupts the enhancer-promoter communication and strongly affects expression of the LacZ reporter driven by the ac promoter linked to the DC enhancer. Because null alleles of osa suppress the loss of DC bristles displayed by ChipE, the consequences of reducing the dosage of osa was examined in ChipE flies. The expression of the LacZ reporter is not affected in ChipE flies when Osa concentration is simultaneously reduced (Heitzler, 2003).

In conclusion, Pnr function during proneural patterning is regulated by interaction with several transcription factors. Pnr function is negatively regulated by Ush, which interacts with its DNA-binding domain. Chip associates with the C terminus of Pnr, bridging Pnr at the DC enhancer with the AC/Sc-Da heterodimers bound at the proneural promoters, thus activating proneural gene expression. The current study reveals that Pnr function can also be regulated by interaction with Osa. Thus, Osa activity is specifically targeted to ac/sc promoter sequences and the binding of Osa therefore has a negative effect on Pnr function, leading to reduced expression of the proneural ac/sc genes. Osa belongs to Brm complexes, which are believed to play an essential role during chromatin remodeling necessary for gene expression. For example, in vitro transcription experiments with nucleosome assembled human beta-globin promoters have shown that the BRG1 and BAF155 subunits of the mammalian SWI/SNF homolog are essential to target chromatin remodeling and promote transcription initiation mediated by GATA-1. In contrast to what was observed in vitro, the current results suggest that in vivo the SWI/SNF complexes can also act to remodel chromatin in a way that represses transcription. Alternatively, the observed repression of proneural genes may simply define a novel function of Osa, independent of chromatin remodeling (Heitzler, 2003).

Role of the Scute C terminus in transcriptional activation and E(spl) repressor recruitment

Neurogenesis in all animals is triggered by the activity of a group of basic helix-loop-helix transcription factors, the proneural proteins, whose expression endows ectodermal regions with neural potential. The eventual commitment to a neural precursor fate involves the interplay of these proneural transcriptional activators with a number of other transcription factors that fine tune transcriptional responses at target genes. Most prominent among the factors antagonizing proneural protein activity are the HES basic helix-loop-helix proteins. Two HES proteins of Drosophila, E(spl)m gamma and E(spl)m7, interact with the proneural protein Sc and thereby get recruited onto Sc target genes to repress transcription. Using in vivo and in vitro assays an important dual role has been discovered for the Sc C-terminal domain: (1) it acts as a transcription activation domain, and (2) it is used to recruit E(spl) proteins. In vivo, the Sc C-terminal domain is required for E(spl) recruitment in an enhancer context-dependent fashion, suggesting that in some enhancers alternative interaction surfaces can be used to recruit E(spl) proteins (Giagtzoglou, 2005).

The fact that proneural and E(spl) bHLH proteins have mutually antagonistic activities has long been accepted. This study describes a molecular basis for this antagonism of the Sc-E(spl)m7 pair, which relies on the ability of the latter to interact and inhibit the activity of the TAD of the former. Sc and E(spl)m7 were dissected and in the process the following were identified: (1) the TAD of Sc, which resides in its 25 C-terminal amino acids; (2) the E(spl)m7 interaction domain of Sc, which is identical to or overlaps with the Sc TAD, and (3) the Sc interaction domain of E(spl)m7, which is contained within the N-terminal 80 amino acids. Three more of the seven E(spl) proteins, E(spl)mgamma., E(spl)mbeta, and E(spl)m3, share the ability E(spl)m7 to inhibit the Sc TAD, consistent with an increased structural similarity among these four E(spl) proteins (Giagtzoglou, 2005).

