FMFRamide
LacZ reporter gene constructs were used to study the promoter/enhancer regions of the Drosophila FMRFamide neuropeptide gene
in germ line transformants. FMRFamide is normally expressed in approximately 60 diverse neurons of the larval CNS that represent
approximately 15 distinct cell types. An 8 kb FMRFamide DNA fragment (including 5 kb of 5' upstream sequence) was sufficient to
direct a pattern of lacZ expression that mimicked nearly all spatial aspects of the normal pattern. This result indicates that the
cell-specific regulation of FMRFamide expression is largely generated by transcriptional mechanisms. Reporter gene expression is
lost from selected cell types when smaller fragments are tested, suggesting that multiple control regions are included in the
FMRFamide promoter. One region (a 300 bp fragment from -476 to -162) acts as an enhancer for the the OL2 neuron, one of the approximately 15
FMRFamide-positive cell types. These results suggest that, in the mature nervous system, the complex pattern of
FMRFamide neuropeptide gene expression derives from the activity of discrete, cell type-specific enhancers that are independently
regulated (Schneider, 1993b).
In the ventral ganglion, apterous is expressed in up to ten of the
~350 neurons in each hemi-segment. In each of six thoracic hemisegments and in the third
subesophageal hemisegments, the ap neurons include a
ventrolateral cluster of four or five cells. Double-labeling
with antiserum to the FMRFalpha propeptide shows that
one of the neurons in each cluster is the Tv neuron, a neuron committed to neuropeptide production. Double-labeled Tv neurons shows cytoplasmic
FMRFalpha immunoreactivity and nuclear beta-galactosidase
immunoreactivity, marking cells expressing Gal4 under the direction of an apterous promoter. The ap gene is also expressed in
several brain cells, one of which is the FMRFalpha-positive SP2
neuron. Other larval brain FMRFalpha neurons, such as
the neighboring SP1 neuron, do not express ap. The
restriction of ap and FMRFalpha co-expression to the Tv and SP2
neurons is constant throughout mature larval stages; in the
adult, additional neurons begin to express dFMRFalpha, and some of these, including the Tva and several
subesophageal neurons, also express ap (Benveniste, 1998).
Tv neurons first stain with antibodies to the
tetrapeptide FMRFalpha during stage 17.
FMRFalpha gene expression was measured using reporter expression driven be a
446 bp Tv neuron-specific enhancer sequence
located within the first kB of FMRFalpha 5'
flanking region. Ap is required for
normal initiation of neuropeptide expression by
the Tv neurons. Apterous is shown not to be required for the survival or
morphological differentiation of the Tv
neuron cluster. Apterous contributes to the initiation of
FMRFalpha expression in Tv neurons, but not in those
FMRFalpha neurons that do not express Apterous. Apterous
is not required for Tv neuron survival or morphological
differentiation. Apterous contributes to the maintenance
of FMRFalpha expression by postembryonic Tv neurons,
although the strength of its regulation is diminished.
Apterous regulation of FMRFalpha expression includes
direct mechanisms, although ectopic Apterous does not
induce ectopic FMRFalpha. These findings show that, for a
subset of neurons that share a common neurotransmitter
phenotype, the Apterous LIM homeoprotein helps define
neurotransmitter expression with very limited effects on
other aspects of differentiation (Benveniste, 1998).
The hypothesis that Ap regulates FMRFalpha in the Tv
neurons directly was tested by seeking potential Ap-binding sites within
the dFMRFa gene regulatory sequences. The search was confined
to the 446 bp Tv neuron-specific enhancer, which is highly
responsive to Ap levels and located in the 5' flanking
region. The 446 bp enhancer contains three sequences
corresponding to the six-nucleotide consensus binding site for
homeodomain proteins. All three of these sequences are shared between the
homologous regions of the FMRFalpha genes of two Drosophila
species: D. melanogaster and D. virilis. Electrophoretic mobility shift assays (EMSA) were used
to test the ability of Ap protein to bind in vitro to these three
sequences, as represented by three different 25 bp
oligonucleotide probes. Recombinant Ap homeodomain binds
all three oligonucleotide probes with different affinities, and at stoichiometries comparable to
those observed for other LIM homeoproteins binding in vitro. Ap binding
to these probes in vitro is sequence-specific: mutant
oligonucleotide probes, with clusters of 6-point mutations
replacing the TAATNN sequences do not bind Ap in these
assays.
It was then asked whether these Ap-binding sequences are
functionally important in vivo. Two mutant Tv-lacZ
constructs were used incorporating the same clustered point
mutations in the Ap-binding sequences used in the EMSA. In
first instar larvae, a construct containing mutations in Ap-binding
site C [(mC)Tv-lacZ ] shows slightly decreased
activity in Tv neurons and in ectopic cells relative to the wild-type
enhancer. Construct (mABC)Tv-lacZ, which
includes mutations in all three Ap-binding sequences, shows
no detectable activity in Tv neurons or ectopic cells.
These results show that at least two of the three elements within
the Tv neuron-specific enhancer that bind Ap in vitro are
critical for proper enhancer activity in vivo (Benveniste, 1998).
It is found that ap is expressed in more than 100 neurons in the
larval CNS, but that FMRFalpha is expressed in only eight of
these. Therefore, co-factors must be required to activate
FMRFalpha transcription in the Tv neurons or to repress FMRFalpha
transcription in other neurons that express Ap. Two lines of
evidence suggest that positively acting co-factors are required
for FMRFalpha gene activation by Ap. (1) Widespread ectopic
expression of Ap (ubiquitously or throughout the CNS) does not
induce ectopic FMRFalpha expression. (2) Ap expression in
embryonic Tv neurons begins soon after the birth of the cell and precedes dFMRFa expression by
at least 3-6 hours (Benveniste, 1998 and references).
To learn about construction of the Drosophila adult nervous system, the differentiation of imaginal neurons in the
Drosophila visual system has been studied. OL2-A and OL3 are tangential neurons that display dFMRFa neuropeptide gene expression in
adults but not in larvae. The two large OL2-A neurons are generated near the end of the embryonic period and already show
morphological differentiation at the start of metamorphosis. The numerous small OL3 neurons are generated postembryonically
and first detected later in metamorphosis. The onset of dFMRFa transcription coincides with that of neuropeptide
accumulation in OL2-A neurons, but it precedes peptide accumulation in the OL3 neurons by days. Altering each of the five
conserved sequences within the minimal 256-bp OL dFMRFa enhancer affects in vivo OL transcriptional activity in two
cases: alteration of a TAAT element greatly diminishes OL2-A/OL3 reporter activity; alteration of a 9-bp tandem repeat completely abolished such activity.
A 46-bp concatamer containing the TAAT element, tested separately, is not active in OL neurons. Because canonical ecdysteroid binding sites within the
dFMRFa regulatory regions are not found,
it is suspected that the putative ecdysteroid regulation of
dFMRFa gene expression is indirect.
A model of neuronal differentiation at metamorphosis is proposed that features developmental differences between
classes of imaginal neurons (Taghert, 2000).
The neurons described in this report are generically called
OL because of their proximity to the optic lobes. They lie
on the anterior adult brain surface, at the lateral border of
the central brain. Along the dorsal to ventral aspect
of this region, several neurons display immunostaining
with antibodies to the molluscan tetrapeptide FMRFa. Only
a subset of these neurons express the dFMRFa gene. The remaining
FMRFa-immunoreactive cells express structurally related
peptides derived from unrelated genes. Among the many
FMRFa-positive OL neurons, dFMRFa OL neurons include
three cell types: 2 large cells called OL2-A, a moderately
sized cell called OL1-A, and two packets of small neurons
(~50 neurons per packet) collectively called OL3.
This assignment is based on double-staining experiments
with dFMRFa-lacZ reporter lines and
with use of antibodies specific for the dFMRF precursor. All OL neurons are
adult-specific with respect to FMRFa expression (i.e., not
seen in feeding stage larvae). All differentiation markers
currently available that permit identification of OL2-A and
OL3 fail to identify OL neurons during prior larval stages (Taghert, 2000).
The morphology of OL2-A cells corresponds
in many ways to the FMRFa-positive, MeRF1 amacrine
neurons of the visual system in the blowfly Musca. Both are tangential neurons that
ramify along the axis perpendicular to that of retinotopic
projections. In Drosophila,
OL2-A axons ramify broadly within the most proximal two
or three layers of the medulla. They do not
send recurrent projections into the central brain. The
smaller OL3 neurons appear to follow the direction of the
OL2-A neurons and produce a similar terminal field. The
morphology of a single OL2-A or a single OL3 neuron could
not be determined from these preparations.
Immunostaining for the CT epitope of pro-dFMRF and for promoter fragment
pWF22-6 beta-gal marked overlapping terminal fields. However,
the reporter-stained terminal fields are wider and
more distal. Because the pro-dFMRF antibody
primarily stains OL2-A and not OL3 neuronal processes
(due to weaker OL3 pro-dFMRF expression), the difference
suggested that OL3 neurons produce a wider terminal field
than do OL2-A or that other beta-gal-immunostained cells of
the optic lobes are contributing to the width of the
reporter-stained terminal field. Support for the first explanation
comes from examination of pWFM22-12A1 animals. This is the only line to show beta-gal expression
in OL3 and not in OL2-A neurons: here OL3 processes
could be traced to the medulla, independent of OL2-A
processes. Counterstaining with the pro-dFMRF antibodies
(to visualize OL2-A processes) reveals OL3 projections
occupying a domain that is slightly wider and more distal
than OL2-A processes. Four to five large beta-PDH-expressing
neurons have cell body positions in the same
location as dFMRFa OL2-A/OL3 neurons and similarly
extend centrifugal axons that form tangential terminal
fields. They are called large LNv (lateral neuron-ventral)
and are candidate pacemakers regulating circadian behaviors. LNv neurons are distinct
from all dFMRFa OL cells. The terminal
fields of LNv neurons do not overlap those of OL2-A and
OL3 neurons: the beta-PDH axon terminals occupy more
distal layers of the medulla (Taghert, 2000).
Observations on the mechanisms of dFMRFa transcription
in OL neurons suggest that the activity of the OL
minimal enhancer depends on several sequences distributed
throughout its 256-bp length that each make different
quantitative contributions. A minority of sites, indicated by
their evolutionary conservation and mutagenesis phenotypes
(i.e., domains B and C), make large contributions. The
sequences of domains B and C suggest specific classes of
candidate binding proteins (Taghert, 2000).
Domain B: a TAATNN element. Domain B contains a
TAATNN sequence that suggests the involvement of
homeodomain-containing proteins. A
similar conclusion has been reached in the case of a separate cell
type-specific enhancer within the dFMRFa gene. The ~500-bp enhancer controlling
transcription in the Tv neuroendocrine neuron contains
three conserved TAATNN sequences, regulated in part by
the LIM homeodomain protein Apterous. Apterous does not
bind the TAATNN site of OL domain B in vitro. These findings highlight the
importance and specificity of TAATNN-binding proteins in
the operation of neuronal cell type-specific enhancers.
Their contributions are required in each case from the
dFMRFa gene (Tv neurons and OL neurons), because the phenotypes
resulting from alterations of single TAATNN sites
produce measurable losses of activity in vivo in both
instances. It is noteworthy that a construct containing
multiple tandem copies of a region that includes domain
B is not effective
in substituting for the entire minimal OL enhancer (Taghert, 2000).
Domain C: TGAC repeats. The similarity of these cis
sequences to AP1 binding sites is strong, but not absolute (6
of 8 bases). In some contexts, AP1 activity is negatively
regulated by retinoid signaling. This
observation suggests a simple hypothesis to explain the
normal metamorphic delay in OL development, whereby
juvenile hormone (JH) is a negative regulator. JH displays
weak retinoid-like biological activity and
could delay OL cell differentiation in premetamorphic
stages by negatively regulating the proteins that bind to
domain C in the OL2 enhancer (Taghert, 2000).
To what extent do these mechanisms apply to regulation
of neuropeptide genes at similar developmental periods in
other imaginal neurons? The Drosophila pdf gene is expressed by neighboring tangential neurons that also differentiate at metamorphosis. Inspection of the upstream region of pdf
reveals a 13-bp perfect direct repeat that includes TGAC
sequences: CCTGCGGATGACATGTATTGGTCCTGCGGATGACA
(direct repeat shown in bold; the first bp is No.
106490 of record AC005813, Berkeley Drosophila Genome
Project). The pdf sequences differ from dFMRFa domain C
in several details: precise repeat sequence; repeat length;
number of bases separating the repeats. Based on these
shared and dissimilar features, it is speculated that a set of
related transcription factors, interacting with domain
C-type repeats, are critical regulators of terminal differentiation
in diverse imaginal neurons (Taghert, 2000).
It has been shown that imaginal neurons differentiate according
to schedules that are highly correlated with changes in
the steroid signals that instigate metamorphosis. Surprisingly,
neurons that otherwise share many cellular properties
(OL2-A and OL3) follow remarkably different schedules.
The principal difference is the lag of many hours
between neuropeptide gene expression and neuropeptide
expression by imaginal (OL3) neurons. The highly similar
OL2-A neurons, which are born much earlier in development,
acquire adult characters in much more rapid fashion.
The descriptive terms 'transcriptional competence'
and 'imaginal inhibition' have been used to indicate two events
hypothesized to have substantial developmental significance
in this context. It is proposed that these events
define much of the rate and pattern underlying the differentiation
of these adult neurons. A better understanding
of transcriptional competence will follow the
identification of regulatory factors that act on domains B
and C of the OL minimal enhancer. A better understanding
of imaginal inhibition will require a molecular definition of
the point at which neuropeptide expression is blocked in
OL3 neurons. It will then be possible to ask when that
block is relieved and what developmental factors regulate
its effects (Taghert, 2000).
