Delta


EVOLUTIONARY HOMOLOGS (part 3/3)

Mammalian Delta homologs

A novel mouse gene, Dll1 (delta-like gene 1), maps to the mouse t-complex and has a deduced amino acid sequence strongly suggests that Dll1 represents a mammalian gene closely related to Drosophila Delta. Dll1 is transiently expressed during gastrulation and early organogenesis, and in a tissue-restricted manner in adult animals. Between day 7 and 12.5 of development, expression was detected in the paraxial mesoderm, closely correlated with somitogenesis, and in subsets of cells in the nervous system. In adult animals, transcripts were detected in lung and heart. Dll1 expression in the paraxial mesoderm and nervous system is strikingly similar to the expression of mouse Notch1 during gastrulation and early organogenesis. The overlapping expression patterns of the Dll1 and Notch1 genes suggest that cells in these tissues can communicate by interaction of the Dll1 and Notch1 proteins. These results support the idea that Delta- and Notch-like proteins are involved in cell-to-cell communication in mammalian embryos and suggest a role for these proteins in cellular interactions underlying somitogenesis and development of the nervous system (Bettenhausen, 1995).

The Notch receptor is involved in many cell fate determination events in vertebrates and invertebrates. It has been shown in Drosophila that Delta-dependent Notch signaling activates the transcription factor Suppressor of Hairless, leading to an increased expression of the Enhancer of Split genes. Genetic evidence has also implicated the Kuzbanian gene, which encodes a disintegrin metalloprotease, in the Notch signaling pathway. A two-cell coculture assay has shown that vertebrate Dl-1 activates the Notch-1 cascade. Consistent with previous data obtained with active forms of Notch-1, a HES-1-derived promoter construct is transactivated in cells expressing Notch-1 in response to Dl-1 stimulation. Impairing the proteolytic maturation of the full-length receptor leads to a decrease in HES-1 transactivation, further supporting the hypothesis that only mature processed Notch is expressed at the cell surface and activated by its ligand. Dl-1-induced HES-1 transactivation is dependent both on Kuzbanian and RBP-J activities, consistent with the involvement of these two proteins in Notch signaling in Drosophila. Exposure of Notch-1-expressing cells to Dl-1 results in an increased level of endogenous HES-1 mRNA. Finally, coculture of Dl-1-expressing cells with myogenic C2 cells suppresses differentiation of C2 cells into myotubes, as previously demonstrated for Jagged-1 and Jagged-2, and also leads to an increased level of endogenous HES-1 mRNA. Thus, Dl-1 behaves as a functional ligand for Notch-1 and has the same ability to suppress cell differentiation as do the Jagged proteins (Jarriault, 1998).

Mouse delta-like 3 (Dll3), a novel vertebrate homolog of the Drosophila gene Delta, was isolated by a subtracted library screen. Dll3 is the most divergent Delta homolog identified to date. Dll3 can inhibit primary neurogenesis when ectopically expressed in Xenopus, suggesting that it can activate the Notch receptor and therefore is a functional Delta homologue. An extensive expression study during gastrulation and early organogenesis in the mouse reveals a diverse and dynamic pattern of expression. The three major sites of expression implicate Dll3 in somitogenesis and neurogenesis and in the production of tissue from the primitive streak and tailbud. A careful comparison of Dll3 and Dll1 expression by double RNA in situ hybridization demonstrates that these genes have distinct patterns of expression, but implies that together they operate in many of the same processes. It is postulated that during somitogenesis Dll3 and Dll1 coordinate in establishing the intersomitic boundaries. During neurogenesis in the spinal cord, Dll1 and Dll3 are expressed by postmitotic cells. Expression is sequential such that cells express Dll1 first followed by Dll3. It is hypothesized that Dll1 is involved in the release of cells from the precursor population and that Dll3 is required later to divert neurons along a specific differentiation pathway (Dunwoodie, 1997).

A new member of the Delta family of Notch ligands, Dll4, has been cloned and characterized. Like other Delta genes, Dll4 is predicted to encode a membrane-bound ligand, characterized by an extracellular region containing several EGF-like domains and a DSL domain required for receptor binding. In situ analysis reveals a highly selective expression pattern of Dll4 within the vascular endothelium. The activity and expression of Dll4 and the known actions of other members of this family suggest a role for Dll4 in the control of endothelial cell biology (Shutter, 2000).

The predicted protein sequences for both human DLL4 and murine Dll4 exhibit all of the hallmarks of the Delta family of Notch ligands. The extracellular region contains 8 EGF-like repeats, as well as a DSL domain that is conserved among all Notch ligands and is necessary for receptor binding. The predicted protein also contains a transmembrane region, and a cytoplasmic tail lacking any catalytic motifs. The absence of an extracellular cysteine-rich domain and the lack of insertions between the EGF-like repeats clearly exclude Dll4 from the Jagged family of ligands. The Dll1 and X-Delta1 homologs are >70% identical at the amino acid level, whereas each of these genes is ~50% identical to Dll4. Similarly, Dll4 is ~50% identical to X-Delta2; suggesting Dll4 is not a mammalian homolog of the X-Delta2 gene, but rather a novel fourth member of the Delta gene family (Shutter, 2000).

Mice mutant for the gene Mash1 display severe neuronal losses in the olfactory epithelium and ganglia of the autonomic nervous system, demonstrating a role for Mash1 in development of neuronal lineages in the peripheral nervous system. Mash1 function in the central nervous system, has been analyzed, focusing on the ventral telencephalon where it is expressed at high levels during neurogenesis. Mash1 mutant mice present a severe loss of progenitors, particularly of neuronal precursors in the subventricular zone of the medial ganglionic eminence. Discrete neuronal populations of the basal ganglia and cerebral cortex are subsequently missing. An analysis of candidate effectors of Mash1 function reveals that the Notch ligands Dll1 and Dll3, and the target of Notch signaling Hes5, fail to be expressed in Mash1 mutant ventral telencephalon. In the lateral ganglionic eminence, loss of Notch signaling activity correlates with premature expression of a number of subventricular zone markers by ventricular zone (VZ) cells. In mutant embryos, GAD67 is ectopically expressed by Z cells of the ventral telencephalon at all developmental stages examined. Similarly, Dlx-5 is ectopically expressed in the VZ in mutant embryos. Dlx-1 transcripts are also found in virtually all cells of the mutant VZ, an expression normally observed only in the subventricular zone. Expression of Lhx2 expression is strongly reduced in the VZ of the mutant median ganglionic eminence, but remains at significant levels in the lateral ganglionic eminence. This result suggests that, although mutant VZ cells have prematurely acquired subventricular zone characteristics, they have only partially changed phenotype in the lateral ganglionic eminence, since they maintain expression of a ventricular zone marker. Therefore, Mash1 is an important regulator of neurogenesis in the ventral telencephalon, where it is required both to specify neuronal precursors and to control the timing of their production. Negative regulation of Dlx-1/2 by Mash1 is probably due to a process of lateral inhibition, rather than to a cell-intrinsic mechanism. Mice mutant for Dlx-1 and Dlx-2 present a striatal defect, interpreted as a block in differentiation specifically affecting late-born matrix neurons (Casarosa, 1999).

The neurogenins (NGNs) are neural-specific basic helix-loop-helix (bHLH) transcription factors. Mouse embryos lacking ngn1 (Drosophila homolog: Atonal) fail to generate the proximal subset of cranial sensory neurons. ngn1 is required for the activation of a cascade of downstream bHLH factors, including NeuroD, MATH3, and NSCL1. ngn1 is expressed by placodal ectodermal cells and acts prior to neuroblast delamination. Proximal cranial sensory ganglia, including the trigeminal, jugular and superior ganglia are deleted in ngn1-/- embryos. NGN1 positively regulates the Delta homolog DLL1 and can be negatively regulated by Notch signaling. Thus, ngn1 functions similarly to the proneural genes in Drosophila. However, the initial pattern of ngn1 expression appears to be Notch independent. Expression of ngn1 is first detected in the trigeminal placode at E8.25. NeuroD mRNA is subsequently detected at E8.75, and this is followed by expression of the bHLH protein NSCL1. Taken together with the fact that ectopic ngn1 expression can convert ectodermal cells to neurons in Xenopus, these data identify ngns as vertebrate neuronal determination genes, analogous to myoD and myf5 in myogenesis (Ma, 1998).

Three mammalian Fringe-related family members have been cloned and characterized: Manic, Radical and Lunatic Fringe. Expression studies in mouse embryos support a conserved role for mammalian Fringe family members in participation in the Notch signaling pathway leading to boundary determination during segmentation. This model is proposed based on unpublished results of V. Panin, V. Papayannopoulos, R. Wilson and K. D. Irvine quoted in Johnston, 1997. Drosophila Fringe works in a positive feedback loop by modulating the signaling between the two Notch ligands at the D-V boundary of the wing imaginal disc. Delta expressed in ventral cells binds and activates Notch in dorsal cells, and Serrate expressed in dorsal cells binds and activates Notch in ventral cells. An important consequence of the boundary mediated signaling is that the initial asymmetric boundary between dorsal and ventral cells is translated by reciprocal activation of Notch at the D-V compartment boundary into symmetrical expression of downstream targets and the expression of wingless as the organizing signaling molecule (Johnston, 1997).

Manic and Lunatic expression domains are suggestive of a role for mammalian Fringe in demarcation of segmental boundaries observed during anterior-posterior patterning of the hindbrain and somites. Both Manic and Lunatic are expressed in anterior-posterior stripes in the hindbrain prior to the formation of morphologically recognized rhombomeric boundaries. In embryos at the 5 somite stage, Manic is expressed in pre-rhombomere (pre-r) 3, while Lunatic is expressed in pre-r3 and pre-r5. In embryos with 12-13 somites, r3 and r5 expression of Manic and Lunatic is observed. The restricted pattern of Manic and Lunatic Fringe to r3 and r5 creates a juxtaposition of Fringe-expressing and non-expressing cells between even and odd numbered rhombomeres, an observation consistent with the demarcation and establishment of boundaries. Of the three mouse Fringe genes, Lunatic is solely expressed in the presomitic mesoderm in a striking pattern that appears to demarcate the formation of intersomitic boundaries and the appearance of separated somites. The expression of Lunatic is dynamic, reflecting the rostral-caudal wave of somitic developmetal progression. In the posterior presomitic mesoderm, Lunatic is expressed in a broad swath of cells. As somitogenesis proceeds, this band of expression becomes narrower, paralleling the cell condensation. Stripes of expression appear to correspond to what will form the posterior half of a somite. The initial broad posterior band of Lunatic expression is found in the midst of Dll1-expressing cells (Dll1 is a mammalian homolog of Drosophila Delta). Lunatic and Dll1 expressions become progressively more refined. Lunatic expression is localized to the posterior half of presumptive somitomere 2, while Dll1 expression is localized to the posterior border of this same somitomere. Dll1 expression also extends caudally throughout the adjoining presomitic mesoderm. Once the somite has formed, transcript levels of Lunatic decline rapidly. Likewise Radical expression is correlated with the rostral-caudal maturation of the spinal cord and the differentiation of neuronal population. In mammalian cells, Drosophila Fringe and the mouse Fringe proteins are subject to posttranslational regulation at the levels of differential secretion and proteolytic processing. When misexpressed in the developing Drosophila wing imaginal disc the mouse Fringe genes exhibit conserved and differential effects on boundary determination. In some cases misexpression of a mammalian Fringe in Drosophila eliminates wing margin tissue and Wingless expression (Johnston, 1997).

In the retina, cell fate determination is thought to be regulated by a series of local cell-cell interactions. Evidence suggests that retinal precursors utilize Notch-mediated intercellular signaling to regulate their fates. However, the identity of the endogenous ligand and its role in the Notch-signaling pathway is not well understood. C-Delta-1 has been identified as the putative endogenous ligand for Notch, in the developing chick retina. C-Delta-1 is coexpressed spatially and temporally with C-Notch-1; their coexpression is associated with the temporal aspects of cell birth in the developing retina. This suggests that Delta-Notch signaling is utilized to maintain progenitors in an uncommitted state and that a subtle fluctuation in this signaling helps to sort out competent cells during successive cell-fate determination. The latter possibility has been tested in the specification of the ganglion cells. In early stages of retinal development when ganglion cells are the predominant cells born, decreasing C-Delta-1 expression with antisense oligonucleotides increases the proportion of RA4 antigen-expressing ganglion cells, which are recruited predominantly in the periphery. Conversely, use of exogenous Drosophila Delta leads to a decrease in the RA4 antigen-expressing ganglion cells. These results suggest that C-Delta-1 activation of the Notch pathway regulates the specification of retinal neurons in general and of ganglion cells in particular (Ahmad, 1997).

Notch ligands are substrates for protein O-fucosyltransferase-1 and Fringe

O-Fucose has been identified on epidermal growth factor-like (EGF) repeats of Notch, and elongation of O-fucose has been implicated in the modulation of Notch signaling by Fringe. O-Fucose modifications are also predicted to occur on Notch ligands based on the presence of the C2XXGG(S/T)C3 consensus site (where S/T is the modified amino acid) in a number of the EGF repeats of these proteins. Both mammalian and Drosophila Notch ligands are modified with O-fucose glycans, demonstrating that the consensus site is useful for making predictions. The presence of O-fucose on Notch ligands raises the question of whether Fringe, an O-fucose specific ß1,3-N-acetylglucosaminyltransferase, is capable of modifying O-fucose on the ligands. Indeed, O-fucose on mammalian Delta1 and Jagged1 can be elongated with Manic Fringe in vivo, and Drosophila Delta and Serrate are substrates for Drosophila Fringe in vitro. These results raise the interesting possibility that alteration of O-fucose glycans on Notch ligands could play a role in the mechanism of Fringe action on Notch signaling. As an initial step to begin addressing the role of the O-fucose glycans on Notch ligands in Notch signaling, a number of mutations in predicted O-fucose glycosylation sites on Drosophila Serrate have been generated. Interestingly, analysis of these mutants has revealed that O-fucose modifications occur on some EGF repeats not predicted by the C2XXGGS/TC3 consensus site. A revised, broad consensus site, C2X3-5S/TC3 (where X3-5 are any 3-5 amino acid residues), is proposed (Panin, 2002).

Delta-Notch interaction, the cleavage on Notch, transcytosis of the Notch extracellular domain, and the cleavage of Delta

The biological activity of the soluble form of the Notch ligand (sNL) and requirement of the intracellular domain (ICD) of the Notch ligand have been debated. Soluble Delta1 (sD1) has been shown to activate Notch2 (N2), but much more weakly than full-length Delta1 (fD1). Furthermore, tracing the N2 molecule after sD1 stimulation reveals that sD1 has a defect in the cleavage releasing ICD of N2 (intracellular cleavage), although it triggers cleavage in the extracellular domain of N2. This represents the molecular basis of the lower activity of sD1 and suggests the presence of an unknown mechanism regulating activation of the intracellular cleavage. The fact that Delta1 lacking its ICD (D1ICD) exhibits the phenotype similar to that exhibited by sD1 indicates that the ICD of D1 (D1DeltaICD) is involved in such an as yet unknown mechanism. Furthermore, the findings that D1DeltaICD acts in a dominant-negative fashion against fD1 and that the signal-transducing activity of sD1 is enhanced by antibody-mediated cross-linking suggest that the multimerization of Delta1 mediated by D1ICD may be required for activation of the N2 intracellular cleavage (Shimizu, 2002).

Lateral inhibition, mediated by Notch signaling, leads to the selection of cells that are permitted to become neurons within domains defined by proneural gene expression. Reduced lateral inhibition in zebrafish mib mutant embryos permits too many neural progenitors to differentiate as neurons. Positional cloning of mib revealed that it is a gene in the Notch pathway that encodes a RING ubiquitin ligase. Mib interacts with the intracellular domain of Delta to promote its ubiquitylation and internalization. Cell transplantation studies suggest that mib function is essential in the signaling cell for efficient activation of Notch in neighboring cells. These observations support a model for Notch activation where the Delta-Notch interaction is followed by endocytosis of Delta and transendocytosis of the Notch extracellular domain by the signaling cell. This facilitates intramembranous cleavage of the remaining Notch receptor, release of the Notch intracellular fragment, and activation of target genes in neighboring cells (Itoh, 2003).

