nervous fingers 1
REGULATION
Promoter

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).

The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).

In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).

Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).

Transcriptional Regulation

Comparative analysis of Nerfin-1 and Pros expression in the developing nervous system revealed a marked, although not complete, overlap in expression. The nuclear co-localization of these proteins in neuronal precursor cells, and the fact that mutations in nerfin-1 and pros trigger axon guidance defects, raised the possibility that they may regulate the expression of one another. To determine the epistatic relationship between nerfin-1 and pros, their expression dynamics were studied in each other's loss-of-function mutant backgrounds. Pros immunostaining in nerfin-1null embryos did not identify any significant changes in Pros expression. In marked contrast, nerfin-1 mRNA and protein levels in embryos collected from two independent loss-of-function pros mutants revealed that pros is required for wild-type nerfin-1 expression levels. Nerfin-1 expression was significantly reduced throughout the CNS and PNS; however, its expression was not completely ablated in any of the prosnull alleles tested (Kuzin, 2005).

To determine if the axon guidance phenotype observed in prosnull (prosI13) mutant embryos could be explained by a requirement for wild-type nerfin-1 expression, the extent of CNS axon disorganization triggered by single and double mutant combinations were examined. Comparisons demonstrated that loss of pros function resulted in a more severe phenotype than that observed in the nerfin-1null embryos. Although both prosnull and nerfin-1null embryos exhibited disruptions in the longitudinal axon connectives, loss of pros function resulted in an overall greater disruption in commissure organization. In addition, the nerve cord in prosnull embryos was considerably wider when compared to nerfin-1 mutants or wild-type embryos. The axon scaffolding phenotype observed in nerfin-1null; prosI13 double mutant was more severe than that of either single mutant (Kuzin, 2005).

Analysis of two other transcription factor genes that are widely expressed in the developing CNS, lola and fru, has revealed that they too are required for proper axon guidance and both are required for proper longitudinal axon fasciculation. However, unlike the severe axon guidance phenotype observed in prosnull embryos, the disorganization of the CNS axon scaffolding is not as extensive in lola or fru loss-of-function mutants. To determine the epistatic relationship between nerfin-1 and lola or fru, the expression of each gene in each other's loss-of-function background was analyzed. In contrast to the marked reduction of nerfin-1 expression in pros mutants, no such reduction in nerfin-1 expression was found in lola or fru mutants, nor was the expression of lola or fru altered in nerfin-1null embryos (Kuzin, 2005).

Targets of Activity

Given the axon guidance defects in nerfin-1null embryos and the fact that Nerfin-1 is a Zn-finger nuclear protein, it was hypothesized that Nerfin-1 may be required for the correct expression of genes involved in axon guidance. Accordingly, the embryonic expression profiles of over 35 genes that have been shown to play important roles in axon guidance were examined. Included in the candidate screen were genes encoding transcription factors, RNA-binding proteins, cell surface receptor proteins, their ligands, signal transduction proteins, and components of the cytoskeleton. Homozygous nerfin-1null embryos were identified by the absence of Nerfin-1 immunoreactivity. Whole-mount in situ hybridization and/or protein immunostaining for altered spatial or temporal expression in nerfin-1null embryos identified six genes that require nerfin-1 function to achieve full wild-type expression levels (Kuzin, 2005).

Two genes involved in anterior vs. posterior commissure choice, those encoding the receptor tyrosine kinase Derailed, and its ligand Wnt5, both required nerfin-1 for full expression. In the absence of nerfin-1, ventral cord expression levels of Robo and Robo3 were unaffected; however, Robo2 expression levels were significantly reduced. Expression of Slit, the ligand for Robo receptors, and Commissureless, a factor responsible for clearing Robo receptors from commissural axons, was unaffected in nerfin-1null embryos (Kuzin, 2005).

Loss of nerfin-1 function also significantly delayed and/or reduced the early expression of the neuron-specific microtubule-associated MAP1B-like gene futsch. futsch expression is normally activated in newborn neurons starting at stage 11; however, in nerfin-1null embryos expression is first detected only at the stage 13. Not until embryonic stage 15 did the level of futsch expression in mutant embryos approach that of wild type. Reduced mRNA steady state levels for the genes encoding Leukocyte-antigen-related-like (Lar), another receptor tyrosine kinase, and G-oα47A gene, which encodes an alpha subunit of heterotrimeric G proteins, were also detected in nerfin-1null embryos. The reduced level of gene expression in mutant embryos was nervous system specific. For example, G-oα47A gene expression in mesodermal derived tissues was not altered in nerfin-1null embryos (Kuzin, 2005).