LIM-homeodomain transcription factors are expressed in
subsets of neurons and are required for correct axon
guidance and neurotransmitter identity. The LIM-homeodomain
family member Apterous requires the
LIM-binding protein Chip to execute patterned outgrowth
of the Drosophila wing. To determine whether Chip is a
general cofactor for diverse LIM-homeodomain functions
in vivo, its role in the embryonic nervous
system was studied. Loss-of-function Chip mutations cause defects in
neurotransmitter production that mimic apterous and islet
mutants. Chip is also required cell-autonomously by
Apterous-expressing neurons for proper axon guidance,
and requires both a homodimerization domain and a LIM
interaction domain to function appropriately. Using a
Chip/Apterous chimeric molecule lacking domains
normally required for their interaction,
the complex was reconstituted and the axon guidance defects of
apterous mutants, of Chip mutants and of embryos doubly
mutant for both apterous and Chip were rescued. These results indicate
that Chip participates in a range of developmental
programs controlled by LIM-homeodomain proteins and
that a tetrameric complex comprising two Apterous
molecules bridged by a Chip homodimer is the functional
unit through which Apterous acts during neuronal
differentiation (van Meyel, 2000).
If Chip were required for Ap function, elimination of Chip
might be expected to result in an ap-like phenotype. The
requirement of maternally supplied Chip in segmentation precluded an examination of the effects
of eliminating both maternal and zygotic Chip on neuronal
development. Thus, neurotransmitter expression
and axon guidance were examined in Chip mutants in which half of the
maternal and all of the zygotic Chip expression were absent.
In each thoracic hemisegment of the VNC, ap is expressed
in a lateral cluster of four neurons, one of which is the Tv
neuroendocrine cell that expresses the neurotransmitter
dFMRFa. In wild-type embryos, there
are a total of six Tv cells, one in each thoracic hemisegment.
In ap mutants, the Tv neurons are present, but half of all Tv
neurons stochastically fail to express dFMRFa. This regulation of dFMRFa by ap is transcriptional,
since expression of a fusion transgene comprising a 446 bp Tv
neuron-specific enhancer of the dFMRFa gene driving beta-galactosidase
(Tv-lacZ) is similarly reduced in ap
mutants. Ap binds in vitro to each of three sequences within
the enhancer, and mutagenesis of these sites has confirmed that
these sequences are important for Tv-lacZ expression in vivo (van Meyel, 2000).
Individual neurons express only one or a few of the many identified neurotransmitters and neuropeptides, but the molecular mechanisms controlling their selection are poorly understood. In the Drosophila ventral nerve cord (VNC), the six Tv neurons express the neuropeptide gene FMRFamide (FMRFa). Each Tv neuron resides within a neuronal cell group specified by the LIM-homeodomain (LIM-HD) gene apterous (ap). The zinc-finger gene squeeze acts in Tv cells to promote their unique axon pathfinding to a peripheral target. There, the BMP ligand Glass bottom boat activates the Wishful thinking receptor, initiating a retrograde BMP signal in the Tv neuron. This signal acts together with apterous and squeeze to activate FMRFamide expression. Reconstituting this 'code,' by combined BMP activation and apterous/squeeze misexpression, triggers ectopic FMRFamide expression in peptidergic neurons. Thus, an intrinsic transcription factor code integrates with an extrinsic retrograde signal to select a specific neuropeptide identity within peptidergic cells (Allan, 2003).
FMRFa is specifically expressed in the six Tv neuroendocrine neurons located bilaterally in the three thoracic (T1-3) segments of the embryonic and larval VNC. apterous is expressed in three interneurons per VNC hemisegment, as well as in a lateral cluster of four neurons (the ap-cluster) in each of the T1-3 hemisegments. One of the four ap-cluster cells is the FMRFa-expressing Tv neuron. All ap interneurons in the VNC, except for the Tv, join a common ipsilateral axon tract termed the ap-fascicle. The Tv axon instead projects to the midline and exits the VNC dorsally to innervate the dorsal neurohemal organ (DNH). The DNH is a club-like neuroendocrine structure formed by two glial cells protruding from the midline of each thoracic segment. Anteriorly, two additional FMRFa-expressing cells are found, denoted SE2 cells. The SE2 cells do not express, nor depend upon, any regulators described in this study for their FMRFa expression. ap is important for the expression of FMRFa in the Tv neurons, but since most ap neurons do not express FMRFa, other regulators are likely needed for FMRFa regulation (Allan, 2003).
Rotund, a zinc finger protein of the C2H2 Krüppel-type belongs to a conserved subfamily of zinc finger proteins together with Drosophila CG5557, C. elegans Lin-29, and rat CIZ. Squeeze is most closely related to Rotund, with identity greater than 90% throughout the zinc finger region; Squeeze is 78% identical to LIN-29 in the conserved zinc finger region. Both rotund and CG5557 are expressed in subsets of cells in the developing CNS. CG5557 has a larval lethal phase. Mutants eclosed at a low frequency as immotile adults that died within 24 hr. Mutant larvae display a motility defect whereby the body wall musculature over-contract radially during the peristaltic wave typical of insect larval motility, apparent as a 'squeezing' of the intestine. Since this motility phenotype is fully penetrant and scored with 100% accuracy (sqzlacZ/sqzDf), CG5557 was renamed squeeze (sqz) (Allan, 2003).
The expression of sqz is largely restricted to subsets of cells in the CNS throughout embryonic and first instar larval (L1) development. Using sqzGAL4 to drive expression of the axonal reporter, UAS-τ-myc, sqz was found to be expressed in a population of lateral interneurons, primarily projecting axons in the anterior and posterior commissures. In sqz mutants, expressing neurons are generated and appear to extend axons along the appropriate tracts. Using both sqzlacZ and sqzGAL4, tests were performed for overlap with ap; sqz and ap were found to be co-expressed specifically within the thoracic ap cluster. Co-expression of sqz and ap is evident from the onset of ap expression at stage 14, with one neuron typically expressing higher levels of sqz. By stage 17, sqz expression is restricted to two neurons within the ap-cluster, with one neuron typically continuing to display higher levels of expression. Expression overlap between sqz and FMRFa was tested in late stage 17 embryos, when FMRFa expression commences; sqz is indeed selectively expressed at higher levels within the FMRFa Tv neuron. Thus, the six neurons within the VNC that co-express ap and higher levels of sqz selectively express the neuropeptide FMRFa and innervate the three specialized neuroendocrine glands -- the dorsal neurohemal organs (Allan, 2003).
To determine whether sqz regulates FMRFa expression, immunoreactivity for the FMRFa peptide was compared in wild-type and sqz mutant L1 larvae. In wild-type, FMRFa immunoreactivity is robust (98%) in all six Tv neurons. In sqz mutants (sqzlacZ/sqzDf), FMRFa staining was found to be reduced in all Tv neurons and was detected in 75% of cells. The T1 segment was most affected, with FMRFa expressed in 40% of T1 Tv neurons. To verify that the observed effects reflected regulation of the FMRFa gene, antibodies recognizing the C-terminal of the FMRFa precursor peptide (proFMRF) were used, as well as an FMRFa-lacZ reporter that faithfully reports FMRFa expression in Tv neurons. An equivalent effect on proFMRF (75%) and FMRFa-lacZ (77%) was found in sqz mutants (sqzlacZ/sqzDf and sqzGAL4/sqzDf, respectively) when compared to wild-type. Again, segment T1 is most affected with FMRFa-lacZ expressed in only 50% of T1 Tv neurons. These results show that sqz in part regulates the expression of the FMRFa gene in Tv cells (Allan, 2003).
To determine whether sqz regulates axon pathfinding of the Tv neuron, apGAL4 was used to drive the expression of a membrane-targeted reporter (UAS-EGFPF). In sqz mutants, a frequent failure of the Tv axon to innervate the DNH was observed, instead, it apparently joins the ap-fascicle. This phenotype is most pronounced within the most anterior thoracic segment (T1). In wild-type embryos, the DNH was innervated in 100% of thoracic segments, whereas sqz mutants (apGAL4/+;sqzie/sqzDf,UAS-EGFPF) show axonal innervation in 69% of T1 segment DNHs. Failure of innervation did not result from the absence of the DNH itself, since its profile was evident in affected segments. These results show that sqz is important for proper pathfinding of Tv axons and that the Tv axon often fails to diverge from the ap-fascicle in sqz mutants, apparently reverting to an “ap-only” phenotype (Allan, 2003).
Several determinants critical for proper FMRFa expression have been identified. These include a general peptidergic cell identity, co-expression of sqz and ap, axon projection out of the VNC, and competence to respond to a retrograde signal by activating the BMP pathway. When these criteria are met, either in the endogenous or ectopic case, FMRFa expression is triggered. Importantly, none of these events are individually exclusive to the Tv cell, but they are uniquely combined in only these 6 out of the 10,000 cells in the VNC. Reconstituting this scenario in other peptidergic neurons can trigger FMRFa expression. These results are in line with the emerging theme of a critical interplay between combinatorial transcription factor codes and signal transduction pathways in regulating gene expression and provide a clear example of how these general mechanisms also apply to the specific regulation of a terminal differentiation gene in the nervous system (Allan, 2003).
Why is ectopic FMRFa expression restricted to peptidergic neurons? Conceivably, cells responding to BMP activation and sqz/ap co-misexpression may arise from precursor cells utilizing a common genetic program, resulting in a chromatin state where the FMRFa gene is accessible to activation. Currently, the lineage from which most neuropeptidergic neurons arise is unknown, and any common theme behind their generation is uncertain. FMRFa expression may also be constrained by the presence of activators common to peptidergic neurons and/or by repressors present in non-peptidergic neurons. Common properties of peptidergic neurons, such as the dense core vesicle secretory machinery and the processing of precursor peptides, may indicate the existence of common regulatory programs for all peptidergic neurons. In support of this notion, recent studies of a novel basic helix-loop-helix transcription factor, dimmed, show that this gene is specifically expressed in most if not all peptidergic neurons. In dimmed mutants, peptidergic and secretory properties of the majority of peptidergic neurons are affected, including the expression of processing enzymes and several neuropeptides, such as FMRFa. This shows that dimmed plays a key role in specifying the peptidergic fate and supports the notion of a common regulatory program for this cell type (Allan, 2003).
Previous studies found that ap is essential for axon pathfinding of the majority of ap-neurons. However, ap does not affect Tv axon pathfinding, suggesting that the role of ap in Tv cells may exclusively be to regulate FMRFa expression. In line with these results, ap mutants do not show any apparent loss of pMad accumulation in the Tv neurons. In contrast, sqz mutants have Tv axon pathfinding phenotypes, and, consequently, a partial loss of pMad staining specifically in Tv neurons. Observations of Tv axons at the midline suggest that in the absence of sqz, the Tv axon likely reverts to an 'ap-only' axonal phenotype and turns to grow along the common ap-fascicle. Given the importance of DNH innervation for FMRFa expression, axon pathfinding defects in sqz mutants likely contribute to the loss of FMRFa in some hemisegments. However, the great difference in the loss of FMRFa expression between sqz (75%) and wit (0%) argues that sqz is not critical for BMP signaling, but rather affects it indirectly by affecting Tv axon pathfinding. Moreover, the sqz axon pathfinding phenotype is only partially penetrant and fails to explain either the reduction of FMRFa expression observed in all hemisegments, or the potency of sqz (acting together with ap) to trigger ectopic expression in Va and Vap peptidergic neurons (cells whose axons already exit the VNC and are pMad-positive). Misexpression of sqz in all ap cells occasionally leads to an additional pMad/FMRFa positive cell in the ap-cluster. In these cases, no ectopic FMRFa expression is detected in any axons extending in the common ap-fascicle, only in axons projecting into the DNH. Therefore, sqz misexpression likely alters the identity of another ap-cluster cell, imposing a Tv-like axonal pathfinding behavior and causing it to ectopically innervate the DNH. Thus, it appears that sqz regulates two critical features of Tv cell identity: differential pathfinding, and FMRFa expression (both directly and indirectly) (Allan, 2003).
Why do sqz and ap function to activate FMRFa expression within only three neuropeptidergic cell types (the Tv, Va, and Vap cells) which together comprise only 18 out of ∼200 peptidergic neurons in the developing Drosophila VNC? Using the specific GAL4 lines, apGAL4, VaGAL4, and VapGAL4 to drive the expression of UAS-EGFPF, it was found that all three neuronal subsets exit the VNC: Tv axons via the DNHs, Va axons via the transverse nerves, and Vap axons via the posterior A8 nerves. This observation is important in light of previous studies of tinman (tin) mutants. In tin mutants, a number of mesodermally derived tissues, including the DNHs, fail to develop. As a result, Tv axons stall at the presumptive midline exit point and, intriguingly, FMRFa expression is strongly reduced. This suggests that the DNHs may be necessary for proper FMRFa expression in Tv cells. These findings have been confirmed; in tin mutants, the DNHs are absent, and proFMRF staining is weak and only detected in 10% of Tv neurons. To address the putative target requirement for FMRFa expression in an alternative way, apGAL4 was used to express molecules that either alter Tv axon pathfinding or interfere with Tv axonal transport. roundabout (robo), a receptor that mediates repulsion from the VNC midline, was tested. In apGAL4/UAS-robo L1 larvae, Tv axons avoid the midline and fail to innervate the DNH. As predicted, this results in a loss (2%) of FMRFa-lacZ expression. Next, dominant-activated rac (UAS-racV12) was tested; it causes Tv axons to stall before reaching the midline and they fail to innervate the DNHs. This results in a complete loss (0%) of FMRFa-lacZ expression. To interfere with axonal transport, apGAL4 was used to express a dominant-negative version of the P150/Glued dynactin motor complex component (UAS-GluedDN), a molecule shown to specifically interfere with retrograde axonal transport. In apGAL4/UAS-GluedDN L1 larvae, a complete loss (0%) of FMRFa-lacZ expression was detected. Similarly, expression of the microtubule binding Tau protein, shown to interfere with axonal transport in Drosophila led to a near complete loss (4%) of FMRFa-lacZ expression (apGAL4/UAS-τ-myc). In both UAS-GluedDN and UAS-τ-myc, normal Tv axon innervation of the DNH was observed in all segments (Allan, 2003).
