The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).
To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).
Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).
During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).
One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).
The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).
Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).
This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).
In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).
Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).
Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).
Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).
Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).
This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).
A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).
A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).
Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).
Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).
EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).
Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).
The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).
EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).
If Nervy serves to tether PKA to the PlexA receptor, then type II PKA should associate in a complex with PlexA. An antibody specific for PKA RII decorates embryonic Drosophila CNS and motor axons, and PKA RII coimmunoprecipitated (co-IP) with HA-PlexA expresses in neurons, showing that type II PKA is associated with the PlexA receptor complex. pka RII LOF mutant embryos also exhibit highly penetrant axon guidance defects that closely resemble the guidance defects observed in nervy LOF, PlexA GOF, and MICAL GOF mutants. In addition, pka RII LOF mutants, like nervy LOF mutants, enhance the repulsive effects of Sema-1a, which suggests that type II PKA antagonizes Sema-1a repulsive axon guidance (Terman, 2004).
To test the necessity of nervy-type II PKA interactions in regulating Sema-1a-PlexA signaling, a single amino acid substitution of a proline for a valine residue was made in Nervy (nervyV523P) that was analogous to a mutation that disrupts MTG16-PKA RII interactions. Transgenic flies were generated expressing epitope (myc)-tagged nervyV523P, but unlike neuronal expression of wild-type nervy in a nervy LOF mutant background, neuronal nervyV523P failed to rescue the nervy LOF mutant phenotypes. Therefore, it was reasoned that nervyV523P might function in a dominant-negative manner by retaining its ability to bind to PlexA but blocking the coupling of PKA to PlexA. Indeed, expression of myc-nervyV523P in all neurons in a wild-type background results in axon guidance phenotypes similar to those seen in nervy or pka RII LOF mutants. These phenotypes are the opposite of those seen when wild-type Nervy is expressed in all neurons and are indicative of increased Sema-1a-PlexA repulsion because they resemble MICAL and PlexA GOF mutants. These results suggest that nervy's ability to bind type II PKA is critical for the modulation of Sema-1a-PlexA repulsive guidance (Terman, 2004).
In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. A subtractive hybridization procedure was used to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, a set of mutant genotypes was developed that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, it was demonstrated that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. In abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes, nervy, whose expression is confined to the nervous system, predicts a protein that is similar to a human proteoncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes (Feinstein, 1995).
Two nervy loss-of-function (LOF) mutants, nervy PDFKG1 and nervy PDFKG38 were generated; they exhibit highly penetrant axon guidance phenotypes consistent with increased axonal repulsion. Motor axons within the intersegmental nerve b (ISNb) pathway require Sema-1a-PlexA repulsive signaling to selectively defasciculate from the intersegmental nerve (ISN) and normally innervate muscles 6/7 and 12/13. In nervy LOF mutants, motor axons within the ISNb pathway often exit the ISN and ISNb in abnormal locations, are excessively defasciculated, and project incorrectly within the ventral musculature. Motor axons within other pathways such as segmental nerve a (SNa) are also abnormally defasciculated in nervy LOF mutants and project to inappropriate areas. CNS projections are also abnormal in nervy LOF mutants. In wild-type embryos, three evenly spaced and uniformly thick longitudinal axon bundles are detected on each side of the CNS with an antibody to Fasciclin II (FasII). In nervy LOF mutants, axons within the third, most lateral, longitudinal bundle are less tightly fasciculated and often extend away from the CNS in inappropriate bundles. A full-length nervy transgene expressed in all neurons rescues these axon guidance defects in nervy LOF mutants, demonstrating that these phenotypes result from a lack of neuronal Nervy. nervy LOF mutant phenotypes are qualitatively and quantitatively similar to those phenotypes observed following increased expression in all neurons [gain of function (GOF)] of PlexA or its downstream signaling partner MICAL, which suggests that Nervy may antagonize Sema-1a-PlexA repulsive axon guidance (Terman, 2004).