To address a possible in vivo role for this interaction between Sc and E(spl) proteins, several points have to be taken into consideration. Natural enhancers recruit a number of transcription factors and co-factors to assemble an enhanceosome, which regulates transcription initiation. For example, Da-Sc target enhancers may variably contain additional activators, such as a putative NFkappaB-like alpha-factor, Sens, or Sis-a. While affording robustness in gene regulation, the multifactorial nature of the enhanceosome and its ability to assemble itself using multiple alternative macromolecular interactions may cause frustration to the researcher trying to dissect out the function of individual components. Artificial enhancers, in contrast, can reveal functions of individual domains, because they rely on a small number of transcription factors because of the very simplicity of their design. Using the artificial enhancers UAS-tk-luc and EE4-lacZ, it was shown that the Sc C terminus is necessary for both transcriptional activation and recruitment of E(spl) proteins. Already, when assayed on a more complex natural enhancer, ac-lacZ, the role of the Sc C terminus starts becoming blurry. Equally good activation and E(spl)m7KNEQ-VP16 recruitment appears to take place whether the Sc C terminus is present or not. This is attributed to the presence of alternative TADs and alternative contact surfaces that are able to recruit E(spl)m7 onto this enhanceosome but not onto the simpler EE4-lacZ. Other than Sc, transcription factors that have been reported in the literature to interact with E(spl)m7 are Da and Sens. Although the presence of Da (predicted to bind on EE4-lacZ) can only weakly sustain transcription and E(spl)m7 recruitment in the absence of Sc TAD, the presence of Sens or some other yet-to-be-identified E(spl) interaction surface on the ac-lacZ appears to render the Sc TAD dispensable in some assays. It is noteworthy that E(spl) uses different domains to contact Sc (the N-terminal region) versus Sens (the middle Orange region). The existence of more than one protein-protein interaction domain on any given factor is likely to be advantageous in complex formation. Establishing contacts via both the N terminus and the Orange domain would likely result in cooperative recruitment, allowing an E(spl) protein to repress a Sc+Sens-containing enhanceosome more effectively. Further functional characterization of the E(spl) proteins will determine the relative contribution of each documented (or yet-to-be documented) protein-protein interaction, as well as of direct DNA binding, to recruitment onto target genes (Giagtzoglou, 2005).

The C terminus of Sc is conserved in other Sc family proneural proteins in Drosophila (Ac and L'sc), as well as homologues from other phyla,which in itself argues for some important function. Its role had been overlooked so far; in fact an earlier report had proposed that it is dispensable for the proneural activity of Lethal of Scute (L'sc). In that work, a transgene essentially consisting of only the bHLH domain of L'sc (l'scDelta) was able to promote ectopic sensory organ (bristle) production, only slightly more weakly than full-length L'sc. Because that transgene was not tested against specific reporter genes such as the ones used in this study, caution is required in drawing conclusions about the function of the L'sc C terminus for the reasons described above. Namely, bristle production is the outcome of the activation of a (still ill-defined) number of Sc (L'sc) target genes driven by complex enhancers and multiple factors, the presence of which might compensate for the lack of the L'sc C-terminal domain. So, in a transgenic assay, the presence of the Sc (or L'sc) TAD may be dispensable, whereas its bHLH domain is sufficient to recruit Da to the bristle-promoting target genes to nucleate the assembly of complex enhanceosomes. Indeed the behavior of C-terminally truncated transgenes sc1-260 and sc1-290 is entirely consistent with that of l'scDeltaNDeltaC. Adult flies expressing the UAS-sc transgene have approximately the same number of ectopic bristles as those expressing UAS-sc1-260 or UAS-sc1-290. These very same genotypes, however, display a dramatic difference in the activation of the EE4-lacZ reporter (Giagtzoglou, 2005).

Does phylogenetic conservation of the C terminus imply that both functions, TAD and HES repressor recruitment, have also been conserved? Preliminary data suggest that at least the TAD function has been conserved in Mash1. Additionally, some evidence exists in the literature, consistent with protein interaction-mediated antagonism between Mash1 and HES1. Mash1 promotes and HES1 inhibits neuronal differentiation of rat hippocampal neural precursors in culture. Importantly, transfection of Mash1 together with HES1 also inhibits neuronal differentiation, suggesting that HES1 antagonizes Mash1 post-translationally. In a reporter assay, this ability of HES1 to antagonize Mash1 was retained by a basic region mutant of HES1. This would be consistent with HES1 interacting with the TAD of Mash1 to block its activity, independently of the ability of HES1 to bind DNA. Further dissection of these and related vertebrate bHLH proteins will reveal the extent to which the present documented mechanism has been conserved through evolution (Giagtzoglou, 2005).

Another interesting question raised by this work regards the remaining proneural proteins. The second subclass of proneural proteins, the Ato/Ngn subclass, is equally important in neural precursor commitment but has a bHLH domain different from that of the achaete-scute proteins and, most importantly for the present discussion, lacks the conserved C-terminal TAD. In fact the TADs of Ato/Ngn proteins remain to be identified. It will be interesting to determine whether the Ato/Ngn TADs have also evolved to be inhibited by HES proteins. Preliminary analysis has shown that Ato can interact with two E(spl) proteins in yeast two-hybrid, so an analogous mechanism for this proneural subclass is conceivable (Giagtzoglou, 2005).


scute: Biological Overview | Evolutionary Homologs | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.