By co-expressing UAS-EGFPF in all scenarios outlined above, it was found that loss of FMRFa expression was not due to loss of the Tv cell, since the number of cells within the ap-cluster was unaltered in tin, UAS-robo, UAS-racV12, UAS-GluedDN, and UAS-τ-myc. Using α-Glutactin, it was found that the DNH itself is only affected in tin mutants, not in the other genotypes. Together, these results show that innervation of the DNH and retrograde signaling is essential for the expression of FMRFa (Allan, 2003).
What is the identity of the retrograde FMRFa-inducing signal? Recently, a Drosophila BMP type-II receptor, wishful thinking (wit), was implicated in mediating a retrograde signal from muscles to motor neurons, responsible for presynaptic maturation. Signaling by the TGF-β/BMP superfamily occurs via activation of a receptor complex, consisting of two type I and two type II receptors, leading to phosphorylation and nuclear translocation of a receptor Smad protein. In Drosophila, BMP signaling leads to the phosphorylation and nuclear translocation of the Smad protein Mothers against dpp (Mad), which can be monitored using antibodies specific to phosphorylated Mad (pMad) (Allan, 2003).
Using antibodies to pMad, BMP activation in peptidergic neurons was assayed. Nuclear pMad was detected not only in motor neurons, but also in the Tv, Va, and Vap neurons, demonstrating that peptidergic neurons projecting out of the VNC also show evidence of BMP activation. Accumulation of pMad in the Tv neurons commences during stage 17, immediately following DNH innervation. These results led to a test of whether Tv innervation of the DNH would be critical for pMad accumulation and consequently for FMRFa expression. Indeed, it was found that the absence of the DNH (in tin mutants), Tv axon pathfinding alterations (in apGAL4/UAS-robo and apGAL4/UAS-racV12) and interference with Tv axonal transport (in apGAL4/UAS-GluedDN and apGAL4/UAS-τ-myc) are all accompanied by loss of pMad staining specifically in Tv neurons. The ectopic ap-cluster FMRFa-expressing cell induced by sqz misexpression is also pMad positive. Given the role of sqz in Tv axon pathfinding, this is interpreted as resulting from sqz dominantly altering the projection of one other ap-cluster cell, forcing it to innervate the DNH. Thus, in all genotypes examined, Tv axonal projection to the DNH is critical for pMad accumulation (Allan, 2003).
Since Wit is expressed in a restricted pattern in the developing VNC, attempts were made to address whether the Tv neurons express Wit. However, single-cell resolution could not be obtained with the Wit antibody and Wit could not be definitely localized in Tv cells. However, the wit-dependent pMad accumulation in Tv neurons, the apGAL4/UAS-tkvA, UAS-saxA-mediated rescue of wit mutants, and the UAS-gbb-mediated 'rescue' of UAS-robo misexpression, provide genetic evidence supporting the expression of wit in Tv cells. Previous studies have shown that gbb is expressed in developing endoderm and visceral mesoderm, but it has not been detected in the VNC. By in situ hybridization, no apparent expression was detected in the DNH. Given that the DNH only contains two cell bodies, low-level gbb expression may be beyond detection. Moreover, since the anterior midgut is positioned in very close proximity to the DNHs, it is possible that Gbb diffuses from the visceral mesoderm to the DNH (Allan, 2003).
Why is BMP activation necessary for FMRFa expression? Neither forced axonal exit from the VNC (apGAL4/UAS-Unc5) nor autocrine presentation of the Gbb ligand (apGAL4/UAS-gbb) leads to activated pMad and FMRFa expression in ap cells other than the Tv cell. This indicates that the Tv cell is uniquely predetermined to respond to the Gbb ligand. In fact, even direct activation of the BMP pathway (UAS-saxA, -tkvA;apGAL4/+) in all ap neurons does not trigger ectopic FMRFa expression, showing that the Tv cell is further uniquely capable of responding to BMP activation. The misexpression results show that both of these properties of the Tv cell are specified by sqz/ap co-expression. Given this level of Tv cell predetermination, it begs the question as to why Tv cell FMRFa expression evolved to be dependent upon a retrograde BMP signal. Perhaps dependence upon a retrograde signal provides precise control over the onset of FMRFa expression during embryogenesis. In fact, Tv neurons are born by stage 14 (as evident by ap expression) but do not activate FMRFa expression until late stage 17, upon DNH innervation. Alternatively, the presence of a small number of sqz/ap co-expressing cells in the developing brain that do not express FMRFa may necessitate additional regulatory control over FMRFa expression. Dependence upon a signal transduction pathway also provides several unique means of control and amplification of target gene expression. Finally, the fact that sqz, ap, and BMP activation only act to trigger FMRFa expression within a neuropeptidergic cellular context reveals additional complexity underlying the control of specific neuropeptide expression. Given the large number of diverse cell types in the CNS, what may appear to be an almost excessive complexity of combinatorial coding may in fact be essential for high fidelity of gene expression (Allan, 2003).
Amidated neuropeptides of the FMRFamide class regulate numerous physiological processes including synaptic efficacy at the Drosophila neuromuscular junction (NMJ). Mutations in wishful thinking (wit), a gene encoding a Drosophila Bmp type 2 receptor that is required for proper neurotransmitter release at the neuromuscular junction, also eliminates expression of FMRFa in that subset of neuroendocrine cells (Tv neurons) that provide the systemic supply of FMRFa peptides. Gbb, a Bmp ligand expressed in the segmentally repeated neurohemal organ associated with the ventral cord, provides a retrograde signal that helps specify the peptidergic phenotype of the Tv neurons. Supplying FMRFa in neurosecretory cells partially rescues the wit lethal phenotype without rescuing the primary morphological or electrophysiological defects of wit mutants. It is proposed that Wit and Gbb globally regulate NMJ function by controlling both the growth and transmitter release properties of the synapse as well as the expression of systemic modulators of NMJ synaptic activity (Marqués, 2003).
wishful thinking is primarily expressed in, and required for, proper nervous system function. Mutations in wit result in pharate lethality caused, in part, by defects in the growth and physiology of motoneuron synapses. Mutations in wit also affect the peptidergic phenotype of certain FMRFa-expressing cells found in the ventral cord. In particular, FMRFa expression is eliminated in the Tv neurons that contribute to the systemic supply of FMRFa peptides through release at the neurohemal organ. The regulation of FMRFa expression in Tv neurons is mediated by the Bmp ligand Gbb, since gbb null mutations also eliminate FMRFa expression in Tv neurons. Furthermore, supplying Gbb to the dorsal neurohemal cells restores FMRFa expression in Tv neurons. Since Tv neuron axons arborize onto the neurohemal cells, this strongly suggests that Gbb signals in a retrograde manner to specify the peptidergic phenotype of Tv neurons. Consistent with this view, overexpression in neuroendocrine cells of Dynamitin or a dominant-negative form of p150/Glued, both components of the Dynactin/Dynein motor complex was found to eliminate FMRFa expression in the Tv neurons. Finally, it is shown that providing FMRFa in neuroendocrine cells using the Gal4/UAS system partially rescues the lethal phenotype of wit mutants, even though they still exhibit structural and physiological synaptic defects. It is suggested that Bmp signaling provides a global cue that not only regulates the growth of the NMJ synapses locally but also controls their systemic modulation by the neuroendocrine system (Marqués, 2003).
The Drosophila genome contains seven TGFß type ligands. Three
of these, Dpp, Screw and Gbb, have been shown to transduce Bmp-type signals
(Mad) and to use the type I receptors Tkv and Sax. Two
others, Activin and Activin-like protein, transduce signals through Smad2. The signaling pathways used by Maverick and
Myoglianin remain untested. Among the three Bmp-type ligands, Gbb seemed a
likely candidate for controlling expression of FMRFa, since it is broadly
expressed, at least in embryos, and can signal through Wit to regulate P-Mad accumulation in motoneurons and tissue culture cells. gbb
is strongly expressed in the larval brain lobes and much more weakly in the
ventral ganglia. Interestingly, gbb shows enriched expression in the NHO relative to other ventral ganglia neurons. Thus, Gbb is expressed in the correct place to be a FMRFa regulating ligand (Marqués, 2003).
In Drosophila, FMRFamide peptides have been shown to enhance
synaptic transmission and muscle twitch tension when perfused onto standard
larval nerve-muscle preparations; however, their in vivo role(s) are not known as no
mutations in the FMRFa gene have been identified. As with most
neuropeptides, FMRFamide related peptides are thought to act as neuromodulators and neurohormones.
The Tv-produced FMRFamide related peptides are released into the hemolymph through the neurohemal
organ and hence are able to act on every tissue in the animal that is not
blocked to hemalymph contact. It has been hypothesized that the
lethality of wit mutants is due to the lack of proper synaptic
transmission at the NMJ, resulting in the animals not being able to eclose
from the pupal case. The lack of systemic FMRFamide described in this study would be
expected to further decrease synaptic efficiency and the ability of
wit mutants to eclose. The fact that loss of FMRFa does contribute to
the lethal phenotype is supported by the partial rescue of wit
mutants by overexpression of FMRFa. These results are consistent with
the view that in vivo, FMRFa peptides probably enhance NMJ synaptic activity
similar to their in vitro documented effects on standard larval
electrophysiological preparations (Marqués, 2003).
It is important to note that although the lethal phenotype is partially
reversed, the morphological and physiological synaptic defects reported for
wit mutants are not rescued by overexpression of FMRFa. The
simplest interpretation is that the excess of FMRFamide related peptides enhances the efficiency of wit mutant synapses in vivo without correcting the underlying developmental defects. Although one might expect a significant improvement of the electrophysiological phenotype, this is not detected, probably because the excess FMRFamide related peptides are either washed off the preparation during standard dissection
prior to recording or act for only short periods (Marqués, 2003).
How Wit signaling regulates FMRFa expression is not clear. Since
Smads are well known to act as transcriptional co-activators or co-repressors, the
simplest explanation is that Mad directly regulates activation of
FMRFa transcription, perhaps by forming a complex with Ap. However,
other indirect mechanisms are also possible and this issue will only be
resolved once the FMRFa promoter is fully characterized. It is also
not clear whether Gbb is the only ligand that regulates FMRFa
expression through Wit. In some developmental contexts, such as wing imaginal disc patterning, Gbb acts in combination with Dpp, another Bmp-type ligand. No expression of dpp has been detected in the NHO. However, it could be that one of the as yet uncharacterized ligands, Maverick or Myoglianin, could be a partner with Gbb in regulating FMRFa expression. Conversely, it seems clear that regulating the peptidergic phenotype of the six Tv neurons is not the only role of Gbb signaling. There are hundreds of neurons that receive Bmp signaling as indicated by P-Mad nuclear localization Most of them appear to be motoneurons, which require Wit/Gbb signaling to achieve proper synaptic growth but not to specify their neurotransmitter phenotype. Given that Smads act as co-transcriptional regulators, the fact that the same signal (nuclear translocation of P-Mad) results in different phenotypic outcomes in different neurons can probably be ascribed to the presence of a different set of transcription factors available in each cell type. The Tv neurons receiving the Bmp signal express apterous, a transcription factor required in those cells for FMRFa transcription, and maybe other factors that are required,
in addition to the Wit signal, to activate FMRFa (Marqués, 2003).
Another important issue to resolve is whether Gbb is constitutively
released from the NHO, or is synthesized and released as part of a feedback
mechanism to modulate muscle contractions. It might be that efficient muscle
contraction under normal conditions requires a constant level of FMRFamide related peptides that
are produced in response to a constitutive Gbb signal. Alternatively, Gbb
production or release might be regulated by a sensing mechanism that would
activate the pathway in response to an increased demand for FMRFamide related peptides, owing to
increased locomotor activity or other stimuli, such as compensating for a
synaptic developmental defect. Muscle-derived Gbb
acts through neuronal Wit to convey a retrograde signal essential for NMJ
synapse growth and maturation. In that context, it appears that the role of Bmp
signaling is to coordinate muscle growth with synapse maturation to ensure
proper synaptic efficiency. Thus, the
Wit/Gbb pathway acts as a two-step regulator of NMJ function. First, there is
a developmental role in which Wit signaling is required for proper synaptic
growth during larval development. Second,
Wit signaling is required to achieve the neuromodulatory effect of circulating
FMRFamide related peptides that are required for optimal synaptic transmission. Lack of either one
of these inputs probably results in a substantial decrease of the EJCs. These
two examples suggest that the Gbb/Wit pathway is of general importance in
neural retrograde signaling and it is speculated that it may be used in the
nervous system for other as yet uncharacterized developmental and
physiological purposes (Marqués, 2003).