In contrast to nervy LOF phenotypes, overexpression of Nervy in all neurons in a wild-type background (nervy GOF) decreases the ability of motor axons to defasciculate and innervate their muscle targets. These phenotypes are consistent with the absence of, or inability to respond to, an axonal repellent and are identical to those seen in Sema1a, PlexA, MICAL, and Off-track (OTK, part of the Sema-1a signaling cascade) LOF mutants. ISNb axons often fail to defasciculate from each other, or even from the ISN, in nervy GOF mutants and bypass their muscle targets. Likewise, axons within the SNa pathway fail to defasciculate in nervy GOF mutants and often stall along their trajectory. Sema1a, PlexA, MICAL, and OTK LOF-like phenotypes are also seen in the CNS of nervy GOF mutants: The outermost 1D4-positive longitudinal connective was thinner in some segments, discontinuous in others, and often fused with the middle Fas2-positive fascicle. These results support a role for nervy in antagonizing Sema-1a-PlexA repulsive axon guidance (Terman, 2004).
If nervy antagonizes Sema-1a signaling, then reducing nervy expression should increase the repulsive effects of Sema-1a. Very few axon guidance defects were observed when low levels of Sema1a were expressed in all muscles. Expression of low levels of Sema-1a in all muscles in a nervy heterozygous background, however, results in an increase in Sema-1a repulsion and leads to the inability of motor axons to defasciculate and innervate their muscle targets. These phenotypes are identical to those seen when high levels of Sema-1a are expressed in all muscles. This dominant enhancement of a weak Sema1a GOF phenotype by nervy, together with dominant suppression of a weak Sema1a LOF phenotype by nervy, suggest that Nervy and Sema1a function in the same signaling pathway but have opposing effects, and that Nervy acts downstream of Sema-1a to regulate repulsive guidance (Terman, 2004).
Dendrite arborization patterns are critical determinants of neuronal function. To explore the basis of transcriptional regulation in dendrite pattern formation, RNA interference (RNAi) was used to screen 730 transcriptional regulators and 78 genes involved in patterning the stereotyped dendritic arbors of class I da neurons were identified in Drosophila. Most of these transcriptional regulators affect dendrite morphology without altering the number of class I dendrite arborization (da) neurons and fall primarily into three groups. Group A genes control both primary dendrite extension and lateral branching, hence the overall dendritic field. Nineteen genes within group A act to increase arborization, whereas 20 other genes restrict dendritic coverage. Group B genes appear to balance dendritic outgrowth and branching. Nineteen group B genes function to promote branching rather than outgrowth, and two others have the opposite effects. Finally, 10 group C genes are critical for the routing of the dendritic arbors of individual class I da neurons. Thus, multiple genetic programs operate to calibrate dendritic coverage, to coordinate the elaboration of primary versus secondary branches, and to lay out these dendritic branches in the proper orientation (Parrish, 2006; Full text of article).
To assay for the stereotyped dendrite arborization pattern of class I da neurons (hereafter referred to as class I neurons) in RNAi-based analysis of dendrite development, a Gal4 enhancer trap line (Gal4221) was used that is highly expressed in class I neurons and weakly expressed in class IV neurons during embryogenesis. Because of the simple and stereotyped dendritic arborization patterns of the dorsally located ddaD and ddaE, the studies of dendrite development focused on these two dorsally located class I neurons (Parrish, 2006).
To establish that RNAi is an efficient method to systematically study dendrite development in the Drosophila embryonic PNS, it was demonstrated that injecting embryos with double-stranded RNA (dsRNA) for green fluorescent protein (gfp) is sufficient to attenuate Gal-4221-driven expression of an mCD8::GFP fusion protein as measured by confocal microscopy. Next whether RNAi could efficiently phenocopy loss-of-function mutants known to affect dendrite development was tested. Similar to the mutant phenotype of short stop (shot), which encodes an actin/microtubule cross-linking protein, shot(RNAi) caused routing defects, dorsal overextension, and a reduction in lateral branching of dorsally extended primary dendrites. Likewise, RNAi of sequoia or flamingo resulted in overextension of ddaD and ddaE, RNAi of hamlet resulted in supernumerary class I neurons, and RNAi of tumbleweed resulted in supernumerary class I neurons and a range of arborization defects, consistent with the reported mutant phenotypes. Thus, RNAi is effective in generating reduction of function phenotypes in embryonic class I dendrites (Parrish, 2006).