There are two models that could explain why an E3 that is responsible for ubiquitylation and internalization of Delta would be required for effective Notch signaling. One possibility is based on the proposition that Mib is required in the cell that delivers signals; the other assumes that it is required in the cell that receives them. In the first model, Mib promotes the transendocytosis of the Notch extracellular domain by promoting endocytosis of Delta and, in doing so, facilitates proteolytic events that generate the transcriptionally active NotchICD fragment. This proposal comes from studies of the neurogenic phenotype of shibire and neur mutants in Drosophila, suggesting that transendocytosis of the Notch extracellular domain by the adjacent Delta-expressing cell is essential for efficient Notch activation. In the zebrafish system, transplantation experiments show that cells with reduced mib function are less likely to become neurons when surrounded by wild-type cells. This supports the idea that loss of mib function primarily reduces a cell's ability to produce an effective inhibitory signal in the competition to become a neuron (Itoh, 2003).

The other model that explains why ubiquitylation and internalization of Delta might be essential for Notch signaling postulates a cell-autonomous role for mib in signal reception, as has also been suggested previously for neur. According to this model, mib-mediated Delta turnover would limit Delta's ability to inhibit Notch function cell autonomously. However, cell transplantation results argue against a significant deficit in reception of the inhibitory signal. Furthermore, the luciferase experiments, in which cells were cotransfected with notch and various delta constructs, show that, while Delta does indeed have a cell-autonomous effect in blocking signal reception, mib does not significantly influence this action of Delta. Moreover, this action of Delta does not seem to be ubiquitin dependent: the recombinant addition of ubiquitin does not significantly reduce DeltaDeltaICD's ability to inhibit Notch function. It is possible that in these assays, Mib is ineffective at reducing cell-autonomous inhibition of Notch by Delta because very high levels of artificially expressed Delta in the transfected cells in vitro may overwhelm the capacity of the Mib-dependent machinery. However, in studies in COS7 cells, at least, Mib is effective in removing artificially expressed Delta from the cell surface, suggesting that the inhibitory effect of Delta may be independent of delivery of Delta to the cell surface: it may result from Delta-Notch interactions within the secretory pathway. In short, observations do not support a significant role for Mib in limiting Delta's ability to cell autonomously inhibit Notch function as has been described for Neur, but such a role cannot be completely ruled out (Itoh, 2003).

The role of Mib in signal delivery is strongly supported and tightly correlated with Delta ubiquitylation. Ectopic expression of XDelta1DeltaICD, which cannot be ubiquitylated, permits too many cells to become neurons, while XDelta1 and XDelta1DeltaICD-Ub, ectopically expressed in the embryo in a similar way, both inhibit cells from becoming neurons. These effects correlate with the ubiquitin-dependent reduction of cell surface Delta. The internalization of XDelta1DeltaICD-Ub is consonant with previous studies that have shown that in-frame addition of ubiquitin to stable plasma membrane proteins can serve to target their entry into the endocytic pathway. The obvious suggestion, therefore, is that Mib-induced ubiquitylation drives internalization of Delta by endocytosis, and that this process is critical for effective signaling by Delta (Itoh, 2003).

An additional possibility that cannot as yet be excluded is that Mib-dependent ubiquitylation of Delta also decreases the amount of Delta that reaches the cell surface by sorting Delta directly from the Golgi complex to late endosomes. Such a dual role has been shown in yeast for the E3 ligase Rsp5p, which ubiquitylates its substrate, Gap1p, to regulate the total amount of Gap1p at the cell surface. Ubiquitylation of Gap1p by Rsp5p promotes endocytosis of Gap1p and favors sorting of Gap1p from the Golgi to the vacuole, where it is degraded. Mib may also have dual roles in endocytosis of Delta and in direct sorting of Delta to late endosomes/lysosomes; however, it is not clear at this time how the later function might contribute to Notch signaling (Itoh, 2003).

Although mib mutants express unusually high levels of cell surface Delta, it is unlikely that this is per se the cause of the neurogenic phenotype, since artificial expression of even higher levels of Delta in mib mutants following injection of delta mRNA suppress the neurogenic phenotype (Itoh, 2003).

From these observations, it seems that while all the forms of Delta that were examined can cell autonomously inhibit Notch function, only the forms of Delta that are ubiquitylated and endocytosed can effectively activate Notch in neighboring cells. It is likely that when Delta is driven to high levels in a group of cells, the effect of Delta in trans, as an activator of the Notch pathway, dominates over its effect in cis, as an inhibitor, accounting for the ability of Xdelta1 and Xdelta1DeltaICD-Ub to inhibit neurogenesis in the embryo (Itoh, 2003).

The opposing cell-autonomous and nonautonomous effects on Notch signaling define two synergistic mechanisms by which a cell expressing more Delta than its neighbors gains an enhanced ability to become a neuron. By activating Notch in neighboring cells, Delta reduces the neighbors' ability to express the Notch ligand Delta at high levels. At the same time, Delta interferes with Notch function in the cell where Notch and Delta are coexpressed, making it harder for this cell to be inhibited from becoming a neuron by Delta in neighboring cells (Itoh, 2003).

The role for mib in promoting endocytosis in the signal-delivering cell, as demonstrated in this study, is similar to one role proposed for neur in Drosophila. In vertebrates, however, neur seems to have a much more limited role than has been demonstrated for it in Drosophila. Mice that are homozygous for a neur loss-of-function mutation have restricted defects: one study demonstrated defects in spermatogenesis and in mammary gland development, while another study has shown ethanol hypersensitivity and an olfactory discrimination defect. In Xenopus, interfering with neur function by overexpressing either wild-type Neur or a mutant form that lacks the RING finger domain increases the density of ciliated cells in the epidermis . But none of these studies revealed the dramatic neural phenotypes or defects in somitogenesis that are seen when there is broad loss of Notch signaling. In contrast, mib mutants do show widespread abnormalities, suggesting a deficit in many more Notch-dependent developmental events. Currently being investigated are whether mib has assumed some roles that were originally played by neur in Drosophila or whether a cooperative role for neur and mib in Notch signaling limits the deficit caused by loss of neur alone in vertebrates (Itoh, 2003).

In summary, the analysis of the zebrafish mib mutant has led to the identification of a gene that is essential for effective Notch signaling in many different tissues during development. The function of Mib as a ubiquitin ligase in the internalization of Delta provides new avenues for clarifying the mystery of how endocytosis may increase the ability of cell surface Delta to deliver lateral inhibition signals (Itoh, 2003).

The cleavage of Notch by presenilin (PS)/gamma-secretase is a salient example of regulated intramembrane proteolysis, an unusual mechanism of signal transduction. This cleavage is preceded by the binding of protein ligands to the Notch ectodomain, activating its shedding. It was hypothesized that the Notch ligands, Delta and Jagged, themselves undergo PS-mediated regulated intramembrane proteolysis. The ectodomain of mammalian Jagged is shown to be cleaved by an A disintegrin and metalloprotease (ADAM) 17-like activity in cultured cells and in vivo, similar to the known cleavage of Drosophila Delta by Kuzbanian. The ectodomain shedding of ligand can be stimulated by Notch and yields membrane-tethered C-terminal fragments (CTFs) of Jagged and Delta that accumulate in cells expressing a dominant-negative form of PS or treated with gamma-secretase inhibitors. PS forms stable complexes with Delta and Jagged and with their respective CTFs. PS/gamma-secretase then mediates the cleavage of the latter to release the Delta and Jagged intracellular domains, a portion of which can enter the nucleus. The ligand CTFs compete with an activated form of Notch for cleavage by gamma-secretase and can thus inhibit Notch signaling in vitro. The soluble Jagged intracellular domain can activate gene expression via the transcription factor AP1, and this effect is counteracted by the co-expression of the gamma-secretase-cleaved product of Notch, Notch intracellular domain. It is concluded that Delta and Jagged undergo ADAM-mediated ectodomain processing followed by PS-mediated intramembrane proteolysis to release signaling fragments. Thus, Notch and its cognate ligands are processed by the same molecular machinery and may antagonistically regulate each other's signaling (LaVoie, 2003).

The evolutionary conserved Notch signaling pathway is involved in cell fate specification and mediated by molecular interactions between the Notch receptors and the Notch ligands -- Delta, Serrate, and Jagged. Like Notch, Delta1 and Jagged2 are subject to presenilin (PS)-dependent, intramembranous 'gamma-secretase' processing, resulting in the production of soluble intracellular derivatives. Moreover, and paralleling the observation that expression of familial Alzheimer's disease-linked mutant PS1 compromises production of Notch S3/NICD, the PS-dependent production of Delta1 cytoplasmic derivatives are also reduced in cells expressing mutant PS1. These studies led to the conclusion that a similar molecular apparatus is responsible for intramembranous processing of Notch and it's ligands. To assess the potential role of the cytoplasmic derivative on nuclear transcriptional events, a Delta1-Gal4VP16 chimera was expressed and marked transcriptional stimulation of a luciferase-based reporter was demonstrated. These findings suggest that Delta1 and Jagged2 play dual roles as activators of Notch receptor signaling and as receptors that mediate nuclear signaling events via gamma-secretase-generated cytoplasmic domains (Ikeuchi, 2003).

Although Notch plays a crucial role in T cell development, regulation of Notch signaling in the thymus is not well understood. Kuzbanian, an ADAM protease, has been implicated in the cleavage of both Notch receptors and the Notch ligand, Delta. In this study it was shown that the expression of a dominant-negative form of Kuzbanian (dnKuz) leads to reduced TCRbeta expression in double-negative thymocytes and to a partial block between the double-negative to double-positive stages of development. These defects were rescued by overexpression of Delta-1 on thymocytes. Mixed chimeras showed a cell-autonomous block by dnKuz, but non-cell-autonomous rescue by Delta-1. This suggests that dnKuz impairs Notch signaling in receiving cells, and increasing Delta-1 on sending cells overcomes this defect. Interestingly, the expression of an activated form of Notch-1 rescued some, but not all, the defects in dnKuz Tg mice. These data suggest that multiple Notch-dependent steps in early thymocyte development require Kuzbanian, but differ in the involvement of other Notch signaling components (Manilay, 2005: full text of article).

Transcriptional regulation of Delta homologs

The Notch signaling cascade is involved in many developmental decisions: one paradigm involving Notch has been the selection between epidermal and neural cell fates in both invertebrates and vertebrates. Notch has also been implicated as a regulator of myogenesis, although its precise function there has remained controversial. The muscle-determining factor MyoD is a direct, positive regulator of the Notch ligand Delta-1 in prospective myoblasts of the pre-involuted mesoderm in Xenopus gastrulae. Injection of a dominant MyoD repressor variant ablates mesodermal Delta-1 expression in vivo. Furthermore, MyoD-dependent Delta-1 induction is sufficient to activate transcription from promoters of E(spl)-related genes in a Notch-dependent manner. These results indicate that a hallmark of neural cell fate determination, i.e. the feedback loop between differentiation promoting basic helix-loop-helix proteins and the Notch regulatory circuitry, is conserved in myogenesis, supporting a direct involvement of Notch in muscle determination (Wittenberger, 1999).

As a first step to identify upstream factors regulating Delta1 expression in different tissues, a search was carried out for cis-regulatory regions in the Delta1 promoter able to direct heterologous gene expression in a tissue specific manner in transgenic mice. A 4.3 kb genomic DNA fragment of the Delta1 gene is sufficient in a lacZ reporter transgene to reproduce most aspects of Delta1 expression from the primitive streak stage to early organogenesis. Using a minimal Delta1 promoter this upstream region has been shown to contain distinct regulatory modules that individually direct tissue-specific transgene expression in subdomains of the endogenous expression pattern. It appears that expression in the paraxial mesoderm depends on the interaction of multiple positive and negative regulatory elements. At least some regulatory sequences required for transgene expression in subdomains of the neural tube have been maintained during the evolution of mammals and teleost fish, suggesting that part of the regulatory network that controls expression of Delta genes may be conserved (Beckers, 2000).

The comparison of the available upstream sequences from mouse and zebrafish has identified two regions of homology (Homology I and II). Both conserved regions direct transgene expression reproducibly in distinct regions of the neural tube and, when they are absent from reporter gene constructs, these aspects of Delta1 expression are lost. This suggests that these regions contain element(s) that are necessary and sufficient for Delta1 transcription in subsets of neuroectoderm cells. The sequence conservation of both neuronal elements suggests that in the neuroectoderm at least some interactions of transcription factors with Delta promoters are conserved between mammals and teleosts. Both conserved sequence blocks contain multiple binding sites for known transcription factors. For example, E-boxes thought to be involved in bHLH-factor dependent transcriptional activation, are located in Homology I as well as in Homology II. Similar to the two `msd' regions in the Delta1 promoter, the zebrafish deltaD promoter contains a distal and a prox- imal mesodermal enhancer region directing reporter gene expression in the paraxial mesoderm of transgenic zebrafish. However, in contrast to the elements for neural expression (HI and HII), the mesodermal elements of the mouse Delta1 promoter do not share significant sequence homologies with the zebrafish deltaD promoter. This suggests that the regulatory sequences (and the corresponding transcription factors) that direct mesodermal expression have considerably diverged during evolution. Alternatively, since the Delta1 promoter appears to consist of modules that can interact with the minimal promoter in different distances, it is possible that the mesodermal elements in the zebrafish corresponding to the mouse 'msd' regions reside in a portion of the zebrafish promoter outside the analyzed region. In the somitic mesoderm the expression pattern of the zebrafish deltaC gene resembles that of the mouse Delta1 gene, since its expression is also restricted to posterior somite compartments. Sequence comparisons between the mouse Delta1 and the zebrafish deltaC gene could be helpful in identifying potential elements that may repress expression in anterior somite compartments -- if the transcription factors for this regulation have been conserved during vertebrate evolution (Beckers, 2000).

Notch signaling has a central role in cell fate specification and differentiation. Evidence is provided that the Mash1 (bHLH) and Dlx1 and Dlx2 (homeobox) transcription factors have complementary roles in regulating Notch signaling, which in turn mediates the temporal control of subcortical telencephalic neurogenesis in mice. Progressively more mature subcortical progenitors (P1, P2 and P3) are defined through their combinatorial expression of MASH1 and DLX2, as well as the expression of proliferative and postmitotic cell markers at E10.5-E11.5. In the absence of Mash1, Notch signaling is greatly reduced and 'early' VZ progenitors (P1 and P2) precociously acquire SVZ progenitor (P3) properties. Comparing the molecular phenotypes of the delta-like 1 and Mash1 mutants, suggests that Mash1 regulates early neurogenesis through Notch-and Delta-dependent and -independent mechanisms. While Mash1 is required for early neurogenesis (E10.5), Dlx1 and Dlx2 are required to downregulate Notch signaling during specification and differentiation steps of 'late' progenitors (P3). Dlx1/2 function appears to be required to specify and differentiate P3 progenitors by repressing the genes that are normally expressed in VZ progenitor cells (e.g. Mash1, Gsh1/2, Lhx2, COUP-TF1) and by activating genes expressed in the SVZ (e.g. Dlx5, Dlx6 and SCIP/Oct6) and MZ (e.g. Drd2). It is suggested that alternate cell fate choices in the developing telencephalon are controlled by coordinated functions of bHLH and homeobox transcription factors through their differential affects on Notch signaling (Yun, 2002).

Dlx1/2 mutants exhibit increased levels of Hes5 expression, implying that differentiation may be blocked due to increased levels of Notch signaling. At E11.5 Dll1 (a Delta homolog) and Mash1 expression are elevated in the SVZ; these abnormalities become more severe at later stages. As MASH1 and DLX2 are co-expressed in some progenitors (P3), a potential mechanism underlying this phenotype would be that Dlx1 and Dlx2 repress Mash1 expression (directly or indirectly) as P3 cells mature. In Dlx1/2 mutants, failure to downregulate Mash1 expression would lead to elevated levels of Dll1 expression; this, in turn, would increase Notch signaling and Hes5 expression in adjacent cells (Yun, 2002).