Tv neurosecretory cells form part of a cluster of four
apterous-expressing neurons on each side of the three thoracic
ganglia. The axons of the Tv neurons extend proximally and dorsally to join
the contralateral axon, and form a median nerve that swells and arborizes onto a group of neurons and glial cells that constitute the neurohemal organ. In wit mutants, these structures develop normally, but the Tv neuron fail to activate FMRFa transcription. Using the Gal4/UAS system Wit's requirement for FMRFa expression was narrowed down to the Tv neurons. Since these neurons accumulate nuclear P-Mad, the results strongly suggest that Wit is required in the Tv neurons themselves, as opposed to forming part of an indirect signal relay mechanism. It appears likely that the source of Gbb in this signaling system is the NHO, since gbb is expressed in the NHO and replenishing Gbb in the NHO of gbb mutants rescues FMRFa expression in the Tv neurons. These experiments do not exclude the possibility that signaling might occur at the cell soma of the Tv neurons in vivo or that
the source of the diffusible ligand could be a different tissue under
physiological conditions. However, the dependence of nuclear P-Mad
accumulation and FMRFa expression in Tv neurons on Dynein-mediated
retrograde transport strongly suggests that signaling is taking place at the
Tv axon terminal. This dependency on Dynein motors is not a general
requirement for FMRFa expression in all neurons because subesophageal
ganglion neurons are not affected by overexpression of dominant-negative Glued or Dynamitin. Nor is the consequence of disrupting this motor likely to exert its effect at the level of P-Mad translocation to the nucleus, since nuclear accumulation of P-Mad in epithelial and mesodermal cells is not effected by retrograde transport disruption. Only in the nervous system is P-Mad accumulation specifically affected, consistent with a role for a retrograde transport mechanism in moving some component of this signaling pathway from the synapse to the nucleus (Marqués, 2003).
In the Drosophila nerve cord, a subset of neurons expresses the
neuropeptide FMRFamide related (Fmrf). Fmrf expression is controlled
by a combinatorial code of intrinsic factors and an extrinsic BMP signal.
However, this previously identified code does not fully explain the regulation
of Fmrf. The Dachshund (Dac) and Eyes Absent (Eya)
transcription co-factors participate in this combinatorial code. Previous
studies have revealed an intimate link between Dac and Eya during eye
development. Here, by analyzing their function in neurons with multiple
phenotypic markers, it is demonstrated that they play independent roles in
neuronal specification, even within single cells. dac is required for
high-level Fmrf expression, and acts potently, together with
apterous and BMP signaling, to trigger Fmrf expression
ectopically, even in motoneurons. By contrast, eya regulates
Fmrf expression by controlling both axon pathfinding and BMP
signaling, but cannot trigger Fmrf ectopically. Thus,
dac and eya perform entirely different functions in a single
cell type to ultimately regulate a single phenotypic outcome (Miguel-Aliaga, 2004).
Phenotypic and transcriptional synergy between So, Dac and Eya during
development and in vitro has been well documented. By
contrast, the current results indicate that these genes can act independently in the
embryonic nervous system to specify neuronal identity. This is the case even
when they are coexpressed in the same neuron; while no evidence of
so expression was found in the ap-cluster, dac and
eya functioned together with the previously identified
ap/sqz/BMP combinatorial code to activate Fmrf expression in
Tv neurons. However, eya controls additional aspects of Tv neuronal
identity, such as axon pathfinding and the ability to respond to a BMP signal. Furthermore, the expression of Dac, but not Eya, So or Ap, in a large number of interneurons has suggested that Dac has additional, independent functions in postmitotic neurons (Miguel-Aliaga, 2004).
The molecular mechanisms underlying transcriptional synergy between So
(Six), Eya and Dac (Dach) have proven to be quite complex. In most cases
examined, So/Six binds DNA and Dac/Dach and Eya regulate its activity. These
biochemical models would not appear to explain the current observations fully. In these studies, Dac appears to act as a potent activator of Fmrf expression but to
rely on Eya for activating Fmrf expression only within ap-neurons;
when dac and ap are co-misexpressed in all neurons there
is widespread ectopic Fmrf expression without any ectopic Eya expression. Why
Eya is required in the ap-neurons for both endogenous and ectopic
Fmrf expression, but not for ectopic Fmrf expression outside
ap-neurons, is currently unclear (Miguel-Aliaga, 2004).
The current findings illustrate the fact that regulators acting within a
postmitotic neuron can act together in a combinatorial fashion to specify one
aspect of neuronal identity (Fmrf expression, in this case). However, some of
these regulators can simultaneously function in combinatorial sub-codes to
control other aspects of neuronal identity; the additional roles of
ap and eya in Tv axon pathfinding may be one such example.
In abdominal hemisegments, Ap is expressed in the two vAp and the single dAp
neurons. Normally, the axons of these neurons join a common ipsilateral
longitudinal fascicle running the length of the VNC. Previous studies have
revealed that ap is important for proper ap-axon
fasciculation as well as for their avoidance of the midline. Eya
is not expressed in vAp neurons, and the results indicate that it
specifically controls dAp pathfinding. The eya mutant phenotype only
partially phenocopies the ap phenotype, since eya affects
midline crossing but not fasciculation; once dAp neurons have aberrantly
crossed the midline they join the contralateral ap-fascicle. Neither
the ap nor the eya mutant phenotypes are due to any apparent
crossregulation between these two genes. Surprisingly, these findings indicated
that different genetic mechanisms underlie the indistinguishable,
ap-dependent axon pathfinding of dAp and vAp neurons; dAp axons
crucially depend upon eya to avoid crossing the midline, whereas vAp
axons neither express eya nor depend upon it (Miguel-Aliaga, 2004).
Together with previous findings these results indicate that Fmrf expression is triggered by the combinatorial action of ap, sqz, dimm, dac, eya and BMP signaling. However, with the exception of BMP signaling,
none of these factors are absolutely necessary for endogenous Fmrf
expression - in all mutants, expression of Fmrf is not lost from all Tv
neurons. Similarly, although misexpression of a partial code can lead to
ectopic Fmrf expression, its expression levels are consistently
weaker than those seen in Tv neurons. Thus, it appears that a partial code is
sufficient for some level of Fmrf expression: the ectopic expression of
Fmrf in BMP-positive RP neurons (cells that do not express sqz,
eya or dimm) in response to dac and ap is one
such example. However, the complete code
(ap/sqz/dimm/dac/eya/BMP)
appears to be necessary for wild-type (high) levels of expression, as seen in
the Tv neurons. It is possible that the simultaneous misexpression of all
these factors would lead to robust ectopic Fmrf expression in all
neurons. Due to obvious technical limitations, this idea has not been tested (Miguel-Aliaga, 2004).
Multiple signal transduction inputs/outputs appear to revolve around Eya: (1)
phosphorylation of Eya by the Ras/MAPK pathway has been found to
regulate Eya activity and synergy with So; (2)
the transcriptional activity of Eya itself depends upon an intrinsic tyrosine
phosphatase activity that is also required for ectopic eye induction in
Drosophila. The target(s) of Eya phosphatase activity are currently
unknown. (3) It is found that Eya regulates the BMP pathway in Tv neurons and
pMad cannot be reactivated in eya mutants even by cell-autonomous
introduction of the BMP ligand Gbb. A probable explanation for this result is
that eya regulates the expression or activity of the BMP type
receptors Wit, Tkv or Sax. When the BMP pathway is dominantly activated by the
use of activated type I receptors, nuclear pMad is restored. However, this
still does not reactivate Fmrf expression, indicating that Eya additionally
plays important roles downstream of pMad activation. One interpretation of
these findings is that Eya acts directly on the Fmrf gene. However,
it is also tempting to speculate that Eya may act to modulate pMad activity
directly. There are several reasons for this proposal. It is known that
several other kinase pathways, such as MAPK, can phosphorylate Smad proteins
on residues other than those phosphorylated by TGFß/BMP type I receptors. The
in-vivo roles of such modifications are unclear, but in-vitro evidence points
to both repression and activation of Smad activity.
Nevertheless, given its nuclear localization and phosphatase activity, it is
possible that Eya acts to de-phosphorylate inhibitory residues in pMad. A
regulatory circuitry between MAPK (and other kinases), Eya and the
TGFß/BMP pathway is an intriguing possibility. Moreover, recent studies
reveal that vertebrate orthologs of Dac can physically interact with the Smad
complex, thereby affecting TGF-ß signaling. Together
with these previous findings, the current results point to a model wherein Eya and Dac play central roles in integrating input from, and controlling the activity of,
multiple signal transduction networks. Determination of the precise mechanisms
by which Eya and Dac orchestrate these events should enhance understanding
of how both intrinsic and extrinsic signals intersect to affect cellular
differentiation (Miguel-Aliaga, 2004).
In the Drosophila ventral nerve cord, a small number of neurons
express the LIM-homeodomain gene apterous (ap). These ap
neurons can be subdivided based upon axon pathfinding and their expression of
neuropeptidergic markers. ap, the zinc finger gene squeeze, the
bHLH gene dimmed, and the BMP pathway are all required for proper
specification of these cells. Here, using several ap neuron terminal
differentiation markers, how each of these factors contributes to ap neuron diversity has been resolved. These factors interact genetically and biochemically in subtype-specific combinatorial codes to determine certain defining aspects of ap neuron subtype identity. However, it was also found that ap, dimmed, and squeeze additionally act independently of one another to specify certain other defining aspects of ap neuron subtype identity. Therefore, within single neurons, single regulators acting in numerous molecular contexts differentially specify multiple subtype-specific traits (Allan, 2005 ).
Within every VNC hemisegment, ap is expressed by one dorsal neuron (dAp) and two ventral neurons (vAp). Additionally, in thoracic VNC hemisegments, ap is expressed by a lateral cluster of four neurons (the ap cluster), termed the Tv, Tvb, Tva, and Tvc neurons. These ap neurons are phenotypically
diverse. The axons of most ap neurons project within an ipsilateral
fascicle (ap fascicle) that projects to the brain, whereas the axons of the Tv cell exit the VNC at the midline to innervate the dorsal neurohemal organs (DNH).
A subset of ap neurons is peptidergic (the Tv, Tvb, and dAp
neurons). As is characteristic for the vast majority of Drosophila peptidergic
neurons, these cells express high levels of the peptide biosynthetic enzyme
peptidylglycine alpha-hydroxylating monooxygenase (PHM).
However, this peptidergic subset is also diverse: Tv cells selectively express
the dFMRFa neuropeptide, whereas Tvb and dAp cells selectively coexpress three
peptide biosynthetic enzymes -- PC2, Furin1, and PAL2 -- although the
identity of their secreted neuropeptide(s) remains unknown. This coexpression in
Tvb and dAp cells suggested a functional grouping and a common name, 'Ap-let'
cells. For clarity, the ap neurons will be considered as three
classes: (1) Tv cells express dFMRFa and PHM and innervate the DNH; (2) Ap-let (Tvb and dAp) cells express PHM, PC2, Furin1, and PAL2; (3) the vAp, Tva, and Tvc cells are nonpeptidergic (Allan, 2005).
ap, sqz, dimm, and the BMP pathway act in a
combinatorial code to regulate dFMRFa in the Tv cell (ap,
sqz, dimm, and the BMP pathway) and furin1 (ap,
dimm) in Ap-let cells. Importantly, however, each
regulator also plays critical roles within these ap neurons independent
of the other regulators. Ap independently acts to regulate axon pathfinding by
all ap cells except the Tv. Dimm independently controls PHM in the Tv and
Ap-let cells. Moreover, Sqz independently acts via the N pathway to regulate
cell identity within the ap cluster, upstream of both Ap and Dimm,
apparently by suppressing the Tvb cell fate to favor the Tv fate. The Ap-let
cells do not express Sqz, nor do they have an activated BMP pathway. In these
neurons, Ap activates the expression of Dimm, and both act together to activate
the expression of the peptide-processing enzyme Fur1. The Tva and Tvc cells of
the ap cluster do not express Dimm and do not have an activated BMP
pathway. Remarkably, the differences inferred between regulatory circuits for the
two classes of peptidergic cells are highly reminiscent of differences in
regulatory circuits that operate during the differentiation of distinct
noradrenergic neurons. Together, these sets of studies support the proposition
that epistatic relations between regulators underlying the production of a
common phenotype may differ according to cell type (Allan, 2005).
The loss-of-function and gain-of-function phenotypes presented for ap, sqz, dimm, and the BMP pathway,
suggest that they act in a combinatorial fashion to regulate dFMRFa
expression in the Tv neuron. Likewise, the results indicate that ap and
dimm, in the absence of sqz and the BMP pathway, combine to
activate Fur1 in the Ap-let neurons, Tvb and dAp. In order to determine whether
these regulators act simultaneously on dFMRFa and Fur1, rather than in a genetic
hierarchy, the epistatic and biochemical relationship between
these regulators were studied. Only one clear epistatic relationship was found;
Ap activates the expression of Dimm in the majority of ap neurons. Therefore, it was important to determine whether Dimm acted downstream of Ap to independently and more directly regulate dFMRFa and Fur1 expression. This hypothesis was tested in two complementary tests. (1) Rescuing Dimm function in ap neurons that were absent for Ap function, yielded a nearly complete rescue of dFMRFa in Tv neurons, but only relatively weak rescue of Fur1 in Ap-let neurons.
(2) Panneuronal co-misexpression of both ap and dimm
triggers ectopic dFMRFa expression in a much greater number of neurons than does
either regulator alone. These data indicate that Dimm functions together with Ap
to achieve wild-type levels of dFMRFa and, more notably, Fur1. Thus, ap
and dimm appear to display both hierarchical and combinatorial
interactions. This hypothesis has precedent in studies of the developing
pancreas, in which Foxa2 is required for pdx-1 transcription in β
cells and later interacts directly with PDX-1 protein to regulate target gene
expression, including maintained pdx-1 expression. Biochemical data are
also consistent with the possibility that a combinatorial Ap, Dimm, and Sqz code
that activates dFMRFa and dFur1 involves direct protein
interactions. These may exist within larger complexes bridged by Chip, since Dimm
can interact directly with both Ap and Chip, and this in turn may explain why
Dimm partially rescues both the ap mutant dFMRFa and Fur1 phenotypes.