In addition to genes with functions in promoting dendrite arborization, 20 group A genes were identified that regulate dendrite arborization by limiting dendrite growth and/or branching. Consistent with recent reports that loss of function of the BTB/POZ domain TF abrupt (ab) causes an increase in dendritic branching and altered distribution of branches, it was found that ab(RNAi) altered the arborization of class I dendrites. ab(RNAi) caused an increase in the number and length of lateral branches, expanding the coverage field most noticeably along the anteroposterior (AP) axis. In addition to these defects, ab(RNAi) also caused frequent cell death, consistent with the phenotype observed for a hypomorphic allele of ab (Parrish, 2006).
Increased dendritic branching also resulted from RNAi of several genes known to affect nervous system development, including Adh transcription factor 1 (Adf1), the zinc finger TF nervy (nvy), the basic helix–loop–helix (bHLH) TF deadpan (dpn), as well as genes not previously known to affect neuronal function, such as the putative transcription elongation factor Elongin c. Both Adf1 and dpn mutants have defects in larval locomotion and, in light of recent findings suggesting that da neurons may regulate aspects of larval locomotion, it is possible that dendrite defects underlie these behavioral defects. Consistent with its role in class I dendrite development, dpn is expressed in all PNS neurons. Likewise, nervy has been implicated in regulation of axon branching in motorneurons and is apparently expressed in most neurons. Thus, nervy likely regulates multiple aspects of neuronal differentiation. Finally, Elongin C may regulate transcriptional elongation but also likely functions as a component of a multimeric protein complex that includes the von Hippel-Lindau (VHL) tumor suppressor and targets specific proteins for poly-ubiquitination and degradation. Moreover, BTB/POZ domain proteins (such as cg1841 and ab) function as substrate adaptors for cullin E3 ligases. Interestingly, RNAi of a Drosophila homolog (tango) of a known VHL substrate (HIF-1) also affected dendrite arborization. It thus appears that protein degradation pathways regulate dendrite arborization (Parrish, 2006).
Reference names in red indicate recommended papers.
Amann, J. M., et al. (2001). ETO, a target of t(8;21) in acute leukemia, makes distinct contacts with multiple histone deacetylases and binds mSin3A through its oligomerization domain. 11533236
Barseguian, K., et al. (2002). Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins. Proc. Natl. Acad. Sci. 99(24): 15434-9. 12427969
Brody, T., Rasband, W., Baler, K., Kuzin, A., Kundu, M. and Odenwald, W. F. (2008). Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers. BMC Genomics 9: 371. PubMed Citation: 18673565
Calabi, F. and Cilli, V. (1998). CBFA2T1, a gene rearranged in human leukemia, is a member of a multigene family. Genomics 52(3): 332-41. Medline abstract: 9790752
Cao, Y., Zhao, H. and Grunz, H. (2002). XETOR regulates the size of the proneural domain during primary neurogenesis in Xenopus laevis. Mech. Dev. 119(1): 35-44. 12385752
Davis, J. N., McGhee, L. and Meyers, S. (2003). The ETO (MTG8) gene family. Gene 303: 1-10. PubMed citation: 12559562
Feinstein, P. G., Kornfeld, K., Hogness, D. S., Mann, R. S. (1995). Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue. Genetics 140(2): 573-86. 7498738