Notch signaling in the presomitic mesoderm (psm) is critical for somite formation and patterning. WNT signals regulate transcription of the Notch ligand Dll1 in the tailbud and psm. LEF/TCF factors cooperate with TBX6 to activate transcription from the Dll1 promoter in vitro. Mutating either T or LEF/TCF sites in the Dll1 promoter abolishes reporter gene expression in vitro as well as in the tail bud and psm of transgenic embryos. These results indicate that WNT activity, in synergy with TBX6, regulates Dll1 transcription and thereby controls Notch activity, somite formation, and patterning (Hofmann, 2004).

Wnt signaling, which is mediated by LEF1/TCF transcription factors, has been placed upstream of the Notch pathway in vertebrate somitogenesis. The molecular basis for this presumed hierarchy has been examined and it has been shown that a targeted mutation of Lef1, which abrogates LEF1 function and impairs the activity of coexpressed TCF factors, affects the patterning of somites and the expression of components of the Notch pathway. LEF1 was found to bind multiple sites in the Dll1 promoter in vitro and in vivo. Moreover, mutations of LEF1-binding sites in the Dll1 promoter impair expression of a Dll1-LacZ transgene in the presomitic mesoderm. Finally, the induced expression of LEF1-ß-catenin activates the expression of endogenous Dll1 in fibroblastic cells. Thus, Wnt signaling can affect the Notch pathway by a LEF1-mediated regulation of Dll1 (Galceran, 2004).

The transcriptional repressor Tel plays an evolutionarily conserved role in angiogenesis: it is indispensable for the sprouting of human endothelial cells and for normal development of the Danio rerio blood circulatory system. Tel orchestrates endothelial sprouting by binding to the generic co-repressor, CtBP. The Tel-CtBP complex temporally restricts a VEGF (vascular endothelial growth factor)-mediated pulse of dll4 expression and thereby directly links VEGF receptor intracellular signalling and intercellular Notch-Dll4 signalling. It further controls branching by regulating expression of other factors that constrain angiogenesis such as sprouty family members and ve-cadherin. Thus, the Tel-CtBP complex conditions endothelial cells for angiogenesis by controlling the balance between stimulatory and antagonistic sprouting cues. Tel control of branching seems to be a refinement of invertebrate tracheae morphogenesis that requires Yan, the invertebrate orthologue of Tel. This work highlights Tel and its associated networks as potential targets for the development of therapeutic strategies to inhibit pathological angiogenesis (Roukens, 2010).

cis-Decoder discovers constellations of conserved DNA sequences shared among tissue-specific enhancers: Analysis of Dll1 enhancers

A systematic approach is described for analysis of evolutionarily conserved cis-regulatory DNA using cis-Decoder, a tool for discovery of conserved sequence elements that are shared between similarly regulated enhancers. Analysis of 2,086 conserved sequence blocks (CSBs), identified from 135 characterized enhancers, reveals most CSBs consist of shorter overlapping/adjacent elements that are either enhancer type-specific or common to enhancers with divergent regulatory behaviors. These findings suggest that enhancers employ overlapping repertoires of highly conserved core elements (Brody, 2007).

Analysis of mammalian cis-regulatory sequences included 14 neural and 21 mesodermal enhancers whose regulatory behaviors have been characterized in developing mouse embryos. EvoPrints of these enhancers included orthologs from placental mammals (human, chimp, rhesus monkey, cow, dog, mouse, rat) or also included the opossum; these species afford enough additive divergence (~200 My) to resolve most enhancer Multi-Species Conserved Sequences (MCSs). When possible, chicken and frog orthologs were also included in the EvoPrints. Except when EvoDifference profiles revealed sequencing gaps or genomic rearrangements in one or more species that were not present in the majority of the different orthologous DNAs, pair-wise reference species versus test species readouts from all of the above BLAT formatted genomes were used to generate the EvoPrints (Brody, 2007).

Using the EvoPrint-Parser program, both forward and reverse-complement sequences of each enhancer CSB of 6 bp or greater were extracted, named and consecutively numbered. Based on their enhancer regulatory expression pattern, CSBs were grouped into two different CSB-libraries, neural and mesodermal. Although there exists a distinction between expression in either neural or mesodermal tissues, each of the CSB-libraries represent a heterogeneous population of enhancers that drive gene expression in different cells and/or different developmental times in these tissues. For this study, CSBs of 5 bp or less were not included in the analysis. Although these shorter CSBs, particularly the 5 and 4 bp CSBs, are most likely important for enhancer function, the use of CSBs of 6 bp or larger (representing greater than 80% of the conserved MCS sequences) is sufficient to resolve sequence element differences between enhancers that regulate divergent expression patterns. A total of 286 neural CSBs and 289 mesodermal CSBs were extracted from the mammalian enhancers (Brody, 2007).

For Drosophila, three CSB-libraries, neural, segmental and mesodermal, were generated from CSBs identified by EvoPrinting : neural enhancers included those regulating both CNS and peripheral nervous system (PNS) determinants; segmental enhancers included those regulating both pair-rule and gap gene expression; and mesodermal enhancers included those regulating both presumptive and late expression. Many of the D. melanogaster reference sequences used to initiate the EvoPrints were curated from the regulatory element database REDfly, while others were identified from their primary reference. The collection of neural enhancers includes both those that direct expression during early development, such as the snail , scratch, and deadpan CNS and PNS enhancers, and late nervous system regulators, such as the eyeless enhancer ey12, which confers expression in the adult brain. The early embryonic segmental enhancers represent pair-rule regulators such as the hairy stripe 1 and even-skipped stripe 1 enhancers, and gap expression regulators, such as the hunchback enhancers. The mesodermal enhancers include those directing mesodermal anlage expression of snail and tinman , and late expressing enhancers, such as those directing serpent fat body expression and mesodermal expression of Sex combs reduced. The collective evolutionary divergence of all of the EvoPrints was greater than 100 My and in most cases EvoPrints represented over approximately 160 My of additive divergence. The average CSB length for both the Drosophila and mammalian CSBs is 13 bp; the longest identified CSBs were 99 bp from the giant (-10) segmental enhancer and 95 bp from the Paired-like homeobox-2b mammalian neural enhancer (Brody, 2007).

As an initial step toward understanding the nature of the CSB substructure, a set of DNA sequence alignment tools, known collectively as cis-Decoder, were developed that allow identification of 6 bp or greater perfect match identities, called cis-Decoder Tags (cDTs), within two or more CSBs from either similar or divergent enhancers. The cDTs, which range in size from 6 to 14 bp with an average of 7 or 8 bp, are organized into cDT-libraries that identify sequence elements within CSBs of the same CSB-library. In addition, common cDT-libraries that represent sequence elements aligning to CSBs of two or more different CSB-libraries were also organized (Brody, 2007).

Mammalian CSB alignments, using the CSB-aligner program, yielded 336 neural specific and 60 neural-enriched cDTs and analysis of the mammalian mesodermal CSBs yielded 258 mesodermal specific and 55 mesodermal enriched cDTs. The CSB alignments also produced 137 cDTs that are common to both neural and mesodermal CSBs. Alignments of the Drosophila enhancer CSBs yielded 444 neural specific cDTs (showing no hits on mesodermal or segmental enhancer CSBs), 284 segmental enhancer specific cDTs and an additional 451 cDTs found in neural and segmental enhancers but not part of mesodermal CSBs. Also 451 cDTs were identified that were enriched in neural and/or segmental CSBs but were also found at a lower frequency in mesodermal enhancer CSBs. From the mesodermal CSBs analyzed, 169 mesodermal specific cDTs (not in neural or segmental enhancer CSBs) were identified along with 104 additional cDTs enriched in mesodermal enhancers but also found at a lower frequency among neural and/or segmental enhancer CSBs. A common cDT-library was also generated that contains 993 cDTs that represent common sequence elements found in CSBs of both neural and mesodermal enhancers (Brody, 2007).

The constituent sequence elements of the different cDT-libraries are dependent on the enhancers used to identify them. As additional CSBs are included in the cDT-library construction, certain cDTs may be re-designated. For example, some that are currently considered neural specific will be discovered to be neural enriched, and others that are part of enriched libraries may be reassigned to common cDT-libraries (Brody, 2007).

Although each mammalian and fly cDT is present in at least two or more enhancers, most are not found as repeated sequences in any of the enhancers. In addition, one of the principle observations of this analysis is that enhancers of similarly regulated genes share different combinatorial sets of elements that are enhancer-type specific (Brody, 2007).

Cross-library CSB alignments revealed that nearly all CSBs contain cDTs that are either shared by CSBs from divergent enhancer types or found only in CSBs from enhancers with related regulatory functions. For example, the 37 bp neural mastermind #10 CSB (TATTATTACTATATACAATATGGCATATTATTATTAC) contains a 9 bp sequence (first underlined sequence) also found in the 20 bp #8 CSB from the dpp mesodermal enhancer and it also contains a 14 bp sequence (second underlined sequence) that constitutes the entire 14 bp #33 CSB from the neural enhancer region of nerfin-1 (Brody, 2007).

The analysis of both the mammalian and fly common cDT-libraries reveals that many cDTs contain core recognition sequences for known transcription factors. However, when additional flanking CSB sequences are considered, many common transcription factor binding sites become tissue specific cDTs. For example, the DNA-binding site for basic helix-loop-helix (bHLH) transcription factors, the E-box motif CAGCTG is present 22 times in different neural CSBs, and 2 and 4 times within the CSBs of segmental and mesodermal enhancers, respectively. However, when flanking sequences are included in the analysis, such as the sequences CAGCTGG, CAGCTGAT, CAGCTGTG, CAGCTGCA, CAGCTGCT and ACAGCTGCC, all are neural specific cDTs (E-box underlined). It has been previously shown that different E-boxes bind different bHLH transcription factors to regulate different neural target genes. Although transcription factor consensus DNA-binding sites are well represented in the cDT-libraries, greater than 50% of the cDTs in all of the libraries, both mammalian and fly, represent novel sequences whose function(s) are currently unknown. The fact that there exists such a high percentage of novel sequences within these highly conserved sequences indicates that the identity, function and/or the combinatorial events that regulate enhancer behavior are as yet unknown (Brody, 2007).

Although the resolution of cis-Decoder analysis increases as more enhancers and/or enhancer types are included in the CSB and cDT alignments, analysis of mammalian enhancers found that many shared sequence elements can be identified among related enhancers when as few as two different enhancer groups are used to generate specific cDT-libraries. This is a particularly useful feature of cis-Decoder, especially when studying a biological process or developmental event where relatively little is known about the participating genes and their controlling enhancers. To demonstrate the ability of cis-Decoder to analyze relatively small subsets of enhancers, this study showed how cDT-libraries generated from 14 neural and 21 mesodermal mammalian enhancers can be used to distinguish between the neural and mesodermal enhancers that regulate embryonic expression of Dll1 (Brody, 2007).

Dll1 encodes a Notch ligand that is essential for cell-cell signaling events that regulate multiple developmental events. Studies in the mouse reveal that Dll1 is dynamically expressed in specific regions of the developing brain, spinal cord and also in a complex pattern within the embryonic mesoderm. The 1.6 kb Dll1 cis-regulatory region, located 5' to its transcribed sequence, has been shown to contain distinct enhancers that direct gene expression in these different tissues. These studies have identified two highly conserved neural enhancers, designated Homology I (H-I) and Homology II (H-II), and two mesodermal enhancers termed msd and msd-II. The H-I enhancer directs expression to the ventral neural tube, while the H-II enhancer primarily drives Dll1 expression in the marginal zone of the dorsal region of the neural tube. The msd enhancer drives expression in paraxial mesoderm, and msd-II directs Dll1 expression to the presomitic and somitic mesoderm (Brody, 2007).

An EvoPrint of the Dll1 cis-regulatory region reveals clustered CSBs in each of the enhancer regions. The EvoPrint analysis used mouse (reference DNA), human, rhesus monkey, cow, rat, opossum and Xenopus tropicalis orthologs, representing over approximately 240 My of collective evolutionary divergence. EvoPrint-parser CSB extraction of the EvoPrint generated a total of 35 CSBs of 6 bp or longer, representing 83% of the total MCS. A cDT-scan of the four Dll1 enhancer regions using the mammalian neural and mesodermal specific cDT-libraries accurately differentiates between the neural and mesodermal enhancers. The cDT-library scan identified 77 type-specific sequence elements within the Dll1 CSBs and over half (52%) align with three or more CSBs from different enhancers, indicating that, even if Dll1 had been excluded from the analysis that generated the specific cDT-libraries, there would still be extensive coverage of the Dll1 CSBs by type-specific cDTs. All but eight of the CSBs contain elements that align with one or more neural or mesodermal specific cDTs. The H-I and H-II early CNS enhancers exhibited 64% and 43% coverage, respectively, by neural specific cDTs. The CSBs of the two mesodermal enhancers, msd and msd-II, exhibited 48% and 56% coverage, respectively, by one or more mesodermal specific cDTs. When common cDTs, shared by mesodermal and neural enhancers, were taken into account, coverage of all four enhancers was 81% (Brody, 2007).

cDT-cataloger analysis of aligning cDTs with H-I and H-II early CNS enhancers revealed that the H-I enhancer shares a remarkable 9 different sequence elements with the Wnt-1 early CNS neural plate enhancer CSBs, representing 62 bp (32%) of the H-I CSB coverage, 7 elements with the Paired-like homeobox-2b (Phox2b) hindbrain-sensory ganglia enhancer CSBs (23% coverage) and 6 sequence elements (20% coverage) with the Sox9p hindbrain-spinal cord enhancer CSBs as well as numerous other neural specific elements in common with CSBs of other neural enhancers. Comparisons of Dll1 H-I, Wnt-1, Phox2b and Sox9p enhancer CSBs reveal that the orientation and order of the shared cDTs are unique for each of the enhancers. The H-I and H-II enhancer CSBs also share the 7 bp sequence element GCTCCCC, and H-I has a repeat sequence element (AGTTAAA) that is present in two of its CSBs. The conserved AGTTAAA repeat is also part of a CSB in Phox2b enhancer. cDT-cataloger analysis of the mesodermal enhancer cDT hits reveals that, together, msd and msd-II share 7 elements in common with the mesodermal enhancer of Nkx2.5 as well as numerous elements in common with CSBs of other mesodermal enhancers (Brody, 2007).

To demonstrate the ability of cis-Decoder to differentiate between Drosophila neural and mesodermal enhancers, an analysis was performed of the snail upstream cis-regulatory region. The enhancers that regulate snail's dynamic embryonic expression have been mapped to a 2,974 bp upstream DNA fragment. An EvoPrint of this sequence reveals that each of the restriction fragments that contain the different enhancer activities (CNS, mesodermal and PNS) harbor clusters of highly conserved CSBs. The combined evolutionary divergence of the snail upstream EvoPrint (generated from Drosophila melanogaster, D. sechellia, D. yakuba, D. erecta, D. ananassae, D. pseudoobscura, D. mojavensis, D. virilis and D. grimshawi orthologous sequences) is approximately 160 My, suggesting that many, if not all, of the identified CSBs are likely to be genus invariant and that each base-pair within a CSB has been evolutionarily challenged (Brody, 2007).

To identify sequence elements within the snail upstream CSBs that are present in CSBs of other functionally related or unrelated enhancers, a cDT-scan of the snail EvoPrint was carried out using the neural, segmental and mesodermal specific cDTs and the enriched cDT-libraries. Within the snail early CNS neuroblast enhancer region, the cDT-library scan identified 22 different neural and neural/segmental cDT hits, distributed among all but one of the CSBs, covering 73% of the CSBs. Interestingly, 10 of the 22 cDTs that align with the early CNS enhancer CSBs are found in CSBs of both neural and segmentation enhancers. The high percentage of neural/segmental cDT hits most likely reflects the fact that this enhancer initially drives snail expression in the neuroectoderm in a pair-rule pattern and then in a segmental pattern corresponding to the first wave of delaminating neuroblasts. cDT-cataloger analysis of the aligning cDTs reveals that many of the identified sequence elements are also part of other early neuroblast enhancer CSBs. For example, the 9 bp cDTs ATTCCTTTC, ATTGATTGT, ATTGTGCAA, TGCAATGCA and GATTTATGG are also present, respectively, in CSBs from the nerfin-1, biparous, string, scratch and worniu neuroblast enhancers (Brody, 2007).