These multiple interactions are reminiscent of
synergistic interactions suggested between mammalian bHLH proteins, LIM-HD
proteins, and the Chip homolog, LDB1/NLI. The simplest explanation for restricted
patterns of neuropeptides and certain neuropeptide biosynthetic enzymes features
a combinatorial hypothesis. More specifically, it is proposed that different
combinatorial codes of transcription factors act cell specifically to effect
differing patterns of neuropeptides and associated processing enzymes (Allan, 2005).
Ap expression is an early marker of ap cell
differentiation, and it is required for proper axonal pathfinding by most
ap neurons, although not by the Tv cell. In contrast, neither Sqz nor
Dimm appear to control ap cell morphogenesis. An independent role for Sqz
occurs early in ap cell differentiation, at a time when postmitotic
cell fates are being determined. It is surprising that such cell fate changes
can be rescued by UAS-Dl. Why would the frequently used N pathway
signaling system depend upon a much more restricted regulator like sqz
for proper activity? Increasing evidence points to major mechanistic differences
between N signaling during neuroblast specification and during asymmetric
division, where asymmetric divisions specifically require neuralized,
numb, and sanpodo. No expression of sqz is found in
neuroblasts, but expression is evident in many VNC cells. Therefore, it is proposed
that factors like Sqz coordinate late N signaling with cell specification and/or
cell cycle genes (Allan, 2005).
Dimm acts independently of Ap, Sqz, and
the BMP pathway to activate expression of the neuropeptide-processing enzyme
PHM. The evidence regarding the independent role of Dimm suggests that it is a
master regulator of neuroendocrine cell fate. dimm expression is highly
correlated with a neuroendocrine/peptidergic cellular identity, where it
regulates the expression of almost all neuropeptides and their processing
enzymes examined to date, especially within those neurons that express peptides
that are processed to include an α-amidated C terminus. This is a
significant cellular pattern, because more than 90% of Drosophila
neuropeptides are amidated. Furthermore, high-level expression of the PHM enzyme is
absolutely required for amidation and serves as an excellent marker for most peptidergic neurons
in Drosophila. Finally, PHM expression appears to be dedicated to
neuroendocrine peptide biosynthesis; it is exclusively found within the
luminal domain of secretory vesicles. Thus, PHM expression provides a faithful
marker for the peptidergic/neuroendocrine cell fate. This study has shown that
PHM is dominantly induced by dimm overexpression throughout most or all
of the CNS. This evidence, together with the loss-of-function data argues strongly that
dimm is a neuroendocrine master regulator, with properties akin to those
of other bHLH proteins in regulating cell fate (Allan, 2005).
As anticipated,
more restricted peptidergic traits such as dFMRFa and Fur1 expression are
dependent upon combinatorial codes. Importantly, however, the
selection of cell-specific peptidergic markers arises from a deterministic
interaction between a peptidergic master regulator and a cell-specific
combinatorial code. There exists a clear analogy between the action of
dimm in developing neurons and results regarding the glial cells
missing (gcm) gene. Studies have shown that gcm is both
necessary and sufficient for glial cell specification within the
DrosophilaVNC.
gcm is able to ectopically activate generic glial genes, such as
reversed polarity, and also activates subclass-specific glial genes,
but only in certain prescribed subsets of cells. Thus, similar to gcm,
it is predicted
that dimm is a master regulator of core neuroendocrine genes in most
peptidergic/neuroendocrine cells. It will be of interest to determine which
genes beyond PHM are under dimm control. In parallel, dimm
combines with local-acting factors to help activate subclass-specific genes
(e.g., neuropeptide-encoding genes) within peptidergic cell subsets (Allan, 2005).
The genes studied here
combine to regulate dFMRFa and Fur1 but also have independent roles
within the same cells. This raises the issue of how Dimm, for instance, can
complex with Ap/Sqz on dFMRFa and also act independently on PHM
within the same nucleus. Surprisingly, no clear evidence of an
antagonistic relationship between the individual roles of Ap, Sqz, and Dimm was found. For
example, co-misexpression of ap with dimm does not obviously
suppress the ectopic PHM expression observed when dimm alone is
misexpressed. Likewise, misexpression of sqz in the Fur1-expressing
dAp/Tvb cells does not suppress Fur1. Thus,
it appears that the independent mechanisms of regulator action are robust and
can coexist with combinatorial functions. Therefore, it is proposed that these
regulators operate within a bistable organizational mechanism. With respect to
independent roles, it is proposed that Dimm operates independently of Ap and Sqz to
dominantly induce specific target genes (e.g., PHM) within all neuronal
lineages by forming heterodimers with a class A bHLH like Da, or by forming
homodimers. The Drosophila bHLH Twist
protein has distinct regulatory roles in vivo, acting either as a heterodimer
with Da, or as a homodimer. Notably, the mammalian ortholog of Dimm, Mist1, forms functional
homodimers to promote the differentiation of pancreatic secretory cells (Allan, 2005).
The TGFβ/BMP signal transduction pathway plays critical
roles during a number of developmental events, and mutants affecting the
DrosophilaBMP pathway show dramatic defects in embryonic development. In
contrast, in the Tv neuron, BMP signaling plays a much more subtle
role, and although it is critical for dFMRFa expression, no effects were found
upon the expression of sqz, ap, or dimm or on the general
peptidergic marker PHM in wit mutants. Although these studies cannot rule
out other roles for the BMP pathway in Tv neurons, it is tempting to speculate
that target-derived BMP signaling in neurons may have quite a limited set of
nuclear readouts in each specific neuronal subclass (Allan, 2005).
The regulation of neuropeptide and peptide hormone gene expression is
essential for the development and function of neuroendocrine cells in
integrated physiological networks. In insects, a decline in circulating
ecdysteroids triggers the activation of a neuroendocrine system to stimulate
ecdysis, the behaviors used to shed the old cuticle at the culmination of each
molt. Two evolutionarily conserved transcription factor
genes, the basic helix-loop-helix (bHLH) gene dimmed (dimm)
and the basic-leucine zipper (bZIP) gene cryptocephal (crc),
control expression of diverse neuropeptides and peptide hormones in
Drosophila. Central nervous system expression of three neuropeptide
genes (Dromyosuppressin, FMRFamide-related and
Leucokinin) is activated by dimm. Expression of Ecdysis
triggering hormone (ETH) in the endocrine Inka cells requires
crc; homozygous crc mutant larvae display markedly reduced
ETH levels and corresponding defects in ecdysis. crc
activates ETH expression though a 382 bp enhancer, which completely
recapitulates the ETH expression pattern. The enhancer contains two
evolutionarily conserved regions, and both are imperfect matches to
recognition elements for activating transcription factor-4 (ATF-4), the
vertebrate ortholog of the CRC protein and an important intermediate in
cellular responses to endoplasmic reticulum stress. These regions also contain
a putative ecdysteroid response element and a predicted binding site for the
products of the E74 ecdysone response gene. These results suggest
that convergence between ATF-related signaling and an important intracellular
steroid response pathway may contribute to the neuroendocrine regulation of
insect molting (Gauthier, 2006).
DIMM has been proposed as a direct regulator of neuroendocrine gene
expression in most neuropeptidergic cells. Quantitative RTPCR results, supplemented by in situ hybridization, show that DIMM upregulates the levels of mRNAs derived from at least three neuropeptide genes, Fmrf, Lk and Dms. These findings provide strong support for DIMM as a key regulator of multiple neuroendocrine genes. The LIM-homeodomain gene apterous (ap) also controls Fmrf and Lk gene expression. ap acts cell-autonomously to stimulate dimm expression, but the AP and DIMM proteins can also physically interact, and they may function together in regulating Fmrf. Several other factors, including the transcriptional co-factors encoded by dachshund and eyes absent, the zinc-finger gene squeeze, and the retrograde bone morphogenetic protein (BMP) pathway, act in combinatorial fashion with dimm and ap to control Fmrf expression. However,
other neuropeptidergic cells appear to use only portions of this code. For
example, ap and dimm appear to contribute to the expression
of Lk in Fmrf-negative cells (the segmental cells A1A7 and possibly the brain lobe cells Br1).
Even within the population of Lk cells, loss of dimm results
in very different effects in different neurons, with a reduction in
Lk transcript levels in cells A1A7, and an increase (or no
change) in Lk levels in the Br1 and the subesophageal SE neurons. How do these
relatively widely expressed factors interact with other regulatory proteins to
produce cell type-specific patterns of neuropeptide gene expression? It will
be of interest to determine which other elements of the combinatorial
pro-Fmrf code are used to control Lk and Dms
expression, and to identify additional factors that interact with
dimm to control expression of these neuropeptide genes (Gauthier, 2006).
Does dimm control neuropeptide levels through an additional indirect mechanism?
No changes were detected in levels of three neuropeptide biosynthetic
enzyme mRNAs, Phm, Fur1 and amon, in the qRTPCR analysis.
This is in contrast to earlier immunocytochemical studies, in which a marked reduction was observed in the protein products of these genes in
dimm mutant CNS. In some cases, these differences may reflect the spatial
insensitivity of the qRTPCR methods, as was confirmed by in situ
hybridization analysis of Lk expression. Phm, in particular, may belong in this category. Although levels of PHM and DIMM expression are strongly correlated, PHM is also highly expressed in many other tissues that do not express dimm. Any dimm-dependent change in Phm expression may have been obscured by the much larger pool of dimm-independent Phm mRNA in whole-animal qRTPCR analysis (Gauthier, 2006).
DIMM may regulate levels of other neuroendocrine proteins through a route
that does not involve interactions between DIMM and cis-regulatory
elements in the respective genes. Evidence was obtained in support of
this hypothesis in an earlier analysis of an ectopically expressed
neuropeptide in dimm mutant cells; levels of ectopic PDF protein were
strongly reduced while dimm had no effect on levels of the cognate
Pdf mRNA. This study showed that larvae homozygous for a specific
loss-of-function mutation in dimm displayed reduced levels of
endogenous ETH-like protein(s), but not ETH mRNA, in the endocrine
Inka cells, a site of dimm gene expression. This may occur simply through a
dimm-dependent change in levels of one secreted protein, such as PHM,
that may disrupt the formation of multi-protein aggregates required for
neuropeptide sorting into secretory granules.
Alternatively, recent studies on the mouse ortholog of dimm, Mist1,
suggest that dimm may play a more direct role in the management of
secretory granule budding from the trans-Golgi network. In Mist1
knockout mice (Mist1KO), pancreatic exocrine cells display
reduced intracellular organization. Moreover, the Mist1KO phenotype is partially phenocopied in animals mutant for the Rab3D gene, a small GTPase involved in secretory granule trafficking.
Further studies on the regulation of ETH, PHM and Rab3-like proteins, and on
the biochemical interactions among them, may shed light on the cellular
mechanisms underlying the indirect actions of DIMM (Gauthier, 2006).
Mutations in the crc gene result in pleiotropic defects in
ecdysone-regulated events during molting and metamorphosis. Many of
the morphological defects are associated with a failure of the insect to
properly complete ecdysis, a stereotyped set of behaviors required for
shedding of the old cuticle at the culmination of each molt. Several
neuropeptides and peptide hormones, including ETH, play critical roles in
organizing and triggering ecdysis behavior (Gauthier, 2006).
This study provides four independent lines of evidence that demonstrate a
crucial role for crc in the upregulation of ETH mRNA levels.
First, a marked reduction by qRTPCR is observed in levels of ETH
transcripts [but not in mRNAs encoding CCAP or EH, two other neuropeptides
involved in the neuropeptide hierarchy controlling ecdysis in
crc mutant larvae. Second, in situ hybridization revealed a strong
reduction in ETH mRNA levels in the endocrine Inka cells in
crc mutant larvae. Third, the intensity of anti-PETH immunoreactivity was
markedly reduced in crc1/crc1
homozygotes. Fourth, EGFP fluorescence driven by an ETH-EGFP reporter
gene was reduced in crc mutant larvae. Therefore, CRC is a
strong activator of ETH gene expression, and loss of CRC results in a
corresponding reduction in levels of the ETH protein (Gauthier, 2006).
Despite the molecular identification of the crc locus, almost
six decades after the original description of the first crc allele, the
causes of the molting and metamorphosis defects in crc mutants
remained unclear. The current results suggest a simple model to explain the
crc mutant phenotype. Strong hypomorphic or null mutations in
crc and ETH both severely disrupt ecdysis. These defects
include weak, irregular and slower ecdysis contractions and a failure to shed
old cuticular structures, leading to retention of two and sometimes three sets
of mouthparts into the next larval stage. These
similarities in molting defects, taken together with the observation that
crc is required for normal expression of ETH mRNA and ETH
protein, point to the loss of ETH signaling as the likely proximate cause of
the ecdysis defects observed in crc mutants (Gauthier, 2006).
Despite the specific effects of crc on ETH transcription in the Inka cells, crc is widely expressed, suggesting a cellular housekeeping function. The vertebrate ATF-4 protein is also ubiquitously expressed. In addition, the upregulation of ATF-4 constitutes a milestone of many cellular stress response pathways including oxidative stress, amino acid deprivation, and hypoxia. In the tobacco hornworm, Manduca sexta, levels of ETH fluctuate during the molts and are regulated by circulating ecdysteroids. It is hypothesized that CRC contributes to the regulation of ETH gene expression during this period, perhaps in response to signals from the tracheae (Gauthier, 2006).