Fukuyama, T., Sueoka, E., Sugio, Y., Otsuka, T., Niho, Y., Akagi, K. and Kozu, T. (2001). MTG8 proto-oncoprotein interacts with the regulatory subunit of type II cyclic AMP-dependent protein kinase in lymphocytes. Oncogene 20(43): 6225-32. 11593431
Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G. and Lazar, M. A. (1998). Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO. Mol. Cell. Biol. 18(12): 7185-91. 9819405
Ice, R. J., Wildonger, J., Mann, R. S. and Hiebert, S. W. (2005). Comment on 'Nervy links protein kinase A to plexin-mediated semaphorin repulsion'. Science 309(5734): 558. PubMed citation: 16040690
Lutterbach, B., et al. (1998). ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors. Mol. Cell. Biol. 18(12): 7176-84. 9819404
Melnick, A. M., et al. (2000). The ETO protein disrupted in t(8;21)-associated acute myeloid leukemia is a corepressor for the promyelocytic leukemia zinc finger protein. Mol. Cell. Biol. 20(6): 2075-86. 10688654
Parrish, J. Z., Kim, M. D., Jan, L. Y. and Jan, Y. N. (2006). Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites. Genes Dev. 20(7): 820-35. Medline abstract: 16547170
Rochford, J. J., et al. (2004). ETO/MTG8 is an inhibitor of C/EBPbeta activity and a regulator of early adipogenesis. Mol. Cell. Biol. 24(22): 9863-72. 15509789
Rossetti, S., Hoogeveen, A. T. and Sacchi, N. (2004). The MTG proteins: chromatin repression players with a passion for networking. Genomics 84(1): 1-9. PubMed citation: 15203199
Sacchi, N., et al. (1998). Subcellular localization of the oncoprotein MTG8 (CDR/ETO) in neural cells. Oncogene 16(20): 2609-15. 9632137
Schillace, R. V., Andrews, S. F., Liberty, G. A., Davey, M. P. and Carr, D. W. (2002). Identification and characterization of myeloid translocation gene 16b as a novel a kinase anchoring protein in T lymphocytes. J. Immunol. 168(4): 1590-9. 11823486
Terman, J. R. and Kolodkin, A. L. (2004). Nervy links protein kinase a to plexin-mediated semaphorin repulsion. Science 303(5661): 1204-7. Medline abstract: 14976319
Terman, J. R. and Kolodkin, A. L. (2004). Response to comment on 'Nervy links Protein kinase A to Plexin-mediated Semaphorin repulsion.' Science 309; 558. Online text
Wang, J., Hoshino, T., Redner, R. L., Kajigaya, S. and Liu J. M. (1998). ETO, fusion partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the human N-CoR/mSin3/HDAC1 complex. Proc. Natl. Acad. Sci. 95(18): 10860-5. 9724795
Wei, Y., et al. (2007). A TAF4-homology domain from the corepressor ETO is a docking platform for positive and negative regulators of transcription. Nat. Struct. Mol. Biol. 14(7): 653-61. Medline abstract: 17572682
Wildonger, J. and Mann, R. S. (2005). Evidence that nervy, the Drosophila homolog of ETO/MTG8, promotes mechanosensory organ development by enhancing Notch signaling. Dev. Biol. 286(2): 507-20. Medline abstract: 16168983
Wood, J. D., et al. (2000). Atrophin-1, the dentato-rubral and pallido-luysian atrophy gene product, interacts with ETO/MTG8 in the nuclear matrix and represses transcription. J. Cell Biol. 150: 939-948. Medline abstract: 10973986
Zhang, J., et al. (2001). Oligomerization of ETO is obligatory for corepressor interaction. Mol. Cell. Biol. 21(1): 156-63. Medline abstract: 11113190
Zhang, J., et al. (2004). E protein silencing by the leukemogenic AML1-ETO fusion protein. Science 305: 1286-1289. Medline abstract: 15333839
date revised: 10 November 2008
Home page: The Interactive Fly © 2003 Thomas B. Brody, Ph.D (Terman, 2004).
The Interactive Fly resides on the
Society for Developmental Biology's Web server.