Within the presumptive mesodermal enhancer CSBs, 11 cDTs mesodermal specific aligned with 5 of the 12 CSBs, covering 40% of the CSBs. Like the neural cDTs, some of the mesodermal cDTs contain putative DNA-binding sites for classes of known transcription factor families. For example, the seventh cDT (TAATTGGA) contains a consensus core DNA-binding sequence (underlined) for Antennapedia class homeodomain factors (Brody, 2007).

In the snail early PNS enhancer region, 5 of the 7 CSBs aligned with a total of 15 different cDTs that cover 69% of the total PNS CSB sequence. Similar to the CNS enhancer CSB cDT alignments, close to half of the PNS cDT hits represent sequence elements within both neural and segmental enhancer CSBs, again most likely a reflection of the segmental structure of the PNS. The significant overlap in cDTs found in both CNS and PNS enhancer CSBs may reflect the likelihood that many early neural specific transcriptional regulatory factors are pan-neural (Brody, 2007).

Many of the snail enhancer CSB-cDT hits represent sequences found only in two CSBs, snail itself and one other. In these instances it appears that these elements, although specific for neural or mesodermal CSBs, are relatively rare when compared to others. Only through analysis of additional enhancers will it be clear whether these rare elements are indeed type-specific or only enriched in the type-specific CSBs. Nevertheless, the fact that the sequence elements identified by these rare cDTs are conserved in two distinct enhancer CSBs that have both been under positive selection for over 160 My of collective divergence merits their inclusion in the analysis (Brody, 2007).

As part of this study of Drosophila enhancers, cis-Decoder analysis was carried out of 38 segmentation enhancers responsible for both gap and pair-rule gene expression during Drosophila embryogenesis. Although the segmentation enhancer specific library consisted of only 284 cDTs, these cDTs aligned with over 70% of bases of the CSBs of segmentation enhancers. As an example of alignment of these cDTs with a segmental enhancer, an alignment of segmentation specific cDTs with the hairy stripe 1 enhancer is presented. cis-Decoder recognizes highly conserved Abdominal-B, HOX, Hunchback, Kruppel and Tramtrack binding sites, as well as additional uncharacterized sites, as being shared by hairy stripe 1 enhancer and other segmentation enhancers (Brody, 2007).

Although cDT-libraries were initially generated from general classes of different enhancer types, this approach should be applicable to the analysis of gene co-regulation in any cell type involved in any biological event. As the variety and depth of the different cDT-libraries increase, it is thought that cDT-library scans of EvoPrinted putative enhancer regions will have great utility for the identification and initial characterization of cis-regulatory sequences. Future efforts that address the role of individual enhancer CSBs and the dissection of their modular elements will undoubtedly yield new insights into the function of these 'evolutionarily hardened' sequences and ultimately produce a better understanding of the regulatory code underlying coordinate gene expression (Brody, 2007).

Proneural bHLH and Brn proteins coregulate a neurogenic program through cooperative binding to a conserved DNA motif

Proneural proteins play a central role in vertebrate neurogenesis, but little is known of the genes that they regulate and of the factors that interact with proneural proteins to activate a neurogenic program. The proneural protein Mash1 and the POU proteins Brn1 and Brn2 interact on the promoter of the Notch ligand Delta1 and synergistically activate Delta1 transcription, a key step in neurogenesis. Overexpression experiments in vivo indicate that Brn2, like Mash1, regulates additional aspects of neurogenesis, including the division of progenitors and the differentiation and migration of neurons. This study identifies, by in silico screening, a number of additional candidate target genes that are recognized by Mash1 and Brn proteins through a DNA-binding motif similar to that found in the Delta1 gene and present a broad range of activities. It is thus proposed that Mash1 synergizes with Brn factors to regulate multiple steps of neurogenesis (Castro, 2006).

Delta1 is a common target of the proneural genes Mash1 and Neurogenin1/2 in mouse embryos. To determine whether Mash1 and Neurogenin1/2 directly transcribe Delta1, the regulatory sequences of this gene were analyzed. Two evolutionarily conserved enhancers active in different CNS regions have been identified in the Delta1 gene. To determine whether these enhancers mediate the regulation of Delta1 by proneural genes, transgenic mouse lines were generated. A transgene containing the full-length 4.3 kb mouse Delta1 promoter driving lacZ was expressed broadly in the embryonic brain and spinal cord at E11.5, in a pattern similar to that of endogenous Delta1. A transgene containing the proximal Delta1 neural enhancer (hereafter called DeltaM) and a minimal promoter driving lacZ was, in contrast, only expressed in parts of the Delta1 expression domain, including the dorsal spinal cord and ventral telencephalon, which also express Mash1. A transgene containing the distal Delta1 enhancer (hereafter called DeltaN) driving lacZ was expressed in a complementary manner in the neural tube, including the ventral spinal cord and dorsal telencephalon, which also express Ngn1 and Ngn2. To test whether these enhancers are regulated by proneural genes, the transgenic lines were bred with proneural null mutant mice. On a Mash1 null mutant background, the DeltaM-lacZ transgene was not expressed in the CNS at E11.5, demonstrating that the DeltaM enhancer requires Mash1 function for its activation. On a Ngn1;Ngn2 double mutant background, the DeltaN-lacZ transgene showed reduced expression in the spinal cord and was not expressed in the brain, except near the hindbrain border, showing that the DeltaN enhancer is activated by Neurogenins (Castro, 2006).

It was next asked whether proneural proteins directly interact with the Delta1 enhancers in the embryonic CNS by performing chromatin immune precipitation (ChIP) experiments. An antibody to Mash1 coprecipitated the DeltaM sequence in chromatin prepared from E12.5 wild-type telencephalon, but not from Mash1 mutant telencephalon, and the antibody did not precipitate the DeltaN sequence or the Delta1 coding sequence. Conversely, an antibody to Ngn2 coprecipitated the DeltaN sequence from wild-type, but not from Ngn2 null mutant telencephalon, and it did not precipitate the DeltaM or Delta1 coding sequences. Therefore, Mash1 and Ngn2 specifically bind in vivo to the DeltaM and DeltaN enhancers, respectively (Castro, 2006).

To further examine the interaction of Mash1 with the DeltaM enhancer, transcription assays were performed in P19 cells. It was first verified that Mash1 induces Delta1 transcription in these cells. After transfection of P19 cells with a Mash1 expression vector, the Mash1 transcript level increased in less than 4 hr, while the Delta1 transcript level increased less than 3 hr later, suggesting that Delta1 is directly transcribed by Mash1 in this system. By performing ChIP experiments with the Mash1 antibody on Mash1-transfected and mock-transfected P19 cells, it was shown that Mash1 specifically binds to the DeltaM sequence, indicating that Mash1 uses the same enhancer element to activate Delta1 in P19 cells and in the embryo. To examine the regulation of DeltaM by Mash1, the DeltaM sequence was inserted in a luciferase reporter vector and its transcriptional activity was tested in P19 cells. The DeltaM reporter was strongly activated when cotransfected with a Mash1 expression construct (Castro, 2006).

Two E-boxes (hereafter called E1-box and E2-box) were identified in the DeltaM sequence that are completely conserved in the human, mouse, chick, and zebrafish Delta1/DeltaD gene. To test whether these motifs mediate the direct binding of Mash1 to DeltaM, the two E-boxes were mutated either separately or together and examined the activity of the resulting DeltaM mutants. Mutation of each E-box separately or the two E-boxes together abolished activation of DeltaM by Mash1 and severely reduced the capacity of Mash1 to activate the full-length Delta1 promoter in P19 cells. A shorter version of DeltaM that mostly contains the 2 E-boxes and the 17 nucleotides in between (DeltaM short was activated by Mash1 as efficiently as DeltaM (Castro, 2006).

To determine whether activation of DeltaM by Mash1 involves motifs other than the two E-boxes, the DeltaM short element was mutated further. Interestingly, a perfect evolutionarily conserved consensus binding site for the POU family of homeodomain proteins, or octamer, is present in this element, one nucleotide 5′ from the E2-box. Point mutations in each half-site of the octamer motif, octT64G and octC68G, known to disrupt the interaction of the octamer with the homeodomain (POUH) and the POU-specific domain (POUS) of POU factors, respectively, abolished activation of DeltaM short by Mash1, and the same mutations introduced in the complete DeltaM element or the full-length Delta1 promoter also severely reduced their activation by Mash1. This raised the possibility that activation of Delta1 by Mash1 requires binding of both Mash1 and a POU protein to adjacent motifs in the DeltaM enhancer (Castro, 2006).

The proximity of the two sites suggested that binding of Mash1 to the E2-box might be influenced by binding of a putative POU protein to the adjacent octamer. To address this possibility, a luciferase reporter vector containing the multimerized E2 sequence and a minimal promoter (E26 construct) was generated, so that the interaction of Mash1 with E2 could be analyzed in P19 cells independently of the rest of the DeltaM element. It was asked whether the octamer sequence adjacent to E2 had an effect on the Mash1::E2 interaction by generating a reporter construct containing three copies of a sequence containing both the octamer and the E2-box in the same configuration as in DeltaM ([oct+E2]3). Mash1 activated this construct more efficiently. Moreover, a mutation in the octamer that interferes with POU protein binding (octT64G abolished activation of (octmut+E2)3 by Mash1, thus suggesting that binding of a POU protein to the octamer sequence increases the efficiency of the Mash1::E2 interaction (Castro, 2006).

This study shows that the activation of Delta1 expression by Mash1, a key aspect of its proneural function, involves a functional synergy between Mash1 and the POU genes Brn1 and Brn2. The synergistic activation of Delta1 by Mash1 and Brn1/2 likely reflects recruitment of Mash1 by a Brn protein to the DeltaM enhancer. Brn1/2 proteins on their own bind strongly to the consensus octamer sequence present in this enhancer, while Mash1 alone binds only poorly to the adjacent E2-box, but Mash1 efficiently forms a complex with Brn proteins on the octamer-E2 motif. The configuration of this binding motif plays an essential role in the recruitment process, since increasing the distance between the octamer and the E2-box by just one nucleotide is sufficient to abolish Mash1 recruitment and enhancer activity. The importance of keeping the two DNA-binding sites in close proximity strongly suggests that Mash1-E47 and Brn1/2 physically interact when bound to DNA (Castro, 2006).

The interaction of Mash1 and Brn proteins may also enhance the transcriptional activity of the complex. This is another well-documented mechanism of functional synergy, operating, for example, in the interaction between NeuroM, Isl1, and Lhx3 on the HB9 promoter. Although the primary mechanism underlying the functional synergy of Mash1 and Brn1/2 on the Delta1 promoter is cooperative binding to DNA, the role of Brn proteins does not appear to be restricted to Mash1 recruitment. Indeed, direct binding of Mash1 to the Mash1/Brn motif in the absence of Brn protein binding, e.g., when the low-affinity E2-box sequence in the Mash1/Brn motif is converted to a high-affinity one, is not sufficient to activate a Delta1 reporter construct. This suggests that Brn1/2 also potentiate the transcriptional activity of Mash1, perhaps by recruiting an essential coactivator or by initiating a conformational change that exposes the Mash1 activation domain (Castro, 2006).

An evolutionarily conserved Mash1/Brn-binding motif was found in the vicinity of 21 mouse genes. Six of them are components of the Notch pathway, which, together with the finding that a dominant-negative Brn construct blocks Notch activity in the chick neural tube, suggests that Mash1/Brn protein complexes play a major role in regulating Notch signaling in the CNS. Other genes associated with a Mash1/Brn motif also have important roles in neural development but act independently of Notch signaling. This is notably the case of Dcamkl1 or doublecortin-like kinase, a microtubule-associated protein that has recently been implicated in multiple aspects of development of the cerebral cortex, including cell cycle progression, neuronal commitment, neuronal migration, and axon growth (Castro, 2006).

Some of the other genes associated with a Mash1/Brn motif have not been previously studied in the developing nervous system, but studies in other systems suggest that they may also have varied functions during neurogenesis downstream of Mash1 and Brn1/2. The zinc finger transcription factor Insm1 is regulated by the bHLH gene Neurogenin3 in the pancreas, where it promotes neuroendocrine cell differentiation. Fbw7 is an ubiquitin ligase with an important role in promoting cell cycle arrest in G1/G0 through degradation of cyclin E, c-myc, and c-jun. Fbw7 has also been implicated in degradation of Notch1 (Castro, 2006).

These data thus support the idea that Mash1 acts in synergy with Brn proteins to activate a genetic program that controls multiple steps of neurogenesis, including precursor selection through Notch activation, cell cycle exit, neuronal differentiation, and migration. Analysis of Brn1/Brn2 double mutant mice has shown that these two genes regulate neuronal migration and the proliferation of subventricular zone precursors in the cerebral cortex, a region where neurogenesis is primarily regulated by the proneural gene Ngn2. Whether Brn1/Brn2 mutant mice also display neurogenesis defects in regions where Mash1 is the main proneural gene remains to be analyzed (Castro, 2006).

An important question raised by these results is whether Mash1 regulates aspects of neurogenesis independently of Brn proteins. In support of this notion, additional direct targets of Mash1 have been identified in the brain that are not associated with a conserved Mash1/Brn motif. Moreover, a study of Mash1 function in a neuroendocrine prostate cell line has revealed a number of putative direct targets in this tissue that are not associated with a conserved Mash1/Brn motif, and some of these genes are also regulated by Mash1 in the telencephalon in overexpression experiments. These different findings thus support a model whereby Mash1 interacts with different DNA-binding cofactors to activate different subprograms of neurogenesis, similar to the regulation of different subprograms of myogenesis by MyoD (Castro, 2006).

The Wnt/beta-catenin pathway is evolutionary conserved signaling system that regulates cell differentiation and organogenesis. Endothelial specific stabilization of Wnt/beta-catenin signaling alters early vascular development in the embryo. The phenotype resembles that induced by upregulation of Notch signaling, including lack of vascular remodeling, altered elongation of the intersomitic vessels, defects in branching, and loss of venous identity. Both in vivo and in vitro data show that beta-catenin upregulates Dll4 transcription and strongly increases Notch signaling in the endothelium, leading to functional and morphological alterations. The functional consequences of beta-catenin signaling depend on the stage of vascular development and are lost when a gain-of-function mutation is induced at a late stage of development or postnatally. These findings establish a link between Wnt and Notch signaling in vascular development. It is proposed that early and sustained beta-catenin signaling prevents correct endothelial cell differentiation, altering vascular remodeling and arteriovenous specification (Corada, 2010).

The N-Myc-DLL3 cascade is suppressed by the ubiquitin ligase Huwe1 to inhibit proliferation and promote neurogenesis in the developing brain

Self-renewal and proliferation of neural stem cells and the decision to initiate neurogenesis are crucial events directing brain development. The ubiquitin ligase Huwe1 operates upstream of the N-Myc-DLL3-Notch pathway to control neural stem cell activity and promote neurogenesis. Conditional inactivation of the Huwe1 gene in the mouse brain caused neonatal lethality associated with disorganization of the laminar patterning of the cortex. These defects stemmed from severe impairment of neurogenesis associated with uncontrolled expansion of the neural stem cell compartment. Loss- and gain-of-function experiments in the mouse cortex demonstrated that Huwe1 restrains proliferation and enables neuronal differentiation by suppressing the N-Myc-DLL3 cascade. Notably, human high-grade gliomas carry focal hemizygous deletions of the X-linked Huwe1 gene (Drosophila homolog: CG8184) in association with amplification of the N-myc locus. These results indicate that Huwe1 balances proliferation and neurogenesis in the developing brain and that this pathway is subverted in malignant brain tumors (Zhao, 2009).

The expansion of the neural stem cell compartment elicited by loss of Huwe1 becomes progressively more evident as neural development proceeds and Huwe1−/− neural stem/progenitor cells fail to exit cell cycle and commence neuronal differentiation. The deregulated proliferative activity conferred by loss of Huwe1 together with abnormal cell morphology and loss of 'crowd control' ultimately lead to severe perturbation of neuronal differentiation and disorganization of brain architecture. During relatively early stages of neurogenesis (before E14.5), cell cycle timing is not affected by mutation of Huwe1. However, loss of Huwe1 severely impairs the lengthening of the cell cycle that accompanies the progressive shift from proliferation to differentiation during late neurogenesis (Zhao, 2009).