Peaks in circulating levels of the ecdysteroid hormone, 20-hydroxyecdysone
(20HE), initiate and coordinate each molt. A subsequent decline in 20HE levels
is required for ecdysis, and the activation of these behaviors involves a
hierarchical cascade of peptide hormone and neuropeptide signals that is
triggered by ETH. Is CRC required in order to maintain ETH expression, or is
CRC involved in regulating transcription of the ETH gene during the
molts? While it is not known whether ETH mRNA levels fluctuate during
Drosophila post-embryonic development, the regulation of ETH levels
by ecdysteroids in molting Manduca sexta, and the analysis of the conserved region sequences CR1 and CR2 (located 91-171 bp upstream of the ETH translational start site), provides tantalizing clues to possible coordinate regulation of ETH gene expression by CRC and ecdysone response genes.
There is substantial overlap between the predicted CRC binding site in CR1 and
a putative ecdysteroid response element (EcRE). In
addition, a potential binding site in CR2 for products of the
E74 early ecdysone-inducible gene. E74 expression is induced
directly by 20HE, and it encodes transcription factors that regulate other
ecdysone response genes. Mutations that specifically disrupt E74B, which likely binds the same consensus as E74A, display defects associated with pupal ecdysis that closely phenocopy crc. In future, studies will focus on whether ETH expression is regulated by elements in both CR1 and CR2 in an ecdysteroid-dependent manner, and whether CRC, E74B and other factors in the ecdysone-response pathway interact competitively or cooperatively at these sites (Gauthier, 2006).
During differentiation, neuroendocrine cells acquire highly amplified capacities to synthesize neuropeptides to overcome dilution of these signals in the general circulation. Once mature, the normal functioning of integrated physiological systems requires that neuroendocrine cells remain plastic to dramatically alter neuropeptide expression for long periods in response to hormonal and electrical cues. The mechanisms underlying the long-term regulation of neuroendocrine systems are poorly understood. This study shows that the Drosophila basic helix-loop-helix protein Dimmed (DIMM), a critical regulator of neuroendocrine cell differentiation, controls secretory capacity in mature neurons. DIMM expression begins embryonically but persists in adults. Through spatial and temporal manipulation of transgene expression in vivo, two phases of prosecretory DIMM activity have been defined. During an embryonic critical window, DIMM controls the differentiation of amplified expression of the neuropeptide leucokinin. At the onset of metamorphosis, levels of DIMM decreases in the insulin-producing cells (IPCs) in parallel with a marked reduction in levels of Drosophila insulin-like peptide 2 and a key neuropeptide biosynthetic enzyme peptidylglycine α-monooxygenase (PHM). Overexpression of DIMM in the IPCs prevented the decrease in PHM levels at this stage. In addition, transient overexpression of DIMM in adults produces a dramatic increase in PHM levels in numerous neurons located throughout the brain. These findings provide insights into the mechanisms controlling the maintenance of differentiated cell states, and they suggest an effective means for dynamically adjusting the strength of hormonal signals in diverse homeostatic systems (Hewes, 2006).
DIMM is required for the embryonic development of secretory peptide expression in diverse neuronal and endocrine cell lineages. In the current study, these findings were extended through spatiotemporal manipulation of dimm transgene expression. A critical window was found, that closed at the end of embryogenesis, during which DIMM must be present to induce full expression of the neuropeptide leucokinin. Thus, under some conditions, DIMM is a differentiation factor (Hewes, 2006).
If DIMM also regulates mature neuronal cell phenotypes, then it should satisfy five conditions. First, it must be present in terminally differentiated cells. Through analysis of dimm reporter gene expression, dimm in situ hybridization, and anti-DIMM immunocytochemistry, it was shown that DIMM is expressed in mature neurons. Second, levels of DIMM must be positively correlated with levels of secretory proteins, and this should occur without significant changes in the cell fates of the affected neurons. Consistent with this prediction, reduced dimm expression results in lower secretory protein levels, elevated expression of dimm results in higher secretory protein levels, and neither effect was accompanied by gross changes in cell morphology or transmitter identity. Third, acute changes in DIMM expression in mature cells should produce corresponding changes in the abundance of secretory proteins: PHM levels were markedly increased after transient DIMM overexpression in the adult brain. Fourth, levels of both DIMM and secretory proteins should fluctuate in tandem in some cells under native conditions. Positively correlated changes have been observed in cellular expression of secretory proteins and DIMM in the context of normal physiological regulation or postembryonic developmental transitions. Fifth, these natural changes in neuropeptide levels should be sensitive to experimental manipulation of DIMM. Overexpression of DIMM in the IPCs prevented the decrease in PHM levels that normally occurs in these cells at the onset of metamorphosis. Together, these results provide the first direct evidence for the postembryonic regulation of differentiated cell properties by an Atonal family protein in living animals (Hewes, 2006).
The induction of PHM and FMRFamide-related neuropeptide expression in the Tva neurons during Drosophila metamorphosis is accompanied by increased expression of a dimm reporter gene. These results are consistent with a role for DIMM in the postembryonic regulation of both Phm and FMRFamide-related (Fmrf) expression in these neurons, because both genes are regulated embryonically by dimm. Early expression of DIMM in the Tva neurons produced early PHM expression, although Fmrf expression was not affected. However, because the Tva neurons are born in the embryo, and their larval function (if any) is unknown, it is not clear whether the correlated changes in DIMM and PHM in these cells reflect cell regulation or delayed differentiation. In contrast, the IPCs are fully functional neurons that control growth rates and circulating carbohydrate levels in larvae. Thus, the regulation of PHM in the IPCs is a clear example of DIMM activity in terminally differentiated cells (Hewes, 2006).
The control of PHM expression by DIMM may serve to regulate the capacity of neurons to produce amidated neuropeptides. In Drosophila, PHM is essential for neuropeptide amidation. Most insect neuropeptides (>90%) are amidated at the C terminus, and amidation is often required for neuropeptide signaling. In addition, many secretory proteins, including the vertebrate ortholog of PHM, peptidylglycine α-amidating monooxygenase, may play indirect roles in the sorting of coexpressed neuropeptides into secretory granules. Because Drosophila insulin-like peptide 2 (dILP2) is not an amidated peptide, the role of the PHM in the insulin-producing cells (IPCs) is unclear. It will be interesting to determine whether PHM is required for dILP packaging and sorting into secretory granules or whether other amidated neuropeptides contribute to signaling by the IPCs. Nevertheless, because DIMM regulates PHM levels pan-neuronally, it likely effects dynamic changes in levels of bioactive, secretion-competent neuropeptides in diverse neurons in addition to the IPCs. In turn, these changes may alter the gain of neuropeptide signaling in the context of homeostatic and developmental regulation of neuroendocrine systems (Hewes, 2006).
The differential effects of dimm on expression of Phm versus Leucokinin (Lk) and Fmrf may reflect differences in the combinatorial transcription factor codes that control the expression of these secretory genes. PHM can be induced (or elevated) in most if not all neurons by expression of a wild-type dimm transgene, although other factors likely contribute secondarily to the fine-tuning of PHM expression, because the responses to dimm overexpression were not linear. Therefore, the code for Phm expression is primarily binary and depends on whether or not DIMM is expressed and generally not on developmental stage. In contrast, the overexpression of dimm alone is not sufficient in most cells to drive Lk and Fmrf expression, and other factors, such as the LIM homeodomain gene apterous and the zinc finger gene squeeze, are also required. Thus, if some elements of these combinatorial codes are only present in differentiating cells, then the induction of Lk, Fmrf, and other similarly regulated genes may only be possible during differentiation. After this stage, other unknown mechanisms would be needed to maintain Lk and Fmrf expression (Hewes, 2006).
Atonal-related proteins operate in transcriptional hierarchies, with proteins such as the neurogenins involved in selection of cell precursors, and later acting factors such as the NeuroD proteins regulating terminal differentiation. NeuroD1/BETA2, for example, is a member of the latter class, and it is expressed in endocrine cells of the pancreas, intestine, and pituitary and in several classes of neurons. It is essential for the complete differentiation of several neuronal and endocrine cell types. Moreover, NeuroD1/BETA2 has been shown to control neurite outgrowth, cell excitability, and the expression of several peptide hormone genes, including insulin, secretin, and proopiomelanocortin (Hewes, 2006).
Interestingly, hypothalamic NeuroD mRNA levels are reduced in obese ob/ob and food-deprived mice, suggesting a functional relationship in mature neurons between NeuroD and the neuroendocrine/endocrine signaling pathways that control energy balance. NeuroD is also required for activity-dependent granule neuron dendritic growth in the intact rat cerebellar cortex, and Gal4-NeuroD chimeras can activate insulin promoter elements in response to glucose stimulation of cultured pancreatic beta cells. In addition, mutations in NeuroD are associated with the development of certain forms of type 2 diabetes mellitus in young people. Together, these findings provide strong, albeit indirect, support for roles of other Atonal family proteins in the regulation or maintenance of neuropeptide and peptide hormone levels in fully differentiated cells. The current results on the dual functionality of DIMM provide additional indirect evidence for this model and suggest that regulation by Atonal proteins is a conserved and important feature of many neuroendocrine systems (Hewes, 2006).
In summary, this study demonstrates that DIMM controls neuropeptide expression in developing and mature neurons. This is the first direct evidence, in situ, for continued function of an Atonal family transcription factor in differentiated cells. The findings provide insights into the general mechanisms for maintenance of terminally differentiated cells after the induction signals are gone. In addition, they suggest an effective means for the regulation of the gain of neuropeptide signaling in mature animals (Hewes, 2006).
Genetic analysis in Drosophila has been used to study the process of C-terminal peptide alpha-amidation. This process is a late
event in the biosynthesis of secretory peptides and likely, in many instances, to
be the rate-limiting step. In insects, more than 90% of known or predicted neuropeptides
are amidated. Peptidylglycine alpha-hydroxylating monooxygenase (Phm) carries out the penultimate step in alpha-amidation, hydroxylating intermediates from prohormone
precursor cleavage products that terminate in glycine residues (Jiang, 2000).
Phm mutants lack Phm protein and enzyme activity; most null animals die as late embryos with few
morphological defects. Natural and synthetic Phm hypomorphs reveal phenotypes that resemble those of animals with
mutations in genes of the ecdysone-inducible regulatory circuit. Animals bearing a strong hypomorphic allele contain no
detectable Phm enzymatic activity or protein; ~50% hatch and initially display normal behavior, then die as young larvae,
often while attempting to molt. The nervous systems of mutant PhmP[07623]
homozygous, hemizygous, and heterozygous first-instar larvae were examined
to determine whether Phm mutants display alterations in neuropeptide
processing. An immunological approach was used to distinguish between amidated and nonamidated products derived from the pro-dFMRF precursor. Antiserum PT2 was generated against the tetrapeptide
FMRFamide and reveals a pattern of staining that is greater than that displayed by products of the dFMRFamide gene. That pattern likely includes products of related neuropeptide genes (other peptides that share a common '-RFamide'
C terminus). The second antiserum was directed against the final 19 amino acids of the pro-dFMRF prohormone, which is not amidated. The pro-dFMRF antiserum produces a pattern highly similar to that displayed by FMRFamide-related mRNA and by large FMRFamide-related-lacZ reporter transgenes.
The PT2 antiserum stained a robust pattern of ~26
neurons in the larval brain and ventral ganglion of first-instar
PhmP[07623] heterozygotes, but revealed virtually nothing in the CNS of PhmP[07623]
homozygotes or hemizygotes. On rare occasions, small spots of immunoreactivity
were observed in the CNSs of homozygotes in
locations normally occupied by prominent FMRFamide-positive
neurons. These 'spots' may be explained by any of several possibilities: (1) an
alternate (low level or highly inefficient) source of Phm-like
enzyme activity, (2) the action of maternally derived
Phm mRNA or Phm enzyme activity, or (3) a lack of
specificity by the anti-FMRFamide antiserum such that it
weakly detects nonamidated peptide forms. In contrast, no differences were seen in the pattern or intensity of the ~14 neurons immunostained with the pro-dFMRF antiserum between heterozygotes and mutant PhmP[07623] animals. These results are consistent with the hypothesis that Phm mutant animals have defects in a posttranslational step(s) in neuropeptide biosynthesis (Jiang, 2000).
Drosophila melanogaster FMRFamide-related peptides (FaRPs) include SDNFMRFamide, PDNFMRFamide, and TDVDHVFLRFamide (dromyosuppressin, DMS); each peptide contains a C-terminal FMRFamide but a different N-terminal extension. FaRPs and serotonin (5-HT) each affect the frequency of D. melanogaster heart contractions in vivo. The cellular expression was examined of FaRPs and 5-HT, and the activities were examined of FMRFamide, SDNFMRFamide, PDNFMRFamide, or DMS and 5-HT on heart rate. FaRPs and 5-HT do not co-localize; FaRP-and 5-HT-immunoreactive fibers extended from different brain cells and innervated the anterior D. melanogaster dorsal vessel. However, no neuron expressed both a FaRP and 5-HT. The effect of FMRFamide and 5-HT is not different from the effect of 5-HT alone on heart rate. The effect of PDNFMRFamide and 5-HT shows an additive effect on heart rate. SDNFMRFamide and 5-HT or DMS and 5-HT result in non-additive effects on heart rate. These data provide evidence for the complexity of FaRP and 5-HT interactions to regulate frequency of heart contractions in vivo. These results also confirm the biological importance of FaRP N-terminal amino acid extensions (Nichols, 2006).