Hybrid neurons in a microRNA mutant are putative evolutionary intermediates in insect CO2 sensory systems: Loss of a microRNA miR-279, which regulates nerfin-1, results in a switch in cell fate

Carbon dioxide (CO2) elicits different olfactory behaviors across species. In Drosophila, neurons that detect CO2 are located in the antenna, form connections in a ventral glomerulus in the antennal lobe, and mediate avoidance. By contrast, in the mosquito these neurons are in the maxillary palps (MPs), connect to medial sites, and promote attraction. In Drosophila loss of a microRNA, miR-279, leads to formation of CO2 neurons in the MPs. miR-279 acts through down-regulation of the transcription factor Nerfin-1. The ectopic neurons are hybrid cells. They express CO2 receptors and form connections characteristic of CO2 neurons, while exhibiting wiring and receptor characteristics of MP olfactory receptor neurons (ORNs). It is proposed that this hybrid ORN reveals a cellular intermediate in the evolution of species-specific behaviors elicited by CO2 (Cayirlioglu, 2008).

In insects, both the position of CO2 neurons and the behavior elicited by CO2 differ among species. For example, olfactory detection of CO2 through neurons positioned in or around the mouthparts of an insect, such as maxillary palps (MPs) and labial palps, correlates with feeding-related behaviors. Indeed, in some blood-feeding insects such as mosquitoes and tsetse flies, these neurons are harbored in the MPs and are important in locating hosts via plumes of CO2 that they emit. The hawkmoth, Manduca sexta, monitors nectar profitability of newly opened Datura wrightii flowers through CO2 receptor neurons located in their labial palps. In these examples, CO2 acts as an attractant. Conversely, in Drosophila CO2 is a component of a stress-induced odor that triggers avoidance behavior. This repellent response is driven by antennal neurons expressing the CO2 receptor complex Gr21a-Gr63a. How did these diverse behavioral responses to CO2 arise during insect evolution? It is proposed that this diversity emerged through multiple steps, including changes in cellular position (arising from elimination of CO2 neurons in one appendage and generation of these neurons in another) and changes in circuitry (Cayirlioglu, 2008).

In the course of a genetic screen for mutants disrupting the organization of the olfactory system, a mutant (S0962-07) was isolated that resulted in the formation of ectopic Gr21a-expressing neurons in the MPs. Some 22 ± 1.5 (mean ± SEM) green fluorescent protein (GFP)-positive cells were observed in the mutant MP, whereas the number of antennal Gr21a olfactory receptor neurons (ORNs) was unaffected. In the wild type, Gr21a cell bodies were restricted to the antenna. The ectopic MP cells expressed both CO2 receptors (Gr21a and Gr63a). Consistent with this finding, mutant cells conferred CO2 sensitivity to the MP. Staining the MP with an antibody to the pan-neuronal marker Elav revealed an increase of 21 ± 3.4 neurons in the mutant, which suggests that all ectopic neurons expressed Gr21a (Cayirlioglu, 2008).

In wild-type MPs, each sensillum contains two ORNs. By contrast, in the mutant MP sensilla, additional neurons expressing Elav and the general receptor Or83b were observed. This was also apparent when a MP ORN marker (MPS-GAL4) expressed in a subset of MP ORNs was used. This marker labels single cells within a subset of wild-type MP sensilla; however, in mutant MPs, two additional neurons were observed, bringing the total number of neurons within these sensilla to four. Thus, the generation of ectopic Gr21a-Gr63a neurons is due to an increase in the number of neurons within sensilla rather than transformation of MP ORNs (Cayirlioglu, 2008).

In the wild type, each class of adult ORNs sends projections from both antennae or MPs to the antennal lobe (AL). ORNs expressing same odorant receptors (ORs) typically form synapses in the same glomerulus within the AL. CO2 neurons in the antenna target the V-glomerulus. To specifically assess the targeting of ectopic MP CO2 neurons, flies were examined where the antennae were surgically removed. It was found that ectopic CO2 neurons targeted the V-glomerulus and other medial sites in the AL. The wiring specificity of antennal CO2 neurons in the mutants was identical to that in the wild type. Thus, the ectopic CO2 neurons in the MP target, at least in part, the same glomerulus innervated by the wild-type CO2 neurons in the antennae (Cayirlioglu, 2008).