The phenotype of the Huwe1 mutant brain in the mouse is complementary to that caused by inactivation of transcription factors that expand the neural stem cell compartment and inhibit neurogenesis (N-Myc and Notch). The N-Myc protein markedly accumulated in the Huwe1 null brain and this effect preceded the phenotypic defects. To unravel the identity of the downstream signaling events triggered by aberrant N-Myc in Huwe1 null brain, a computational approach was designed to dissect and interrogate the activity of transcription factors following modulation of candidate regulators in a specific cellular context. From this approach, the Notch ligand DLL3 emerged as one of the strongest inferred N-Myc targets in the brain, and it was confirmed that, during neural development, Huwe1 negatively regulates expression of DLL3 in an N-Myc-dependent fashion. Based on this information, DLL3 was experimentally validated as a direct transcriptional target of N-Myc and, most importantly, it was discovered that the hyperproliferation and neuronal differentiation defects resulting from knocking out Huwe1 in the cortex are fully reversed by silencing the expression of DLL3 in vivo. Thus, the N-Myc-DLL3 cascade is restrained by Huwe1 to set the timing of cell cycle withdrawal and neuronal differentiation in the developing brain. Although these results are consistent with DLL3 activating Notch1 in the neural stem cell compartment at midgestation, in other systems DLL3 might also behave as inhibitor of Notch1, possibly through competition with other Notch ligands (Zhao, 2009).

Delta role in vascular development

The Notch signaling pathway is essential for embryonic vascular development in vertebrates. Mouse embryos heterozygous for a targeted mutation in the gene encoding the DLL4 ligand exhibit haploinsufficient lethality because of defects in vascular remodeling. Vascular defects are described in embryos homozygous for a mutation in the Rbpsuh gene, which encodes the primary transcriptional mediator of Notch signaling. Conditional inactivation of Rpbsuh function demonstrates that Notch activation is essential in the endothelial cell lineage. Notch pathway mutant embryos exhibit defects in arterial specification of nascent blood vessels and develop arteriovenous malformations. These results demonstrate that vascular remodeling in the mouse embryo is sensitive to Dll4 gene dosage and that Notch activation in endothelial cells is essential for embryonic vascular remodeling (Krebs, 2004).

Involvement of the Notch signaling pathway in vascular development has been demonstrated by both gain- and loss-of-function mutations in humans, mice, and zebrafish. In zebrafish, Notch signaling is required for arterial identity by suppressing the venous fate in developing artery cells. In mice, the Notch4 receptor and the Delta-like 4 (Dll4) ligand are specifically expressed in arterial endothelial cells, suggesting a similar role. The Dll4 ligand alone is required in a dosage-sensitive manner for normal arterial patterning in development. This implicates Dll4 as the specific mammalian endothelial ligand for autocrine endothelial Notch signaling, and suggests that Dll4 may be a suitable target for intervention in arterial angiogenesis (Duarte, 2004).

In sprouting angiogenesis, specialized endothelial tip cells lead the outgrowth of blood-vessel sprouts towards gradients of vascular endothelial growth factor (VEGF)-A. VEGF-A is also essential for the induction of endothelial tip cells, but it is not known how single tip cells are selected to lead each vessel sprout, and how tip-cell numbers are determined. Evidence that delta-like 4 (Dll4)-Notch1 signalling regulates the formation of appropriate numbers of tip cells to control vessel sprouting and branching in the mouse retina. Inhibition of Notch signalling using gamma-secretase inhibitors, genetic inactivation of one allele of the endothelial Notch ligand Dll4, or endothelial-specific genetic deletion of Notch1, all promote increased numbers of tip cells. Conversely, activation of Notch by a soluble jagged1 peptide leads to fewer tip cells and vessel branches. Dll4 and reporters of Notch signalling are distributed in a mosaic pattern among endothelial cells of actively sprouting retinal vessels. At this location, Notch1-deleted endothelial cells preferentially assume tip-cell characteristics. Together, these results suggest that Dll4-Notch1 signalling between the endothelial cells within the angiogenic sprout serves to restrict tip-cell formation in response to VEGF, thereby establishing the adequate ratio between tip and stalk cells required for correct sprouting and branching patterns. This model offers an explanation for the dose-dependency and haploinsufficiency of the Dll4 gene, and indicates that modulators of Dll4 or Notch signalling, such as gamma-secretase inhibitors developed for Alzheimer's disease, might find usage as pharmacological regulators of angiogenesis (Hellstrom, 2007).

Recent evidence indicates that growing blood-vessel sprouts consist of endothelial cells with distinct cell fates and behaviours; however, it is not clear what signals determine these sprout cell characteristics. This study shows that Notch signalling is necessary to restrict angiogenic cell behaviour to tip cells in developing segmental arteries in the zebrafish embryo. In the absence of the Notch signalling component Rbpsuh (recombining binding protein suppressor of hairless) excessive sprouting of segmental arteries is observed, whereas Notch activation suppresses angiogenesis. Through mosaic analysis it was found that cells lacking Rbpsuh preferentially localize to the terminal position in developing sprouts. In contrast, cells in which Notch signalling has been activated are excluded from the tip-cell position. In vivo time-lapse analysis reveals that endothelial tip cells undergo a stereotypical pattern of proliferation and migration during sprouting. In the absence of Notch, nearly all sprouting endothelial cells exhibit tip-cell behaviour, leading to excessive numbers of cells within segmental arteries. Furthermore, flt4 (fms-related tyrosine kinase 4, also called vegfr3) is expressed in segmental artery tip cells and becomes ectopically expressed throughout the sprout in the absence of Notch. Loss of flt4 can partially restore normal endothelial cell number in Rbpsuh-deficient segmental arteries. Finally, loss of the Notch ligand dll4 (delta-like 4) also leads to an increased number of endothelial cells within segmental arteries. Together, these studies indicate that proper specification of cell identity, position and behaviour in a developing blood-vessel sprout is required for normal angiogenesis, and implicate the Notch signalling pathway in this process (Siekmann, 2007).

The Notch pathway is a highly conserved signaling system that controls a diversity of growth, differentiation, and patterning processes. In growing blood vessels, sprouting of endothelial tip cells is inhibited by Notch signaling, which is activated by binding of the Notch receptor to its ligand Delta-like 4 (Dll4). This study shows that the Notch ligand Jagged1 is a potent proangiogenic regulator in mice that antagonizes Dll4-Notch signaling in cells expressing Fringe family glycosyltransferases. Upon glycosylation of Notch, Dll4-Notch signaling is enhanced, whereas Jagged1 has weak signaling capacity and competes with Dll4. These findings establish that the equilibrium between two Notch ligands with distinct spatial expression patterns and opposing functional roles regulates angiogenesis, a mechanism that might also apply to other Notch-controlled biological processes (Benedito, 2009).

Role of Delta homologs in ear development

The cochlea and vestibular structures of the inner ear labyrinth develop from the otic capsule via step-wise regional and cell fate specification. Each inner ear structure contains a sensory epithelium, composed of hair cells, the mechanosensory transducers, and supporting cells. The spatio-temporal expression of genes in the Notch signaling pathway, Notch receptors (Notch1-4) and two ligands, Jagged1 and Delta1, were examined in the developing mammalian inner ear. Notch1 and Jagged1 are first expressed in the otic vesicle, likely involved in differentiation of the VIIIth nerve ganglion neurons, and subsequently within the inner ear sensory epithelia, temporally coincident with initial hair cell differentiation. Notch1 expression is specific to hair cells and Jagged1 to supporting cells. Their expression persists into adult. Notch2, Notch3, Notch4, and Delta1 are excluded from the inner ear epithelia. These data support the hypothesis that Notch signaling is involved in hair cell differentiation during inner ear morphogenesis (Lewis, 1998).

The sensory patches in the vertebrate ear can be compared with the mechanosensory bristles of a fly. This comparison has led to the discovery that lateral inhibition mediated by the Notch cell-cell signaling pathway, first characterized in Drosophila and crucial for bristle development, also has a key role in controlling the pattern of sensory hair cells and supporting cells in the ear. Here, the arguments are reviewed for considering the sensory patches of the vertebrate ear and bristles of the insect to be homologous structures, evolved from a common ancestral mechanosensory organ, and the role of Notch signaling in each system is examined more closely. Using viral vectors to misexpress components of the Notch pathway in the chick ear, it has been shown that a simple lateral-inhibition model based on feedback regulation of the Notch ligand Delta is inadequate for the ear just as it is for the fly bristle. The Notch ligand Serrate1, expressed in supporting cells in the ear, is regulated by lateral induction, not lateral inhibition; commitment to become a hair cell is not simply controlled by levels of expression of the Notch ligands Delta1, Serrate1, and Serrate2 in the neighbors of the nascent hair cell; and at least one factor, Numb, capable of blocking reception of lateral inhibition, is concentrated in hair cells. These findings reinforce the parallels between the vertebrate ear and the fly bristle and show how study of the insect system can help us understand the vertebrate (Eddison, 2000).

The mammalian auditory sensory epithelium, the organ of Corti, contains sensory hair cells and nonsensory supporting cells arranged in a highly patterned mosaic. Notch-mediated lateral inhibition is the proposed mechanism for creating this sensory mosaic. Mice lacking the Notch ligand JAG2 have been shown to differentiate supernumerary hair cells in the cochlea, consistent with the lateral inhibitory model. However, it was not clear why only relatively modest increases in hair cell production are observed in Jag2 mutant mice. This study shows that another Notch ligand, DLL1, functions synergistically with JAG2 in regulating hair cell differentiation in the cochlea. It was shown by conditional inactivation that these ligands probably signal through the NOTCH1 receptor. Supernumerary hair cells in Dll1/Jag2 double mutants arise primarily through a switch in cell fate, rather than through excess proliferation. Although these results demonstrate an important role for Notch-mediated lateral inhibition during cochlear hair cell patterning, abnormally prolonged cellular proliferation that preferentially affected supporting cells in the organ of Corti was also observed. These results demonstrate that the Notch pathway plays a dual role in regulating cellular differentiation and patterning in the cochlea, acting both through lateral inhibition and the control of cellular proliferation (Kiernan, 2005).

Role of Delta homologs in myogenesis and segmentation

During vertebrate embryonic development, the paraxial mesoderm is subdivided into metameric subunits called somites. The arrangement and cranio-caudal polarity of the somites governs the metamerism of all somite-derived tissues and spinal ganglia. Little is known about the molecular mechanisms underlying somite formation, segment polarity, maintenance of segment borders, and the interdependency of these processes. The mouse Delta homolog Dll1, a member of the DSL gene family, is expressed in the presomitic mesoderm and posterior halves of somites. In Dll1-deficient mouse embryos, a primary metameric pattern is established in mesoderm, and cytodifferentiation is apparently normal, but the segments have no cranio-caudal polarity, and no epithelial somites form. Caudal sclerotome halves do not condense, and the pattern of spinal ganglia and nerves is perturbed, indicating loss of segment polarity. Myoblasts span segment borders, demonstrating that these borders are not maintained. These results show that Dll1 is involved in compartmentalization of somites, that dermomyotome and sclerotome differentiation are independent of formation of epithelia and subdivision of somites in cranial and caudal halves, and that compartmentalization is essential for the maintenance of segment borders in paraxial mesoderm-derived structures (Hrabe de Angelis, 1997).

During vertebrate embryogenesis, paraxial mesoderm gives rise to somites, which subsequently develop into the dermis, skeletal muscle, ribs and vertebrae of the adult. Mutations that disrupt the patterning of individual somites have dramatic effects on these tissues, including fusions of the ribs and vertebrae. The T-box transcription factor, Tbx6, is expressed in the paraxial mesoderm but is downregulated as somites develop. It is essential for the formation of posterior somites, which are replaced with ectopic neural tubes in Tbx6-null mutant embryos. Partial restoration of Tbx6 expression in null mutants rescues somite development, but that rostrocaudal patterning within them is defective, ultimately resulting in rib and vertebral fusions, demonstrating that Tbx6 activity in the paraxial mesoderm is required not simply for somite specification but also for their normal patterning. Somite patterning is dependent upon Notch signaling and Tbx6 is shown to genetically interact with the Notch ligand, delta-like 1 (Dll1). Dll1 expression, which is absent in the Tbx6-null mutant, is restored at reduced levels in the partially rescued mutants, suggesting that Dll1 is a target of Tbx6. The spontaneous mutation rib-vertebrae has been identified as a hypomorphic mutation in Tbx6. The similarity in the phenotypes described in this study and that of some human birth defects, such as spondylocostal dysostosis, raises the possibility that mutations in Tbx6 or components of this pathway may be responsible for these defects (White, 2003).

During Drosophila myogenesis, Notch signaling acts at multiple steps of the muscle differentiation process. In vertebrates, Notch activation has been shown to block MyoD activation and muscle differentiation in vitro, suggesting that this pathway may act to maintain the cells in an undifferentiated proliferative state. In this paper, the role of Notch signaling has been addressed in vivo during chick myogenesis. The Notch1 receptor is expressed in postmitotic cells of the myotome and the Notch ligands Delta1 and Serrate2 are detected in subsets of differentiating myogenic cells and are thus in position to signal to Notch1 during myogenic differentiation. The expression of MyoD and Myf5 during avian myogenesis was investigated, and Myf5 was shown to be expressed earlier than MyoD. Forced expression of the Notch ligand, Delta1, during early myogenesis, using a retroviral system, has no effect on the expression of the early myogenic markers Pax3 and Myf5, but causes strong down-regulation of MyoD in infected somites. Although Delta1 overexpression results in the complete lack of differentiated muscles, detailed examination of the infected embryos shows that initial formation of a myotome is not prevented, indicating that exit from the cell cycle has not been blocked. These results suggest that Notch signaling acts in postmitotic myogenic cells to control a critical step of muscle differentiation (Hirsinger, 2001).

The effect of Notch activation on the expression of the myogenic factors MyoD and Myf5 was assessed 48 hours after infection. In infected somites, MyoD expression is strongly down-regulated in the myotome, whereas Myf5 is still normally expressed. The infected dermomyotome maintains its epithelial structure after it should have undergone an epithelio-mesenchymal transition, allowing the release of dermal precursors. Myf5 is expressed in proliferative cells of the dermomyotome and the dorsal lip in addition to the myotome, whereas MyoD is essentially found in the postmitotic cells of myotome. The absence of MyoD in the infected embryos could be due to an accumulation of proliferative Myf5-expressing cells that are unable to proceed further in their differentiation. This situation would be reminiscent of that in the nervous system where widespread Delta1 overexpression blocks exit of neural progenitor cells from the cell cycle. To examine whether myogenic progenitors are also prevented from exiting the cell cycle, BrdU incorporation together with the expression of MyoD and Myf5 were examined in infected embryos. Postmitotic myogenic cells were found in both infected and uninfected myotomes, indicating that ectopic Notch signaling does not block exit from the cell cycle in this context. This is consistent with the retention of normal, and not dramatically widespread, Pax3 and Myf5 expression in the dermomyotome and myotome. The loss of MyoD expression but maintenance of Myf5 expression in postmitotic cells in the myotomal layer implies that constitutive Notch activation does not affect the production of postmitotic Myf5-expressing cells, but specifically blocks subsequent MyoD expression by these cells (Hirsinger, 2001).