At the end of each molt, insects shed their old cuticle by performing the ecdysis sequence, an innate behavior consisting of three steps: pre-ecdysis, ecdysis, and postecdysis. Blood-borne ecdysis-triggering hormone (ETH) activates the behavioral sequence through direct actions on the central nervous system. To elucidate neural substrates underlying the ecdysis sequence, neurons expressing ETH receptors (ETHRs) have been identified in Drosophila. Distinct ensembles of ETHR neurons express numerous neuropeptides including kinin, FMRFamides, eclosion hormone (EH), crustacean cardioactive peptide (CCAP), myoinhibitory peptides (MIP), and bursicon. Real-time imaging of intracellular calcium dynamics revealed sequential activation of these ensembles after ETH action. Specifically, FMRFamide neurons are activated during pre-ecdysis; EH, CCAP, and CCAP/MIP neurons are active prior to and during ecdysis; and activity of CCAP/MIP/bursicon neurons coincides with postecdysis. Targeted ablation of specific ETHR ensembles produces behavioral deficits consistent with their proposed roles in the behavioral sequence. These findings offer novel insights into how a command chemical orchestrates an innate behavior by stepwise recruitment of central peptidergic ensembles (Kim, 2006).
Analysis of the pupal ecdysis behavioral sequence: In Drosophila, pupal ecdysis is preceded by pupariation, whereby the prepupa contracts its body into a barrel shape to form the puparium composed of the old larval cuticle. The underlying new pupal cuticle then separates from the puparium during pupal ecdysis ~12 hr later. The stereotypic nature of pupal ecdysis and reliable developmental markers make it a favorable model for the behavioral analysis and neural imaging (Kim, 2006).
Pupal ecdysis consists of three centrally patterned behavioral subunits performed sequentially: pre-ecdysis (~10 min), ecdysis (~5 min), and postecdysis (~60-70 min). The behavioral sequence was examined through the semitransparent puparium ('puparium-intact'), but it was found that the puparium obscures and places constraints on some movements. This made it particularly difficult to discriminate differences in abdominal swinging movements during ecdysis and postecdysis. Therefore, a 'puparium-free' preparation was used by surgically removing the puparium immediately after pre-ecdysis onset. The improved visibility and room for movement in this preparation allowed for a more complete analysis of natural and ETH-induced behavior. The following description of the natural pupal ecdysis sequence resulted from comparison of behaviors observed in both puparium-intact and puparium-free prepupae (Kim, 2006).
Pre-ecdysis: About 5 min after in vivo ETH release, preecdysis commences with the abrupt appearance of an air bubble at the posterior end of the prepupa (time zero). Pre-ecdysis involves anteriorly directed rolling contractions along the lateral edges of the abdomen, alternating on the left and right sides of the animal. These contractions move the air bubble anteriorly to separate pupal cuticle from the puparium. This behavior is completed within ~10 min and is followed by ecdysis behavior. Preecdysis behavior is the same in puparium-intact and puparium-free animals (Kim, 2006).
Ecdysis: In higher Diptera including Drosophila, the incipient adult head develops within the prepupal thorax. During pupal ecdysis, head eversion results from lateral swinging movements of the abdomen occurring along with anteriorly directed peristaltic contractions. In puparium-intact preparations, head eversion occurs ~1 min after the onset of ecdysis swinging and is completed within ~5s. After completion of head eversion, ecdysis contractions continue for
~15 min, facilitating expansion of wing pads and legs to their final size. The frequency of ecdysis swinging (~5 swings/min) decreases markedly after head eversion (~2 swings/min). In puparium-free animals, head eversion occurs sooner, and the duration of ecdysis behavior lasts only ~5 min. Later in ecdysis, anteriorly directed swinging contractions are often interrupted by posteriorly directed ones, indicating a transition to postecdysis (Kim, 2006).
Postecdysis: Postecdysis behavior consists of two behavioral subroutines: postecdysis swinging and stretch-compression movements of the abdomen. Postecdysis swinging occurs along with posteriorly directed peristaltic contractions and alternates with longitudinal movements of the abdomen, referred to as 'stretch-compression.' The frequency and intensity of postecdysis contractions wane gradually until they are detected mainly in the anterior part of the abdomen; they cease w100 min after pre-ecdysis onset. Postecdysis behavior concludes with compression of the pupa at the posterior end of the puparium (Kim, 2006).
ETH release coincides with initiation of the ecdysis
sequence: To confirm the role of ETH in initiation of the pupal ecdysis sequence, its release from endocrine Inka cells was monitored in vivo by using time-lapse EGFP fluorescence imaging in pharate pupae (prepupae) carrying the chimeric transgene 2eth3-egfp. In this transgenic fly, EGFP is expressed as part of a fusion protein with the ETH propeptide precursor, and loss of EGFP fluorescence indicates ETH release. Because pharate pupae generally are immobile and Inka cells are located immediately below the semitransparent puparium, in situ imaging of Inka cell in intact pharate pupae is feasible. Two to three Inka cells were monitored simultaneously in each experiment (Kim, 2006).
Depletion of ETH-EGFP occurs in about 50% of monitored Inka cells shortly before pre-ecdysis onset (time zero). The time course of secretory activity for each Inka cell was variable. The mean value for the timing of ETH release was 4.5 min prior to pre-ecdysis onset, and the duration of ETH secretion was 4.4. In contrast, 40% of Inka cells showed no sign of secretory activity by pre-ecdysis onset. After initiation of pre-ecdysis contractions, it was usually impossible to continue monitoring loss of EGFP fluorescence as a result of movement artifacts. All Inka cells are depleted of ETH-EGFP by the end of ecdysis sequence (Kim, 2006).
Injection of ETH induces the ecdysis sequence: Because ETH release coincides with onset of pupal preecdysis, it was of interest to determine whether ETH injection would trigger the pupal ecdysis sequence. The Drosophila gene eth encodes a precursor producing one copy each of two peptides, ETH1 and ETH2, which share similar structure and biological activity. In vivo experiments were carried out primarily in puparium-free preparations (Kim, 2006).
Injection of ETH1 alone into pharate pupae (~1-2 hr prior to natural ecdysis) induced within 1-3 min strong pre-ecdysis contractions followed by ecdysis and postecdysis contractions sequentially. ETH-induced pre-ecdysis showed a strong dose dependence, with higher doses inducing shorter pre-ecdysis duration and higher frequency of contractions. Similar but somewhat less pronounced dose-dependent effects were observed during ecdysis behavior, whereas the frequency of postecdysis contractions showed little or no dose dependence during the first 10 min of behavior (Kim, 2006).
Injection of ETH2 was less efficacious for induction of the behavioral sequence compared to ETH1. ETH2 generated prolonged pre-ecdysis behavior lasting to 50 min or more, but no ecdysis behavior. In contrast, injection of the same dose of ETH1 (0.4 pmol) produced the complete behavioral sequence consisting of pre-ecdysis, ecdysis, and postecdysis. Higher doses of ETH2 (20 pmol) generated a behavioral sequence comparable to that induced by 4 pmol ETH1 in terms of pre-ecdysis duration and frequency of contractions. Behaviors after injecting a cocktail of ETH1 and ETH2 (0.4 pmol of each peptide) were also examined. Because the two peptides are processed from the same precursor, it is likely that these peptides are coreleased under natural conditions. The duration of the behavioral sequence induced by injection of the cocktail was similar to the naturally occurring sequence or one induced by 0.4 pmol ETH1 alone. It is estimated that a 0.4 pmol ETH injection into a prepupa w10 hr after puparium formation results in a concentration of ~300 nM in vivo (Kim, 2006).
ETH receptors are expressed in diverse ensembles of peptidergic neurons: ETH acts directly on the CNS to initiate the ecdysis behavioral sequence in moths and flies via unknown signaling pathways within the CNS. A starting point for elucidation of these downstream signaling pathways is identification of primary neuronal targets of ETH. The ETH receptor gene (CG5911), first identified in Drosophila, encodes two G protein-coupled receptors, ETHR-A and ETHR-B, via alternative splicing. In situ hybridization was used for identification of central neurons expressing ETHR-A and ETHR-B by using DNA probes specific for each receptor subtype. ETHR-A and ETHR-B transcripts were located in mutually exclusive populations of neurons distributed throughout the CNS, suggesting that two subtypes of ETH receptors likely mediate different functions. Further analysis revealed that most ETHR-A neurons are peptidergic. Neurons expressing ETHR-B have not been identified thus far (Kim, 2006).
Multiple ensembles of ETHR-A neurons are classified according to specific neuropeptides they express. Peptides expressed in these ensembles were identified by using GAL4 transgenes under control of neuropeptide promoters to drive UAS-GFP or UAS-GCaMP expression (GAL4::GFP or GAL4::GCaMP). Expression of neuropeptides in these cells was confirmed by combining immunohistochemical staining and in situ hybridization. The first ETHR-A ensemble comprises six pairs of lateral abdominal neurons producing kinin, also known as drosokinin. These cells project axons posteriorly along the lateral edge of the neuropile and then turn anteriorly along the midline of ventral nerve cord, where they arborize and form possible central release sites. Axons of these cells also exit the CNS through nerve roots, suggesting peripheral kinin release. The second ETHR-A ensemble contains three pairs of ventrolateral FMRFamide neurosecretory cells (Tv1-3 or T1-3) in the thoracic neuromeres TN1-3. These cells project axons into the dorsomedial neurohemal organs (NHOs) specialized for peptide release into the hemolymph (Kim, 2006).
The third class of ETHR-A neurons comprises the eclosion hormone (EH)-producing VM neurons in the brain, which project one axonal branch anteriorly into the neurohemal ring gland and a second posteriorly along the dorsal midline of the entire ventral nerve cord. The fourth ETHR-A ensemble is composed of paired dorsolateral neurons producing CCAP, MIPs, and bursicon in subesophageal, thoracic, and abdominal neuromeres (SN1-3, TN1-3, AN1-7, respectively). These cells are likely homologs of moth neurons 27/704, on the basis of their anatomy, peptide coexpression profile, and functional roles during pupal ecdysis. These neurons are referred to as Drosophila neurons 27/704 and them were subdivided on the basis of peptide coexpression. In AN1-4, CCAP is colocalized with MIPs and the heterodimeric peptide hormone bursicon (composed of burs and pburs subunits). In TN2-3 and AN5- 9, CCAP is colocalized with burs, but pburs is not expressed in these neurons. Finally, CCAP is colocalized with MIPs in large paired neurons of AN8,9, but ETHR-A expression has not been confirmed in these cells. The presence of MIP mRNA in abdominal neurons 27/704 was further confirmed by in situ hybridization (Kim, 2006).
Ca2+ imaging of primary ETH targets in transgenic flies: Having shown that ETH receptors occur in diverse ensembles of peptidergic neurons, it was asked whether these cells are activated by ETH and whether this activity coincides with specific behavioral steps of the ecdysis sequence. Calcium dynamics in each group of ETHR-A neurons was monitored by driving expression of the GFP-based Ca2+ sensor, GCaMP [23, 24], in genetically defined sets of neurons with the binary GAL4/UAS system. Ca2+ elevation induces a conformational change of GCaMP, increasing its GFP fluorescence. Using optical imaging of GFP fluorescence, [Ca2+]i dynamics of ETHR neurons were monitored, and these events were associated with each behavioral phase induced by ETH (Kim, 2006).
An abundance of evidence indicates that the ecdysis behavioral sequence in insects is centrally patterned. In particular, the onset and duration of each behavior in the sequence (pre-ecdysis I, pre-ecdysis II, ecdysis) is the same whether observed in vivo or as fictive behavior recorded from the isolated CNS in vitro. On the basis of this evidence, [Ca2+]i dynamics of ETHR-A neuron ensembles of the isolated CNS were associated with behaviors observed in puparium-free preparations (Kim, 2006).
FMRFamide neurons and their neurohemal endings become active early in pre-ecdysis: [Ca2+]i levels were monitored in ETHR-A/FMRFamide Tv neurons by preparing transgenic flies doubly homozygous for FMRFa-GAL4 and UAS-GCaMP. Prior to ETH1 exposure (4-6 hr prior to ecdysis), Tv cell bodies and neurohemal endings in the dorsomedial NHO exhibit low levels of basal GCaMP fluorescence (Kim, 2006).
Exposure of the CNS to ETH1 (600 nM) elicits robust increases in calcium-associated fluorescence in cell bodies and axon terminals of all Tv neurons. At this concentration of ETH1, calcium dynamics typically are characterized by transient, spike-shaped fluctuations superimposed upon a slow upward shift of the baseline, beginning ~8 min after exposure to the peptide. This response lasts ~10-15 min, after which weaker spike-like fluctuations continue without baseline changes until the end of recordings (~40 min). It is estimated that a concentration of 600 nM ETH1 results from a dose of w0.4 pmol of the peptide in vivo. Thus the major calcium response of Tv neurons coincides with the early phase of pre-ecdysis, and weaker activity persists through ecdysis and postecdysis. In contrast, ETH2 alone (600 nM) generates Ca2+ responses after a longer delay comparable to one following exposure to 60 nM ETH1. The longer delay of Ca2+ responses after ETH2 fits with the observations of in vivo behavior, where ETH2 is a less potent agonist than ETH1. The cocktail of ETH1 and ETH2 (600 nM each) evokes Ca2+ dynamics after a delay similar to that induced by ETH1 alone. Overall, [Ca2+]i dynamics observed in Tv neurons are synchronized. In many preparations, Tv neurons from the same neuromere appear to be strongly coupled, given that they produce precisely synchronized Ca2+ dynamics. Transient Ca2+ signals are obvious in the terminal processes of Tv neurons in NHO, the release sites of FMRFamides (Kim, 2006).