S0962-07 was mapped to a P-element insertion some 1 kb upstream of a microRNA, miR-279. MicroRNAs (miRNAs) are small noncoding RNAs of about 22 nucleotides that bind to specific sequences of the 3'-untranslated region (3'UTR) of target genes and thereby repress gene expression posttranscriptionally. In recent years, miRNAs were implied in a variety of functions in the nervous system of different organisms. To assess whether miR-279 is responsible for the observed phenotype, three small deletions were generated that uncovered the miR-279 genomic region. These deletion mutants exhibited phenotypes indistinguishable from S0962-07. The ectopic CO2 phenotype was rescued by a 3-kb fragment of genomic DNA encoding only miR-279. Thus, miR-279 is the gene disrupted in S0962-07 and must repress targets in the MP to inhibit ectopic CO2 neuron development (Cayirlioglu, 2008).

To assess whether miR-279 is expressed in the developing MPs, transgenic flies were generated carrying a transcriptional reporter construct (miR-279-GAL4). Expression was monitored in flies carrying this GAL4 construct and the reporter UAS-mCD8GFP. Around 40 to 50 hours after puparium formation (APF), large cells reminiscent of sensory organ precursors in other epithelia expressed miR-279. At later stages, miR-279-expressing cells were found in clusters with smaller cells, some of which expressed neuronal markers. As ORNs matured, miR-279 expression was lost (Cayirlioglu, 2008).

Attempts were identify the target gene(s) responsible for the miR-279 mutant phenotype. About 205 potential target mRNAs of miR-279 were previously predicted. One of the strongest candidates for miR-279 regulation is Nerfin-1. The Nerfin-1 3'UTR contains multiple miR-279 binding sites and encodes a transcription factor expressed in neuronal precursors and transiently in nascent neurons in the embryonic central nervous system. Nerfin-1 protein appeared in miR-279-positive cells between 50 and 60 hours APF. Nerfin-1 and miR-279 gradually redistributed, generating complementary expression patterns. Cells with high levels of Nerfin-1 expressed low levels of miR-279 and vice versa (Cayirlioglu, 2008).

To test whether Nerfin-1 is up-regulated in miR-279 mutants, mutant MPs were stained with antibodies to Nerfin-1. 22 ± 4.8 additional Nerfin-1-expressing cells were found in miR-279 mutant MPs relative to controls. This is similar to the number of ectopic CO2 neurons in the MP. The vast majority of CO2 ORNs in the MP expressed Nerfin-1. Thus, the expression pattern of Nerfin-1 protein in the wild type and in mutant MPs is consistent with nerfin-1 mRNA being a target for miR-279 in vivo (Cayirlioglu, 2008).

To determine whether miR-279 directly binds to nerfin-1 3'UTR and inhibits its expression, a luciferase reporter assay was used in cultured cells. The luciferase-coding region was fused to the full-length nerfin-1 3'UTR, which contains four conserved 8-nucleotide oligomer target sites for miR-279, as well as to a subregion containing three of these sites. Luciferase activity of both nerfin-1 sensor constructs was strongly repressed when cells were cotransfected with miR-279. By contrast, the activity of either nerfin-1 sensor was unaffected by noncognate miR-315. Antisense oligomers directed against the miR-279 core sequence specifically relieved nerfin-1 reporter repression. Thus, it is concluded that nerfin-1 is a direct target of miR-279 (Cayirlioglu, 2008).

Next whether Nerfin-1 down-regulation by miR-279 inhibits the development of CO2 neurons in the MPs was assessed. To do this, the level of nerfin-1 was reduced by half genetically in a miR-279 mutant background. This decreased the number of CO2 neurons in the MP relative to miR-279 mutants, providing strong in vivo evidence that miR-279 is necessary to down-regulate Nerfin-1 in MPs during normal development. Nerfin-1 up-regulation alone was not sufficient to generate a miR-279-like phenotype. Taken together, these findings suggest that miR-279 down-regulates Nerfin-1 and other targets to prevent CO2 neuron development in the MPs (Cayirlioglu, 2008).

When analyzing the axonal projections of the CO2 neurons in the MPs, it was observed that these neurons targeted one or more medial glomeruli in addition to the V-glomerulus, the target of antennal CO2 neurons. These medial glomeruli are normally innervated by MP Or42a and Or59c ORNs. Double-labeling experiments revealed that mutant neurons also coexpressed Or42a and Or59c, but not other MP ORs. Analysis of subsets of MP ORNs also revealed that Or42a and Or59c classes each showed an approximate increase of 10 cells in the MPs, whereas others were unaffected. These results indicate that the ectopic CO2 neurons are formed as additional cells within Or42a and Or59c sensilla and are hybrid in identity. They express ORs and exhibit wiring characteristics of two classes of neurons (Cayirlioglu, 2008).