Elaborate metamerism in vertebrate somitogenesis is based on segmental gene expression in the anterior presomitic mesoderm (PSM). Notch signal pathways with Notch ligands Dll1 and Dll3, and the bHLH transcription factor Mesp2 (Mesoderm posterior 2) are implicated in the rostrocaudal patterning of the somite. Changes in the Mesp2 expression domain from a presumptive one somite into a rostral half somite results in differential activation of two types of Notch pathways, dependent or independent of presenilin 1 (Psen1), which is a Notch signal mediator. To further refine this hypothesis, genetic interactions between Dll1, Dll3, Mesp2 and Psen1 have been analyzed, and the roles of Dll1- and Dll3-Notch pathways, with or without Psen1, in rostrocaudal patterning have been elucidated. Dll1 and Dll3 are co-expressed in the PSM and so far are considered to have partially redundant functions. Positive and negative feedback loops comprising Dll1 and Mesp2 appear to be crucial for this patterning; Dll3 may be required for the coordination of the Dll1-Mesp2 loop. Additionally, epistatic analysis reveals that Mesp2 affects rostrocaudal properties more directly than Dll1 or Dll3. Finally, Psen1 is found to be involved differently in the regulation of rostral and caudal genes. Psen1 is required for Dll1-Notch signaling for activation of Dll1, while the Psen1-independent Dll3-Notch pathway may counteract the Psen1-dependent Dll1-Notch pathway. These observations suggest that Dll1 and Dll3 may have non-redundant, even counteracting functions. It is concluded that Mesp2 functions as a central mediator of such Notch pathways and regulates the gene expression required for rostrocaudal patterning of somites (Takahashi, 2003).

To analyze requirements for Notch signalling in patterning the paraxial mesoderm, transgenic mice were generated that express in the paraxial mesoderm a dominant-negative version of Delta1. Transgenic mice with reduced Notch activity in the presomitic mesoderm as indicated by loss of Hes5 expression were viable and displayed defects in somites and vertebrae consistent with known roles of Notch signalling in somite compartmentalization. In addition, these mice showed with variable expressivity and penetrance alterations of vertebral identities resembling homeotic transformations, and subtle changes of Hox gene expression in day 12.5 embryos. Mice that carried only one functional copy of the endogenous Delta1 gene also showed changes of vertebral identities in the lower cervical region, suggesting a previously unnoticed haploinsufficiency for Delta1. Likewise, in mice carrying a null allele of the oscillating Lfng gene, or in transgenic mice expressing Lfng constitutively in the presomitic mesoderm, vertebral identities were changed and numbers of segments in the cervical and thoracic regions were reduced, suggesting anterior shifts of axial identity. Together, these results provide genetic evidence that precisely regulated levels of Notch activity as well as cyclic Lfng activity are critical for positional specification of the anteroposterior body axis in the paraxial mesoderm (Cordes, 2004).

Role of Delta homologs in neural crest development

Neural crest cells migrate segmentally through the rostral half of each trunk somite due to inhibitory influences of ephrins and other molecules present in the caudal-half of somites. To examine the potential role of Notch/Delta signaling in establishing the segmental distribution of ephrins, neural crest migration and ephrin expression were examined in Delta-1 mutant mice. Using Sox-10 as a marker, it was noted that neural crest cells moved through both rostral and caudal halves of the somites in mutants, consistent with the finding that ephrinB2 levels are significantly reduced in the caudal-half somites. Later, mutant embryos had aberrantly fused and/or reduced dorsal root and sympathetic ganglia, with a marked diminution in peripheral glia. These results show that Delta-1 is essential for proper migration and differentiation of neural crest cells. Interestingly, absence of Delta-1 leads to diminution of both neurons and glia in peripheral ganglia, suggesting a general depletion of the ganglion precursor pool in mutant mice (De Bellard, 2002).

Ancient evolutionary origin of the neural crest gene regulatory network

The vertebrate neural crest migrates from its origin, the neural plate border, to form diverse derivatives. It has been hypothesized that a neural crest gene regulatory network (NC-GRN) guides neural crest formation. This study investigated when during evolution this hypothetical network emerged by analyzing neural crest formation in lamprey, a basal extant vertebrate. 50 NC-GRN homologs were identified and morpholinos were used to demonstrate a critical role for eight transcriptional regulators. The results reveal conservation in deployment of upstream factors, suggesting that proximal portions of the network arose early in vertebrate evolution and have been conserved for >500 million years. Biphasic expression was found of neural crest specifiers and differences in deployment of some specifiers and effectors expected to confer species-specific properties. By testing the collective expression and function of neural crest genes in a single, basal vertebrate, the ground state of the NC-GRN was revealed and ambiguities were resolved between model organisms (Sauka-Spengler, 2007).

A uniquely vertebrate innovation, the neural crest is defined by its origin at the neural plate border, migratory capability, multipotentiality, and combinatorial gene expression. As a basal jawless vertebrate, lamprey possesses neural crest cells that move along similar pathways and form many, but not all, neural-crest-derived structures found in jawed vertebrates. However, there is little or no information about early steps in neural crest specification in the lamprey. Analysis of a hypothetical NC-GRN in this basal vertebrate promises to inform on the general architecture and evolutionary history of an archetypical vertebrate gene regulatory network. As both a critical test of this putative network and a representation of its ground state, functional tests were performed involving multiple interactions within a single, basal vertebrate (Sauka-Spengler, 2007).

Fifty genes involved in neural crest formation in lamprey were identified. The findings are consistent with several features of a putative NC-GRN proposed to function in jawed vertebrates, particularly with respect to its proximal elements. Expression of signaling molecules and neural plate border specifiers is highly conserved, as are the functions of border specifiers tested in this study. BMP, Wnt, and Delta expression was found in similar patterns to those noted in frog and zebrafish, suggesting that signaling cues are present in lamprey at proper times and places to play analogous functions in neural crest specification to those in other vertebrates; e.g., Wnt8 is expressed in the nonneural ectoderm abutting the neural rod, much like chick Wnt6. Similarly, lamprey MsxA, ZicA, Dlx, and Pax3/7 are found within and adjacent to the neural plate border, implying that their combinatorial presence in the border is highly conserved across all vertebrate neurulae (Sauka-Spengler, 2007).

In contrast to these proximal steps, distal portions of the gene regulatory network exhibit both conserved and divergent features. The results suggest that neural crest specifiers are activated in two phases, with one set of transcription factors activated at the neural plate border of the early neurula and the other during a second later phase wherein the neural crest in the dorsal neural tube is forming. This differs from the previous formulation of the NC-GRN in which there was no discrimination in the timing of deployment of neural crest specifier genes into early (neural plate border) and late (bona fide neural crest precursor) categories. It is noted that the expression patterns and functions of late neural crest specifiers, like FoxD3 and SoxE family members, in lamprey resemble those observed in other vertebrates, whereas c-Myc, Id, AP2, and Snail are first deployed in the early neurula at the neural plate border rather than in nascent neural crest cells. These early-activated neural crest specifiers are expressed only slightly after the border specifiers, suggesting they may be their direct targets. Furthermore, these genes are involved in cell cycle control and therefore may play a role in maintaining multipotency of neural crest progenitors by acting as a cell cycle control switch between proliferation, cell death, and cell fate decisions (Sauka-Spengler, 2007).

The slow development of lamprey offers the advantage of allowing exquisite temporal resolution not possible in rapidly developing organisms like Xenopus and zebrafish. In jawed vertebrates, c-Myc and its direct target Id3 are expressed at the neural/nonneural ectoderm border prior to Snail1 and Sox8, but after expression of the border specifiers Msx1 and Pax3, whereas Snail2, Sox9, and FoxD3 are expressed by premigratory neural crest. However, the rapid development of Xenopus makes the exact timing of these expression patterns much more difficult to resolve. In amniotes like chick, Id family members are expressed at the neural plate border, together with proto-oncogenes c-Myc and n-Myc and bHLH transcription factor AP2a. In contrast, Sox9, FoxD3, and Snail2 are first expressed in the neural folds, while Sox10 is first expressed in delaminating neural crest. Thus, subdivision of lamprey neural crest specifiers into early- and late-acting categories may reflect either a lack of conservation or a previously unrecognized characteristic of the vertebrate neural crest network in general (Sauka-Spengler, 2007).

A difference in gene expression between lamprey and other species is that Snail is expressed earlier at the lamprey neural plate border, in contrast to its expression in premigratory neural crest in frogs, fish, and birds. Furthermore, the Snail homolog identified does not display a neural-crest-specific pattern at premigratory stages, but rather appears to be ubiquitous, similar to hagfish SnailA, and thus may represent an interesting regulatory difference between cyclostomes and gnathostomes. Similarly, the transcription factor Ets1 is expressed in premigratory, migrating, and postmigratory neural crest in Xenopus and chick and proposed to function in neural crest cell specification. In contrast, no lamprey Ets1 homologs are expressed in the neural crest cells during specification stages; rather, the first expression of both Ets1a and Ets1b is in populations of early differentiating neural crest within the branchial arches. In addition, Ets1b is expressed in hematopoietic and endothelial precursors, similar to its higher vertebrate ortholog implicated in hematopoiesis, vasculogenesis, and angiogenesis; this suggests that the lamprey gene functions hematopoetically while lacking early neural crest specifier function. Along the same lines, Twist is expressed in the premigratory crest in Xenopus, whereas lamprey Twist homologs appear to be expressed only in postmigratory crest cells lining branchial arches and persist in mesenchyme forming buccal cartilage. Extensive searches have yielded four Twist and two Ets1 homologs plus one Ets1-related factor. Given the current genome coverage (~95%), existence of another Twist or Ets1 homolog is unlikely, suggesting that the lamprey genes lack early neural crest specifier function. Intriguingly, these genes may have been co-opted to an earlier function in gnathostomes, lost early specification function in lampreys, or both. In contrast to this apparent lack of conservation, signaling receptors and adhesion and matrix molecules like Neuropilin2, Robo, and Col2a1 have similar expression patterns in gnathostomes and lamprey. An N-cadherin-like adhesion molecule, Cadherin IA, is expressed in neural tube and periocular region, but is absent from branchial arch neural crest population. A type II Cadherin homolog (Cad IIA), similar to Cad-6/7/10/11, shares similarities with all of its gnathostome counterparts and is found in premigratory (in the case of Cad-6) and early migrating (in the case of Cad-7 and Cad-11) neural crest, as well as in differentiating neurogenic derivatives (in the case of Cad-7 and Cad-10) (Sauka-Spengler, 2007).

The cumulative results suggest that lamprey possesses a NC-GRN which is a modified version of that hypothesized to function in gnathostomes (Sauka-Spengler, 2007).

Gain- and loss-of-function experiments performed in various jawed vertebrates give clues about the genetic interactions leading to neural crest specification; e.g., morpholino knockdown of neural plate border specifiers Msx1, Msx2, Pax3, and Zic1 in Xenopus, as well as Pax7 in chick, causes alterations in expression of neural crest specifiers Slug, FoxD3, Sox9, and Sox10. Concomitantly, inactivation of these neural plate border specifiers leads to the expansion of Pax3 and Zic1 and the neural marker Sox2. Inactivation of early (c-Myc, Ids, or AP2) and late (Sox8, Sox9, and Sox10) gnathostome neural crest specifiers affects expression of all neural crest specifiers. However, functional evidence for aspects of this putative network often conflicts between different jawed vertebrates; e.g, depletions of AP2, FoxD3, or Sox10 in Xenopus disrupts neural crest induction, while in zebrafish, their knockdown impinges on differentiation but has no apparent effect on induction. These differences may be due to the tetraploidy of zebrafish, compensation by redundant paralogs, or both. The emerging data suggest that the neural crest specifiers extensively cross-regulate to maintain their expression, though hierarchical relationships remain difficult to ascribe (Sauka-Spengler, 2007).

To better understand the network and obtain a more comprehensive picture of the relationships between its elements, the effects were examined of knockdown of three neural plate border and five neural crest specifier genes on more neural crest markers than has previously been done in any other vertebrate (SoxE1, SoxE2, FoxD-A, AP2, n-Myc, and Id. Although Snail is typically used as a crest marker in Xenopus, its quasi-ubiquitous presence during premigratory stages in lamprey obviated its usefulness in this study (Sauka-Spengler, 2007).

In comparing the current results with those previously described in gnathostomes, it was found that inactivation of border specifiers MsxA, Pax3/7, and ZicA results in depletion of neural crest specifier expression, consistent with observations in Xenopus. However, lamprey neural plate border specifiers do not appear to mutually coactivate. An expansion of the dorsal neural tube was observed and, correspondingly, of Pax3/7 expression therein, suggesting that inactivation of border specifiers may result in a fate conversion from neural crest to neural tube. Because many of the neural plate border specifiers are later expressed in the dorsal neural tube, they appear to have later and separate functions in the developing nervous system. These data show that inactivation of FoxD-A, n-Myc, or Id decreases expression of Pax3/7, ZicA, and SoxB1 in the roof plate, in agreement with findings in Xenopus that FoxD3 induces Zic1 and neural markers, whereas Sox9 is required for later expression of Pax3 and Msx1 (Sauka-Spengler, 2007).

Interestingly, rescue experiments using Xenopus Zic1, Msx1, AP2, and Sox9, as well as chick Pax3 mRNA, suggest that these heterospecific proteins can functionally compensate for the loss of their lamprey orthologs. These experiments imply that the protein structure of these transcription factors has been sufficiently conserved during vertebrate evolution to be interchangeable in the context of neural-crest-inducing function (Sauka-Spengler, 2007).

Traditionally the neural crest is considered an evolutionary innovation of vertebrates, since protochordates lack bona fide neural crest. In cephalochordates signaling molecules like BMP, Notch, and Wnt are expressed in a pattern closely resembling that of vertebrates, consistent with their conserved role in patterning the early ectoderm. Furthermore, in both Amphioxus and ascidians, homologs of neural plate border specifiers Msx, Zic, and Pax3/7 are present within the neural plate border territory in late gastrula/early neurula, suggesting that the initial steps of border patterning and specification are already present in protochordates. In contrast, no neural crest specifiers, with the exception of Snail, are deployed at the neural plate border. Recently, a large number of gene interactions were tested in the ascidian Ciona intestinalis using morpholino-mediated gene knockdown. While interactions related to later events in central nervous system formation appear to be conserved between urochordates and vertebrates, neural-crest-specific links are absent in Ciona, and only the activation of Snail by Zic is reminiscent of the vertebrate NC-GRN (Sauka-Spengler, 2007).

Evolution of neural crest was likely driven by changes at the gene-regulatory level that may include co-option of ancestral gene batteries to a new purpose, as well as recruitment of a supplementary transcription factor or factors into the regulatory cascade. While the proximal gene regulatory elements are highly conserved between lamprey and gnathostomes, the neural crest specifier portion can clearly be subdivided into two temporally separated subsets. More distal regulatory modules that involve deployment of intracellular and extracellular signaling cues and gene batteries responsible for migration and differentiation of neural crest cells are present, implying a high degree of evolutionary constraint. Differences between gnathostome models are likely to reflect lineage-specific alterations in expression of paralogous genes or slight alterations in degrees of cis-regulatory robustness (Sauka-Spengler, 2007).

This study shows that the molecular mechanisms guiding formation of neural crest are a vertebrate synapomorphy. As such, this conserved network fits the proposed criteria for defining gene regulatory networks functioning during development of animal body plans. The NC-GRN is composed of one or more 'kernels'. The neural plate border regulatory module is an evolutionarily inflexible unit that plays an essential upstream function in establishing the identity of the neural crest progenitor territory and is also found in protochordates that lack bona fide neural crest. It is likely that the incorporation of the neural crest specifier module into the network led to the vertebrate innovation of the neural crest kernel consisting of two interconnected parts -- the neural plate border and neural crest specifier modules. Other 'plug-ins' and 'switches' may have been co-opted into the circuit from existing developmental programs. Such plug-ins may provide signaling inputs (Wnts) or guidance cues (Npn/Sema ligand-receptor couple), whereas switches like Myc/Id, integrated at the specification level of the network, provide a mechanism of cell cycle control that alternates between neural crest cell proliferation and cell death (Sauka-Spengler, 2007).

Addition of neural crest modules to the network occurred prior to separation of jawed and jawless vertebrates, likely during the transition from protochordates to vertebrates. This reflects an ancient origin of the NC-GRN during the early Cambrian period within the estimated 200 million years between the divergence of cephalochordates and vertebrates. Furthermore, it is likely that 'differentiation' subcircuits may have been incorporated and co-opted to more proximal use in revising the NC-GRN from agnathans to gnathostomes. As an example, Ets1 and Twist are found to be deployed late in migratory and postmigratory lamprey neural crest, but exist more proximally in the gnathostome network. Thus, though a neural crest gene network was largely fixed at the base of vertebrates, there appears to be remodeling of individual subcircuits that may be responsible for species-specific traits. It is interesting to note that a recent paper reported the successful isolation of embryos from another agnathan, hagfish, for the first time after 100 years of known attempts throughout the literature. Intriguingly, the gene expression patterns for the neural crest markers reported in this study appear highly reminiscent of those of lamprey (Sauka-Spengler, 2007).