Lower concentrations of ETH1 elicit calcium dynamics after a somewhat longer delay. Interestingly, calcium dynamics are obvious first in neurohemal endings of the NHO, followed by fluctuations in cell bodies. This was particularly evident at 60 nM ETH1, where a robust calcium response in the NHO was accompanied by only a weak response in the Tv2 cell body. No calcium responses are observed in Tvs exposed to 6 nM ETH1 (Kim, 2006).
EH neurons reach peak activity at ecdysis: VM neurons producing eclosion hormone (EH) have been implicated as primary ETH targets during fly and moth ecdysis. Expression of ETHR-A was demonstrated in VM neurons, confirming that they are primary ETH targets. To determine whether ETH elicits activity in EH neurons, transgenic flies were prepared doubly homozygous for EHup-GAL4 and UASGCaMP, that show GCaMP fluorescence only in these cells (Kim, 2006).
EH neurons are highly sensitive to ETH1, exhibiting robust [Ca2+]i dynamics upon exposure to concentrations as low as 6 nM. No detectable fluorescence responses are observed after exposure to 0.6 nM ETH1 over a period of 50-60 min. The latency to Ca2+ responses is inversely proportional to the concentration of ETH1; higher ETH1 concentrations evoke faster responses. The cocktail of ETH1 and ETH2 (600 nM each) elicited Ca2+ responses after a ~10-15 min delay (Kim, 2006).
Close examination of these ETH-evoked fluorescence responses reveals two components distinguished by slow and fast kinetics. The slow component is characterized by a gradual increase in baseline levels of Ca2+ followed by a decrease over 20-30 min, whereas the fast component is composed of transient, spike-like activity. Fast components have durations ranging from 5-20 s. Peak DF/F responses are quite variable, even among a group of neurons exposed to the same ETH1 concentration. No significant concentration dependence could be detected in peak response (Kim, 2006).
Distinct subsets of neurons 27/704 are active during different phases of the ecdysis sequence: ETH-evoked Ca2+ signals of neurons 27/704 were examined in transgenic flies carrying CCAP-GAL4 and UAS-GCaMP. Use of the CCAP promoter to drive GCaMP expression resulted in a reporter pattern identical to that described previously. Upon exposure to 600 nM ETH1, distinct subsets of neurons 27/704 exhibited reproducible, stereotypic Ca2+ responses in terms of peak intensity, latency, and termination of Ca2+ dynamics. According to the magnitude of peak fluorescence intensity (peak DF/F), neurons 27/704 fall into three major groups: strong responders, weak responders, and nonresponders. The strong-responder group includes neurons 27/704 in AN1-4 (CCAP/MIPs/bursicon), AN8,9 (CCAP/ MIPs), and TN3 (CCAP). Weak responders are neurons 27/704 in SN2-3, TN1-2, and AN7 producing CCAP only. Neurons in the brain, SN1, and AN5,6 showed no reproducible Ca2+ dynamics in response to 600 nM ETH1 (Kim, 2006).
In response to ETH1, neurons 27/704 in TN3 and AN8,9 become active within 10-15 min, whereas neurons 27/704 in AN1-4 are activated after a 15-25 min delay. Neurons in TN3 and AN8,9 are therefore activated just prior to ecdysis onset, indicating their possible roles in initiation and maintenance of ecdysis behavior. In addition, Ca2+ dynamics observed in AN8,9 neurons terminated early in postecdysis, supporting this interpretation. In contrast, Ca2+ dynamics of neurons in AN1-4 begin during ecdysis and increase in intensity during the entire postecdysis period, suggesting their roles in these events. The cocktail of ETH1 and ETH2 (600 nM each) evoked Ca2+ dynamics similar to those induced by ETH1 alone. Two groups of neurons 27/704 in abdominal neuromeres (AN1-4 versus AN8,9) exhibit differences in sensitivity to ETH and in their patterns of [Ca2+]i dynamics. It was found that 6-60 nM ETH1 activates neurons in AN1-4 (n = 4), whereas higher concentrations of ETH1 (R600 nM) are required to activate neurons in AN8,9. In addition, neurons in AN8,9 generate transient (1-2 min) Ca2+ spikes over a 15-20 min period after ETH1 activation, whereas neurons in AN1-4 generally produce slower, more persistent Ca2+ dynamics. These differences among subgroups of neurons 27/704 suggest their different functional roles during the ecdysis sequence (Kim, 2006).
Targeted ablations of apecific ETHR neurons have behavioral consequences:
To evaluate behavioral roles of specific ETHR neurons, phenotypes of the pupal ecdysis sequence were investigated in transgenic flies bearing targeted ablations of ETHR neurons, including Tv FMRFamide neurons, EH neurons, and CCAP neurons (27/704 homologs). In control flies carrying UAS-reaper and UAS-GCaMP, but lacking the GAL4 driver, pupal ecdysis was executed as in wild-type flies: pre-ecdysis (0-10 min), ecdysis (10-23 min), and postecdysis (23-100 min) (Figure 7). Given that puparium-intact animals were used, the duration of ecdysis behavior may have been overestimated. Transgenic flies bearing targeted ablations of Tv FMRFamide neurons (FMRF-KO) were generated by crossing females doubly homozygous for FMRFa-GAL4, UAS-GCaMP with homozygous UAS-reaper males. Pupal ecdysis of FMRFa-KO flies is very similar to that of control flies. Because FMRFa-GAL4 drives expression of GAL4 only in three pairs of thoracic Tv neurons and one pair of unidentified neurons in SN, FMRFa-KO flies lost only Tv neurons and not other FMRFamide neurons in the CNS. FMRFa-KO flies complete pupal ecdysis without any detectable abnormality, except that pre-ecdysis contractions appear weaker than in control flies. Pupal ecdysis of VM neuron knockout flies (EH-KO) was then examined. Behavioral analysis showed that, although they complete pupal ecdysis without any severe defects or lethality, ecdysis onset is delayed w4 min. As a result of this delay, EH-KO flies show longer pre-ecdysis than control flies. Additional parameters governing pre-ecdysis, ecdysis, and postecdysis are indistinguishable between EH-KO and control flies (Kim, 2006).
Finally, CCAP-KO flies were generated in order to examine the functional roles of neurons 27/704 (CCAP neurons) in pupal ecdysis. As expected, CCAP-KO flies failed to initiate ecdysis contractions and could not complete head eversion. Instead, they show prolonged pre-ecdysis contractions for ~25 min, followed by weak random contractions of the abdomen (different from ecdysis and postecdysis contractions of control flies) for the next 50 min (Kim, 2006).
Conclusions: This study has described orchestration of an innate behavior, the Drosophila pupal ecdysis sequence, by the endocrine peptide ETH. ETH release coincides with onset of behavior, and injection of ETH triggers the complete behavioral sequence, consistent with its role in ecdysis activation previously established in the moths Manduca sexta and Bombyx mori and in Drosophila larvae and adults. Absence of ETH causes lethal ecdysis deficiency, a phenotype that is rescued by ETH injection. ETH therefore functions as a 'command chemical' to orchestrate an innate behavior. Primary CNS targets of ETH was identified by using ETHR-specific in situ hybridization. ETHR-A occurs in multiple classes of peptidergic neurons producing EH, CCAP/MIPs/bursicon, FMRFamides, or kinin (Kim, 2006).
Expression of ETHR-A was shown in VM neurons, which release EH. In response to ETH, VM neurons become active prior to ecdysis behavior and reach peak levels of activity during ecdysis. These results provide further support for a previously described positive-feedback signaling pathway between VM neurons and Inka cells. This feedback is thought to ensure depletion of ETH from Inka cells. These findings are striking because independent evidence indicates that homologous VM neurons in the moth Manduca are direct targets of ETH and that their secretory products regulate ecdysis behaviors downstream of ETH. For example, isolated EH neurons of Manduca respond to direct action of ETH with increased excitability and spike broadening. In response to ETH action, these neurons release EH, causing cGMP elevation and increased excitability in CCAP-containing neurons 27/704 of the thoracic and abdominal ganglia. CCAP and MIPs, cotransmitters produced by neurons 704, are implicated in eliciting ecdysis behavior (Kim, 2006).
A homologous role for EH in activation of Drosophila 27/704 neurons has not been clearly demonstrated. For example, no cGMP elevation is observed in these neurons during the natural ecdysis sequence. This lack of cGMP elevation suggests that CCAP neurons are not directly targeted by EH in Drosophila. Nevertheless, EH-knockout flies exhibit a delay in ecdysis initiation, suggesting that EH may modulate excitability in 27/704 cells indirectly through release of additional factors within the CNS. It is therefore proposed that activation of EH neurons by ETH serves two purposes: (1) release of EH into the hemocoel functions as part of a positive-feedback pathway to ensure ETH depletion from Inka cells; (2) release of EH within the CNS synergizes direct ETH actions on different subsets of neurons 27/704 producing CCAP, MIPs, and bursicon, perhaps indirectly through release of downstream signals within the CNS (Kim, 2006).
Neurons 27/704 expressing ETHR-A respond to ETH with unique patterns of Ca2+ dynamics. These neurons are subdivided by pattern of transmitter expression: CCAP/MIPs/bursicon in AN1-4; CCAP/MIPs in AN8,9; and CCAP in SN1-3, TN1-3, and AN5-7. Temporal patterns of Ca2+ dynamics were determined in each neuronal subset relevant to the behaviors observed. On the basis of these temporal patterns, it is proposed that direct action of ETH on neurons 27/704 in TN3 and in AN8,9 induces initiation and execution of ecdysis contractions and head eversion. In support of this, it is shown that ablation of CCAP neurons abolishes ecdysis contractions and head eversion. Parallel study in Manduca showed that neurons 704 expressing ETHR-A and their peptide cotransmitters, CCAP and MIPs, are implicated in control of the ecdysis motor pattern, supporting the homologous function of 27/704 neurons in Drosophila. Neurons 27/704 in AN1-4 produce CCAP, MIPs, and bursicon, and therefore a cocktail of these peptides is likely released within the CNS and into the hemolymph during postecdysis. It is suggested that centrally released peptides control postecdysis movements, whereas blood-borne CCAP/MIPs regulate heart beat and blood pressure for cuticle expansion and bursicon controls sclerotization of expanded new cuticle. Bursicon was recently identified as a heterodimeric peptide hormone regulating cuticle plasticization, sclerotization, and melanization (Kim, 2006).
The Drosophila FMRFamide gene (FMRFa) encodes multiple FMRFamide-related neuropeptides, which are expressed in many different cell types, including neuroendocrine cells, interneurons, and perhaps motoneurons. Among these diverse FMRFamide-producing neurons, ETHR-A expression is confined to three pairs of thoracic neurosecretory neurons, Tv1-3. Results of the present study show that the Tv neurons are activated early in pre-ecdysis and that they remain active during ecdysis and postecdysis. However, FMRFa-KO flies show no differences in timing of the ecdysis behavioral sequence. Because FMRFamides enhance twitch tension of larval body-wall muscles through synaptic modulation at the neuromuscular junction, blood-borne FMRFamides released from Tv neurons likely facilitates pre-ecdysis, ecdysis, and postecdysis contractions. Thus the role of Tv neurons as primary ETH targets may be enhancement of muscle contraction during the behaviors. Further work to substantiate this is in progress (Kim, 2006).
Expression of ETHR-A occurs in in kinin neurons of abdominal neuromeres of Drosophila. Drosophila kinin is known to be involved in water balance, but its central functions have not been described or considered. Expression of ETHR-A in kinin neurons appears to be a conserved mechanism in fly and moth; the Manduca ETHR-A is expressed in abdominal neurosecretory cells (L3,4), which produce kinins and diuretic hormones (DHs). It was further found that the isolated Manduca CNS generates the fictive pre-ecdysis motor pattern upon exposure to a cocktail of kinin and DHs. These findings suggest that ETH activates L3,4 neurons in Manduca to release kinins and DHs centrally, which initiate and execute pre-ecdysis. On the basis of the conservation between Drosophila and Manduca in spatial expression pattern of ETHR, it is proposed that ETH initiates pre-ecdysis behavior indirectly via central release of kinin in Drosophila (Kim, 2006).
In Drosophila, pupal ecdysis is accomplished by sequential recruitment of three
major behavioral units: pre-ecdysis (0-10 min), ecdysis (10-15 min), and postecdysis (15-100 min). Each behavioral unit is programmed in the CNS and sequentially activated by direct actions of ETH, which is synthesized and released from peripheral endocrine Inka cells. Around 4-5 min before pre-ecdysis onset, a sizeable portion (~50%) of Inka cells initiates secretion of ETH into the hemolymph, whereas the remaining portion completes secretion after onset of pre-ecdysis. Appearance of ETH in the hemolymph activates ETHR-A in neurons expressing neuropeptides including kinin, FMRFamides (Tv1-3), EH, or CCAP, MIPs, and bursicon, but they are not released until descending inhibition is removed at key times during the ecdysis sequence. Upon activation of ETHR, the central release of kinin initiates pre-ecdysis contractions, whereas Tv neurons secrete FMRFamides to enhance neuromuscular transmission. ETH activates neurons producing EH, CCAP, CCAP/MIPs, and CCAP/MIPs/bursicon at different times. EH cells in the brain and neurons producing CCAP in TN3 and CCAP/MIPs in AN8,9 become active ~10-13 min after pre-ecdysis initiation. EH participates in timing the activation of ecdysis neurons, whereas CCAP and MIPs from TN3 and AN8,9 control initiation and execution of the ecdysis motor program. At the end of ecdysis (25 min after pre-ecdysis onset), neurons in AN1-4 secrete a cocktail of CCAP, MIPs, and bursicon, which likely regulate postecdysis contractions and processes associat