These findings are all the more significant when taking into account recent fossil finds suggesting that modern lampreys are 'living fossils,' with similar characteristics to the common ancestor with jawed vertebrates, thus reflecting the primitive vertebrate condition and occupying an important ancestral position. Prior to this study, only two genes were studied thoroughly in the context of early events in neural crest formation in the lamprey. By studying a large group of molecules, these observations couple the formation of the neural crest proper with the establishment of a NC-GRN at the dawn of vertebrates, pushing back the date that such a gene regulatory network was invented by at least 200 million years, and thus giving deep insight into the steps necessary for the creation of defining vertebrate features (Sauka-Spengler, 2007).

Role of Delta homologs in epidermal development

The roles of Notch, Delta, and Serrate were studied in vertebrate epithelial appendage morphogenesis using the feather as a model. The following observations were made:

  1. C-Notch-1, C-Delta-1, and C-Serrate-1 are not expressed at the early placode stage and are therefore not involved in the determination of bud versus interbud compartments.
  2. From symmetric short buds to asymmetric long buds, C-Delta-1 and C-Serrate-1 are expressed in the posterior bud mesenchyme in a nested fashion, while C-Notch-1 is expressed as a stripe perpendicular to the anterior-posterior (A-P) axis and positioned posterior to the midpoint.
  3. Epithelial-mesenchymal recombination with rotation leads to the disappearance of protein products of these genes followed by their reappearance with new positions appearing to predict their new morphological orientation.
  4. Conditions leading to branched buds (e.g., recombination of later buds) show polarized staining patterns before branching occurs.
  5. The condition leading to symmetrical round buds (e.g., treatment with the protein kinase A agonist forskolin) suppresses expression of all three genes.
These results have led to the hypothesis that Notch, Delta, and Serrate are involved in establishing the A-P asymmetry of feather buds (Chen, 1997).

Chick embryonic feather buds arise in a distinct spatial and temporal pattern. Although many genes are implicated in the growth and differentiation of the feather buds, little is known about how the discrete pattern of the feather array is formed and which gene products may be involved. Possible candidates include Notch and its ligands, Delta and Serrate, as they play a role in numerous cell fate decisions in many organisms. Notch-1 and Notch-2 mRNAs are expressed in the skin in a localized pattern prior to feather bud initiation. In the early stages of feather bud development, Delta-1 and Notch-1 are localized to the forming buds while Notch-2 expression is excluded from the bud. Thus, Notch and Delta-1 are expressed at the correct time and place to be players in the formation of the feather pattern. Once the initial buds form, expression of Notch and its ligands is observed within each bud. Notch-1 and -2 and Serrate-1 and -2 are expressed throughout the growth and differentiation of the feathers, whereas Delta-1 transcripts are downregulated. When chick Delta-1 is misexpressed in either large or small patches using a replication competent retrovirus, Notch-1 and-2 are induced, accompanied by a loss of feather buds from the embryo. In large regions of Delta-1 misexpression, feathers are lost throughout the infected area. In contrast, in small regions of misexpression, Delta-1 expressing cells differentiate into feather buds more quickly than normal and inhibit their neighbors from accepting a feather fate. A dual role is proposed for Delta-1 in promoting feather bud development and in lateral inhibition. These results implicate the Notch/Delta receptor ligand pair in the formation of the feather array (Crowe, 1998a).

Given the proposed role of the Notch signaling system in the choice between feather and smooth skin fate in the embryonic chick, a test was performed to see whether Notch signaling may not also play a role in determining scale fate in the chick embryo. Notch-1 and -2, Serrate-1 and -2, and Delta-1 are expressed in the scales throughout their development. Misexpression of chick Delta-1 using a replication-competent retrovirus results in regions of scale loss. Feather buds are often observed on some of the scuta scales. These results suggest a model in which Delta can act as an inhibitor of skin appendage fate as well as a promoter of feather fate (Crowe, 1998b).

The chick dermis is known to control the formation of feathers and interfeathery skin in a hexagonal pattern. The evidence that the segregation of two types of fibroblasts involves Delta/Notch signalling is based on three facts: (1) rings of C-Delta-1-expressing fibroblasts precede and delimit the forming feather primordia; (2) C-Delta-1 is uniformly expressed in the dermis of the scaleless mutant, which is almost entirely devoid of feathers and (3) feather development is inhibited by overexpression of C-Delta-1 in wild type dermis using a retroviral construct. The distribution of C-Delta-1 in the mutant dermis can be rescued by its association with a wild type epidermis, which acts as a permissive inducer, or by epidermally secreted proteins, like FGF2. The effect of FGF2 may be indirect (Viallet, 1998).

The pattern of production of hair cells and supporting cells cannot be determined simply by the pattern of expression of Notch ligands, in the manner proposed by the simple model of lateral inhibition with feedback. The cells that become hair cells are not selected to do so by escape from exposure to Ser1 (they are constantly exposed), Dl1 (its ectopic expression does not change cell fate), or Ser2 (the knockout has only a mild effect). However hair cells contain Numb, which can block Notch activation, supporting the idea that hair cells escape the inhibitory effect of Notch activation not because of lack of ligands from their neighbors, but because they are deaf to the signal delivered by the ligands (Eddison, 2000).

Why are hair cells and supporting cells produced in the observed ratio? This cannot be accounted for simply in terms of the rules of asymmetric inheritance of Numb. If each cell in the developing sensory patch went through a final asymmetric division, yielding one daughter that inherited Numb and one daughter that did not, the result would be a 1:1 ratio of hair cells to supporting cells, whereas the measured ratio (in chick basilar papilla) ranges from 1:1.7 to 1:3.9. The level of Numb in the prospective hair cells as opposed to supporting cells may be controlled in some more complex way or through more complex sequences of cell divisions, or some molecule other than Numb and its asymmetrically located companion proteins may confer immunity to lateral inhibition and serve as the key determinant of cell fate (Eddison, 2000).

Hair follicle development and hair formation involve the co-ordinated differentiation of several different cell types in which Notch appears to have a role. Intricate expression patterns for the Notch-1 receptor and three ligands, Delta-1, Jagged-1 and Jagged-2 in the hair follicle are reported. Notch-1 is expressed in ectodermal-derived cells of the follicle, in the inner cells of the embryonic placode and the follicle bulb, and in the suprabasal cells of the mature outer root sheath. Delta-1 is only expressed during embryonic follicle development and is exclusive to the mesenchymal cells of the pre-papilla located beneath the follicle placode. Expression of Jagged-1 or Jagged-2 overlaps Notch-1 expression at all stages. In mature follicles, Jagged-1 and Jagged-2 are expressed in complementary patterns in the follicle bulb and outer root sheath; Jagged-1 in suprabasal cells and Jagged-2 predominantly in basal cells. In the follicle bulb, Jagged-2 is localized to the inner (basal) bulb cells next to the dermal papilla, which do not express Notch-1, whereas Jagged-1 expression in the upper follicle bulb overlaps Notch-1 expression and correlates with bulb cell differentiation into hair shaft cortical and cuticle keratinocytes (Powell, 1998).

Human epidermis is renewed throughout life from stem cells in the basal layer of the epidermis. Signals from the surrounding keratinocytes influence the differentiation of the stem cells, but the nature of the signals is unknown. In many developing tissues, signaling mediated by the transmembrane protein Delta1 and its receptor Notch1 inhibits differentiation. The role of Delta-Notch signaling in postnatal human epidermis was examined. Notch1 expression is found in all living epidermal layers, but Delta1 expression is confined to the basal layer of the epidermis, with highest expression in those regions where stem cells reside. By overexpressing Delta1 or DeltaT, a truncated form of Delta1, in primary human keratinocytes and reconstituting epidermal sheets containing mixtures of Delta-overexpressing cells and wild-type cells, it was found that cells expressing high levels of Delta1 or DeltaT fail to respond to Delta signals from their neighbors. In contrast, wild-type keratinocytes that are in contact with neighboring cells expressing Delta1 are stimulated to leave the stem-cell compartment and initiate terminal differentiation after a few rounds of division. Delta1 promotes keratinocyte cohesiveness, whereas DeltaT does not. It is proposed that high Delta1 expression by epidermal stem cells has three effects: a protective effect on stem cells by blocking Notch signaling; enhanced cohesiveness of stem-cell clusters, which may discourage intermingling with neighboring cells; and signaling to cells at the edges of the clusters to differentiate. Notch signaling in epidermal stem cells thus differs from other progenitor cell populations in promoting, rather than suppressing, differentiation. The expression Delta in contiguous groups of cells in the epidermal layer and the distribution of epidermal stem cells asters rather than single cells are more consistent with a mechanism in which Notch is activated at the interface between two fields of cells, such as occurs at the dorsal-ventral wing boundary in Drosophila (Lowell, 2000).

In human interfollicular epidermis, stem cells lie in clusters surrounded by their differentiated daughters, transit amplifying cells, an arrangement that reflects differences in cell cohesiveness and motility. Keratinocytes expressing a dominant negative Delta1 mutant, DeltaT, lacking most of the cytoplasmic domain, acquire the motile behavior of transit cells while retaining their stem cell identity. Conversely, overexpression of Delta1 promotes keratinocyte cohesiveness. The adhesive effects of Delta1 and DeltaT are independent of SuH-dependent Notch signaling. DeltaT increase motility and spreading of individual keratinocytes and stimulate lamellipodia formation. Delta and DeltaT colocalize with cortical actin and redistributed upon Latrunculin treatment. It is proposed that Delta promotes keratinocyte cohesiveness by restricting motility (Lowell, 2001).

Delta may promote cohesiveness by decreasing motility or by promoting calcium-independent intercellular adhesion, although if the effects of DeltaT on isolated keratinocytes are due to its dominant negative action on endogenous Delta1 they would tend to suggest an effect on motility. Cells initiate migration by reorganizing the actin cytoskeleton to extend sheet like cytoplasmic protrusions called lamellipodia. These structures become stabilized by forming integrin-mediated anchoring contacts with the underlying extracellular matrix. However, lamellipodia can form without anchorage of the cell to a substrate. Almost half of the DeltaT cells extended unusually broad lamellipodia in the absence of any exogenous extracellular matrix and Delta1 and DeltaT colocalized with cortical actin. Since the distribution of DeltaT is identical to Delta's, yet lacks most of the intracellular domain, it seems unlikely that Delta1 binds directly to the actin cytoskeleton. Instead, it may be indirectly associated via another actin-linked trans-membrane protein. One intriguing possibility is that this is mediated by cis interactions between Delta and Notch on the same cell (Lowell, 2001).

Role of Delta homologs in lung development

Factors controlling the differentiation of the multipotent embryonic lung endoderm and mesoderm are poorly understood. Recent evidence that Delta-like 1 (Dll1) and other genes in the Notch/Delta signaling pathway are expressed in the embryonic mouse lung suggests that this pathway is important for cell fate decisions and/or the differentiation of lung cell types. The localization of transcripts of several genes encoding members of the Notch/Delta pathway in the early mouse lung is reported. Most genes are expressed in specific populations and so may contribute to cell diversification (Post, 2000).

Notch1 expression is seen in the distal endoderm at all times examined (E11.5-E13.5). By contrast, Notch2 and Notch3 are expressed throughout the mesenchyme, although Notch3 transcripts are also found at low levels in the endoderm. Notch4 expression is confined to the endothelium of the blood vessels. Dll1 is expressed within the respiratory epithelium after E13.5. Dll3 expression was not observed in the developing mouse lung at any age examined. Jagged1 (Jag1) transcripts are present in the mesenchyme and blood vessels, while Jag2 expression is observed in the peripheral mesenchyme underlying the surface mesothelium. Radical and Lunatic fringe proteins are believed to modulate the binding of ligand to the Notch receptors. Lfng RNA is localized to the developing endoderm of both the trachea and respiratory tree while Rfng expression is ubiquitous throughout the endoderm and mesenchyme (Post, 2000).

The localized expression of Dll1 during early lung development was studied in more detail using lungs from Dll1LacZ heterozygous animals. Two distinct positive cell populations were found. (1) LacZ-positive cells are observed in isolated clusters in the secondary bronchi after E13.5. As gestation progresses, positive cells increase in number and can be found within more terminal branches of the bronchioles, often at branch points. Postnatally, fewer positive endodermal cells are found, only within the deepest parts of the lung tissue; this pattern is maintained in the adult. The early expression pattern of Dll1 and the similar temporal-spatial pattern of expression seen for Mash1, encoding a mediator of Dll1 function, suggests that the Dll1-positive cells are neuroendocrine cells (NE cells). Mash1 null mice are viable but lack NE cells in the adult lung. (2) A second pattern of Dll1 expression was seen after postnatal day 7 throughout the lung tissue. Upon sectioning, positive cells were identified as endothelial cells lining the lung vasculature (Post, 2000).

Delta homologs and tooth development

Recent data suggest that dental cells utilize the evolutonarily conserved Notch-mediated intercellular signaling pathway to regulate their fates. The expression and regulation of Delta1, a transmembrane ligand of the Notch receptors, during mouse odontogenesis is described. Delta1 is weakly expressed in dental epithelium during tooth initiation and morphogenesis, but during cytodifferentiation, expression is upregulated in the epithelium-derived ameloblasts and the mesenchyme-derived odontoblasts. The expression pattern of Delta1 in ameloblasts and odontoblasts is complementary to Notch1, Notch2, and Notch3 expression in adjacent epithelial and mesenchymal cells. Notch1 and Notch2 are upregulated in explants of dental mesenchyme adjacent to implanted cells expressing Delta1, suggesting that feedback regulation by Delta-Notch signaling ensures the spatial segregation of Notch receptors and ligands. TGFbeta1 and BMPs induce Delta1 expression in dental mesenchyme explants at the stage at which Delta1 is upregulated in vivo, but not at earlier stages. In contrast to the Notch family receptors and their ligand Jagged1, expression of Delta1 in the tooth germ is not affected by epithelial-mesenchymal interactions, showing that the Notch receptors and their two ligands Jagged1 and Delta1 are subject to different regulations (Matsiadis, 1998).

Delta functions in neural stem cells

Neural stem cells become progressively less neurogenic and more gliogenic with development. Between E10.5 and E14.5, neural crest stem cells (NCSCs) become increasingly sensitive to the Notch ligand Delta-Fc, a progliogenic and anti-neurogenic signal. This transition is correlated with a 20- to 30-fold increase in the relative ratio of expression of Notch and Numb (a putative inhibitor of Notch signaling). Misexpression experiments suggest that these changes contribute causally to increased Delta sensitivity. Moreover, such changes can occur in NCSCs cultured at clonal density in the absence of other cell types. However, they require local cell-cell interactions within developing clones. Delta-Fc mimics the effect of such cell-cell interactions to increase Notch and decrease Numb expression in isolated NCSCs. Thus, Delta-mediated feedback interactions between NCSCs, coupled with positive feedback control of Notch sensitivity within individual cells, may underlie developmental changes in the ligand-sensitivity of these cells (Kubu, 2002).

The role of Notch signaling on the generation of neurons and glia from neural stem cells was examined by using neurospheres that are clonally derived from neural stem cells. Neurospheres prepared from Dll1lacZ/lacZ mutant embryos deficient for Delta-like gene 1 segregate more neurons at the expense of both oligodendrocytes and astrocytes. This mutant phenotype could be rescued when Dll1lacZ/lacZ spheres were grown and/or differentiated in the presence of conditioned medium from wild-type neurospheres. Temporal modulation of Notch by soluble forms of ligands indicates that Notch signaling acts in two steps. Initially, it inhibits the neuronal fate while promoting the glial cell fate. In a second step, Notch promotes the differentiation of astrocytes, while inhibiting the differentiation of both neurons and oligodendrocytes (Grandbarbe, 2003).

As a result of Notch function, precursors are generated that are fated either to a neuronal (P1) or a glial fate (P2). However, these precursors do not necessarily give rise to the more mature cell type that expresses the appropriate differentiation marker. The experimental temporal modulation of Notch activity is consistent with the notion that neuron precursors, as well as glial precursors, could be blocked in a non-differentiating state, and that their further differentiation depends on secondary Notch signaling. Neuronal precursors that were normally generated in Dll1lacZ/lacZ mutant spheres, owing to the absence of Notch activity during the proliferation phase, do not develop into MAP2-expressing cells when Notch is activated during the differentiation phase. On the contrary, precursors that were fated to a glial cell type upon transient activation of Notch will not differentiate into GFAP-expressing astrocytes unless Notch is re-activated through the presence of soluble ligand during the differentiation phase. It is assume that these cells, which are blocked in a non-differentiated state, are likely to undergo cell death by apoptosis, as usually described for cells that are misdirected and do not differentiate properly (Grandbarbe, 2003).

In keeping with its role in the specification of cell types, Notch is positively acting for the differentiation of astrocytes and negatively acting for the differentiation of neurons. By contrast, Notch signaling has two contradictory effects on the production of oligodendrocytes. In a first step it acts positively to promote OPC production, whereas it negatively regulates their subsequent differentiation into oligodendrocytes; however, only the latter effect has been previously reported in other systems that were already committed to the oligodendroglial lineage. A model postulates that P2 is restricted to a glial fate with the potential to differentiate into either astrocytes or oligodendrocytes. Owing to the absence of specific markers, P2 cannot be identified in neurospheres. The existence of such a precursor with both astrocytic and oligodendroglial potential is controversial in vivo. The OPCs (formally called 0-2A) have long been investigated and have been shown to differentiate in vitro (in the presence of 10% FBS) into both oligodendrocytes and type II astrocytes that are positive for both GFAP and A2B5. Cells were never observed with characteristics of type II astrocytes. P2 is therefore different from PDGFR cells, which, it is assumed, are already committed to an oligodendroglial lineage and are likely, under the conditions employed, to give rise only to 04-expressing oligodendrocytes. Unfortunately, GFAP is likely to be a marker of astrocyte maturation rather than of lineage commitment, thereby hindering the direct comparison of OPCs with astrocyte precursors regarding Notch signaling. However, the observations show that in no case were oligodendrocytes and astrocytes mutually exclusive regarding Notch activation. It is therefore concluded that the segregation between oligodendrocyte and astrocyte lineages is independent of Notch signaling and might derive from another mechanism, involving for example the transcription factors OLIG1 and OLIG2 (Grandbarbe, 2003).

The cyclic gene Hes1 contributes to diverse differentiation responses of embryonic stem cells: Oscillation of Dll1 in phase with Hes1

Stem cells do not all respond the same way, but the mechanisms underlying this heterogeneity are not well understood. This study found that expression of Hes1 and its downstream genes oscillate in mouse embryonic stem (ES) cells. Those expressing low and high levels of Hes1 tended to differentiate into neural and mesodermal cells, respectively. Furthermore, inactivation of Hes1 facilitated neural differentiation more uniformly at an earlier time. Thus, Hes1-null ES cells display less heterogeneity in both the differentiation timing and fate choice, suggesting that the cyclic gene Hes1 contributes to heterogeneous responses of ES cells even under the same environmental conditions (Kobayashi, 2009).

The oscillations continued throughout the cell cycle, but Hes1 tended to be expressed at higher levels during S-G2 phases compared with G1 phase. The oscillations seemed to be synchronized between neighboring daughter cells after cell division, although they easily became asynchronous in large colonies. The period of Hes1 oscillations was variable from cycle to cycle and from cell to cell. The power spectrum of Hes1 oscillations after Fourier transformation showed that the periodicity was ~3-5 h, although it included many noises of short periodicity. The period of 3-5 h in ES cells was longer than in other cell types (2-3 h). The half-life of Hes1 protein was ~16 min in ES cells, which was similar to fibroblasts, whereas that of Hes1 mRNA was about two to four times longer in ES cells (~46 min) than in fibroblasts, implying that the stabilization of Hes1 mRNA contributes to a longer periodicity in ES cells (Kobayashi, 2009).

Because Hes1 expression oscillated, some downstream genes might be also expressed in an oscillatory manner. To determine the relationship of Hes1 expression with the downstream gene expression, 32 single ES cells were randomly picked up and cDNAs were made from each cell to perform quantitative real-time PCR (single-cell Q-PCR). These ES cells expressed variable levels of Hes1 and were classified into three groups according to the Hes1 expression level. When Hes1 expression is high, both Dll1 and Gadd45g expression are also high and vice versa, whereas the other downstream genes p57, Lef1, Jag1, and Crabp2 display different patterns. Thus, expression levels of Hes1, Dll1, and Gadd45g changed in a similar manner in individual ES cells, suggesting that these genes oscillate in phase. When the Hes1 protein level is high, transcription of all Hes1, Dll1, and Gadd45g genes may be repressed, but they may be activated when the Hes1 protein level is low. Due to this delayed negative regulation by Hes1, expression of all these genes probably oscillates in phase. To obtain direct evidence that both Dll1 and Gadd45g expression also oscillate in ES cells, their expression dynamics were further analyzed by a real-time imaging method using a ubiquitin-fused luciferase reporter under the control of Dll1 or Gadd45g promoter. The expression of both Dll1 and Gadd45g dynamically changed in many individual ES cells. These results suggest that the differentiation competency of ES cells can be changed rapidly by oscillations of Dll1, a ligand of Notch signaling that induces neural differentiation, and Gadd45g, which inhibits cell cycle progression. Interestingly, while Nanog was mostly expressed by picked-up ES cells, its expression level seemed to be variable and became higher when Hes1 was highly expressed, whereas there was no such relationship with Oct3/4 and Sox2, suggesting that Hes1 oscillations may have some correlation with Nanog fluctuation but not with Oct3/4 or Sox2 (Kobayashi, 2009).

Recent reports show that reversible changes in gene expression occur slowly, over several days, in ES cells and hematopoietic progenitor cells, resulting in different potentials for differentiation, although the mechanism for such slow changes remains to be elucidated. This study has shown that Hes1 and its downstream gene expression dynamically change much faster, over several hours, in ES cells. Hes1-high cells tend to adopt the mesodermal fate whereas Hes1-low cells tend to differentiate into neural cells. Furthermore, virtually all Hes1-null ES cells differentiated into the neural cells within 6 d under the neural differentiation condition, whereas only subsets of wild-type ES cells did so. Thus, in the absence of Hes1, ES cells display less heterogeneity in both the differentiation timing and fate choice, suggesting that the cyclic gene Hes1 contributes to heterogeneous responses of ES cells. Such rapid cycling of gene expression might be suitable to make multiple cell types even under a single differentiation condition. Hes1 expression also oscillates in neural progenitor cells, but this oscillation seems to contribute to maintenance of the undifferentiated state rather than the diversity in responses. Thus, it is likely that Hes1 oscillations have different functions in different cell types (Kobayashi, 2009).

Delta homologs and left-right asymmetry

Axes formation is a fundamental process of early embryonic development. In addition to the anteroposterior and dorsoventral axes, the determination of the left-right axis is crucial for the proper morphogenesis of internal organs and is evolutionarily conserved in vertebrates. Genes known to be required for the normal establishment and/or maintenance of left-right asymmetry in vertebrates include, for example, components of the TGF-ß family of intercellular signalling molecules and genes required for node and midline function. Notch signalling, which previously had not been implicated in this morphogenetic process, is required for normal left-right determination in mice. Loss-of-function of the delta 1 (Dll1) gene causes a situs ambiguous phenotype, including randomization of the direction of heart looping and embryonic turning. The most probable cause for this left-right defect in Dll1 mutant embryos is a failure in the development of proper midline structures. These originate from the node, which is disrupted and deformed in Dll1 mutant embryos. Based on expression analysis in wild-type and mutant embryos, a model is suggested in which Notch signalling is required for the proper differentiation of node cells and node morphology (Przemeck, 2003).

Delta homologs and T-lineage development

A monolayer culture system provides a new opportunity to expose the earliest stages of T-cell development for detailed tracking of the commitment process. In this system, the bone marrow stromal line OP9, which normally supports B-cell development in the presence of cytokines Flt3-L and IL-7, is converted to a T-cell inductive stroma by transfection with Delta-like-1 DL1 (OP9-DL1). Using the OP9-DL1 system to deliver temporally controlled Notch/Delta signaling, it is shown that pluripotent hematolymphoid progenitors undergo T-lineage specification and B-lineage inhibition in response to Notch signaling in a delayed and asynchronous way. Highly enriched progenitors from fetal liver require ≥3 d to begin B- or T-lineage differentiation. Clonal switch-culture analysis shows that progeny of some single cells can still generate both B- and T-lineage cells, after 1 wk of continuous delivery or deprivation of Notch/Delta signaling. Notch signaling induces T-cell genes and represses B-cell genes, but kinetics of activation of lineage-specific transcription factors are significantly delayed after induction of Notch target genes and can be temporally uncoupled from the Notch response. In the cells that initiate T-cell differentiation and gene expression most slowly in response to Notch/Delta signaling, Notch target genes are induced to the same level as in the cells that respond most rapidly. Early lineage-specific gene expression is also rapidly reversible in switch cultures. Thus, while necessary to induce and sustain T-cell development, Notch/Delta signaling is not sufficient for T-lineage specification and commitment, but instead can be permissive for the maintenance and proliferation of uncommitted progenitors that are omitted in binary-choice models (Taghon, 2005).

Delta and spinal cord development

Homeodomain (HD) transcription factors and components of the Notch pathway [Delta1 (Dll1), Jagged1 (Jag1) and the Fringe (Fng) proteins] are expressed in distinct progenitor domains along the dorsoventral (DV) axis of the developing spinal cord. However, the internal relationship between these two regulatory pathways has not been established. This report shows that HD proteins act upstream of Notch signalling. Thus, HD proteins control the spatial distribution of Notch ligands and Fng proteins, whereas perturbation of the Notch pathway does not affect the regional expression of HD proteins. Loss of Dll1 or Jag1 leads to a domain-specific increase of neuronal differentiation but does not affect the establishment of progenitor domain boundaries. Moreover, gain-of-function experiments indicate that the ability of Dll1 and Jag1 to activate Notch is limited to progenitors endogenously expressing the respective ligand. Fng proteins enhance Dll1-activated Notch signalling and block Notch activation mediated by Jag1. This finding, combined with the overlapping expression of Fng with Dll1 but not with Jag1, is likely to explain the domain-specific activity of the Notch ligands. This outcome is opposite to the local regulation of Notch activity in most other systems, including the Drosophila wing, where Fng co-localizes with Jagged/Serrate rather than Dll/Delta, which facilitates Notch signalling at regional boundaries instead of within domains. The regulation of Notch activation in the spinal cord therefore appears to endow specific progenitor populations with a domain-wide autonomy in the control of neurogenesis and prevents any inadequate activation of Notch across progenitor domain boundaries (Marklund, 2010).

HD proteins, which are implicated in pattern formation, as well as several components of the Notch pathway, exhibit specific expression domains along the DV axis of the neural tube, but their internal relationship has not been determined. This study shows that the patterned expression of Notch ligands and Fng genes are controlled by HD transcription factors. Loss of Nkx6.1 led to a ventral expansion of Jag1 expression, accompanied by a reduction of Dll1, Lfng and Mfng expression. Conversely, forced ectopic expression of Nkx6.1 suppressed the expression of Jag1 and induced that of Dll1, Lfng and Mfng. Perturbation of Dbx1 caused ectopic Jag1 expression in the ‘p0 domain’ and a concomitant reduction of Dll1, Lfng and Mfng expression, whereas overexpression of Dbx1 had the opposite effect. By contrast, perturbation of Dll1 and Jag1 did not alter the expression patterns of the Nkx6.1 and Dbx1 proteins, and there was no obvious increase of cell intermingling at progenitor domain boundaries. In conclusion, these findings suggest a mechanism in which HD proteins act upstream of Notch ligands and Fng gene expression, resulting in the establishment of discrete progenitor domains with co-localized expression of Dll1 and Fng, whereas regions expressing Jag1 are devoid of Fng protein expression (Marklund, 2010).

Delta homologs and developmental diseases

Approximately 10% of cases of Alzheimer's disease are familial and associated with autosomal dominant inheritance of mutations in genes encoding the amyloid precursor protein, presenilin 1 (PS1) and presenilin 2 (PS2). Mutations in PS1 are linked to about 25% of cases of early-onset familial Alzheimer's disease. PS1, which is endoproteolytically processed in vivo, is a multipass transmembrane protein and is a functional homologue of SEL-12, a C. elegans protein that facilitates signaling mediated by the Notch/LIN-12 family of receptors. To examine potential roles for PS1 in facilitating Notch-mediated signaling during mammalian embryogenesis, mice were generated with targeted disruptions of PS1 alleles (PS1-/- mice). PS1-/- embryos exhibit abnormal patterning of the axial skeleton and spinal ganglia, phenotypes traced to defects in somite segmentation and differentiation. Moreover, expression of mRNA encoding Notch1 and Dll1 (delta-like gene 1), a vertebrate Notch ligand, is markedly reduced in the presomitic mesoderm of PS1-/- embryos, as compared to controls. Hence, PS1 is required for the spatiotemporal expression of Notch1 and Dll1, which are essential for somite segmentation and maintenance of somite borders (Wong, 1997).

Alagille syndrome is a human autosomal dominant developmental disorder characterized by liver, heart, eye, skeletal, craniofacial and kidney abnormalities. Alagille syndrome is caused by mutations in the Jagged 1 (JAG1) gene, which encodes a ligand for Notch family receptors. The majority of JAG1 mutations seen in Alagille syndrome patients are null alleles, suggesting JAG1 haploinsufficiency is a primary cause of this disorder. Mice homozygous for a Jag1 null mutation die during embryogenesis and Jag1/+ heterozygous mice exhibit eye defects but do not exhibit other phenotypes characteristic of Alagille syndrome patients. Mice doubly heterozygous for the Jag1 null allele and a Notch2 hypomorphic allele exhibit developmental abnormalities characteristic of Alagille syndrome. Double heterozygous mice exhibit jaundice, growth retardation, impaired differentiation of intrahepatic bile ducts and defects in heart, eye and kidney development. The defects in bile duct epithelial cell differentiation and morphogenesis in the double heterozygous mice are similar to defects in epithelial morphogenesis of Notch pathway mutants in Drosophila, suggesting that a role for the Notch signaling pathway in regulating epithelial morphogenesis has been conserved between insects and mammals. In the majority of glomeruli of mutant mice, glomerular podocyte precursors differentiate but do not epithelialize, remaining instead as a dysmorphic aggregate of cells). This work also demonstrates that the Notch2 and Jag1 mutations interact to create a more representative mouse model of Alagille syndrome and provides a possible explanation of the variable phenotypic expression observed in Alagille syndrome patients (McCright, 2002).

A loss-of-function mutation in the mouse delta-like3 (Dll3) gene has been generated following gene targeting, and results in severe axial skeletal defects. These defects, which consist of highly disorganized vertebrae and costal defects, are similar to those associated with the Dll3-dependent pudgy mutant in mouse and with spondylocostal dysplasia (MIM 277300) in humans. This study demonstrates that Dll3neo and Dll3pu are functionally equivalent alleles with respect to the skeletal dysplasia, and it is suggested that the three human DLL3 mutations associated with spondylocostal dysplasia are also functionally equivalent to the Dll3neo null allele. Phenotypic analysis of Dll3neo/Dll3neo mutants shows that the developmental origins of the skeletal defects lie in delayed and irregular somite formation, which results in the perturbation of anteroposterior somite polarity. Since the expression of Lfng, Hes1, Hes5 and Hey1 is disrupted in the presomitic mesoderm, it is suggested that the somitic aberrations are founded in the disruption of the segmentation clock that intrinsically oscillates within presomitic mesoderm (Dunwoodie, 2002).

Evolutionary homologs - Return: part 1/3 | part 2/3


Delta: Biological Overview | Regulation | Protein Interactions | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1995, 1996 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.