It is interesting that the loss of miR-279 generates a CO2 neuron within a sensillum harboring four neurons in the MP, given that the antennal CO2 sensilla in Drosophila are the only sensilla in the olfactory system to harbor four ORNs. Because miR-279 acts within the precursor cells in the MP to prevent Nerfin-dependent formation of olfactory neurons, this observation raises the intriguing possibility that positioning of CO2 neurons on different olfactory appendages might have evolved through changes at the level of precursor cell development. Thus, the evolutionary elimination of CO2 neurons from MP sensilla might have required decreasing the number of cells with neuronal identities through down-regulation of Nerfin-1 by miR-279 (Cayirlioglu, 2008).

Although it was hypothesized that relocation of CO2 ORNs to different appendages was important in the evolution of differences in CO2 sensing, additional mechanisms must have evolved to modify the neural circuitry to alter species-specific behaviors in response to CO2. The ectopic CO2 neurons are hybrid cells, which express additional receptors (Or59c or Or42a) and also target medial glomeruli, typically innervated by wild-type ORNs expressing these ORs. This is particularly interesting given that CO2 neurons in mosquitoes connect to medial glomeruli, driving an attractive response. It is speculated that this hybrid cell represents an evolutionary intermediate on a path leading to species-specific CO2 behavior. Perhaps suppressing the expression of Or59c or Or42a ORs could convert this hybrid cell to one dedicated only to CO2 reception. The nature of the behavioral output to CO2 (i.e., attraction versus repulsion) by this cell, however, may be dictated by altering the wiring specificity to one site or the other (medial versus ventral, respectively). More generally, it is proposed that natural selection can work on such an evolutionary intermediate to generate different combinations of OR, wiring, and cellular positional specificities, depending on the insects' environmental needs. This may in turn lead to novel olfactory responses to different odorants, or to the same odorant in different species (Cayirlioglu, 2008).

The Drosophila nerfin-1 mRNA requires multiple microRNAs to regulate its spatial and temporal translation dynamics in the developing nervous system

The mRNA encoding the Drosophila Zn-finger transcription factor Nerfin-1, required for CNS axon pathfinding events, is subject to post-transcriptional silencing. Although nerfin-1 mRNA is expressed in many neural precursor cells including all early delaminating CNS neuroblasts, the encoded Nerfin-1 protein is detected only in the nuclei of neural precursors that divide just once to generate neurons and then only transiently in nascent neurons. Using a nerfin-1 promoter controlled reporter transgene, replacement of the nerfin-1 3' UTR with the viral SV-40 3' UTR releases the neuroblast translational block and prolongs reporter protein expression in neurons. Comparative genomics analysis reveals that the nerfin-1 mRNA 3' UTR contains multiple highly conserved sequence blocks that either harbor and/or overlap 21 predicted binding sites for 18 different microRNAs. To determine the functional significance of these microRNA-binding sites and less conserved microRNA target sites, their ability to block or limit the expression of reporter protein was studied in nerfin-1 expressing cells during embryonic development. The results indicate that no single microRNA is sufficient to fully inhibit protein expression but rather multiple microRNAs that target different binding sites are required to block ectopic protein expression in neural precursor cells and temporally restrict expression in neurons. Taken together, these results suggest that multiple microRNAs play a cooperative role in the post-transcriptional regulation of nerfin-1 mRNA, and the high degree of microRNA-binding site evolutionary conservation indicates that all members of the Drosophila genus employ a similar strategy to regulate the onset and extinction dynamics of Nerfin-1 expression (Kuzin, 2007).

During embryonic stage 10, nerfin-1 mRNA is detected in all early delaminating CNS NBs albeit at differing levels; and within many of the NBs the message appears to be asymmetrically distributed. Although nerfin-1 mRNA expression is pan-neural during this early stage in CNS development, immunostains using different Nerfin-1 specific polyclonal antibodies detect significant levels of Nerfin-1 protein only in the ventral cord MP2 NBs. The punctate/irregular distribution of the nerfin-1 mRNA in NBs lacking detectable levels of Nerfin-1 protein is reminiscent of that observed for mRNAs targeted for miRNA mediated cleavage in mammals, suggesting that nerfin-1 message in many of the NBs may likewise be targeted for degradation (Kuzin, 2007).

Although the dynamics of nerfin-1 mRNA and protein expression differ considerably during the early stages of nervous system development, by stage 13 the pattern of Nerfin-1 expression closely matches that of its mRNA and close inspection of nerfin-1 message distribution in the Nerfin-1 protein expressing cells revealed an even cytoplasmic distribution. Expression of both the message and protein in the new born CNS and PNS neurons is short lived; levels of both rapidly decline such that by late stage 14 both message and protein levels are significantly lower throughout the nervous system (Kuzin, 2007).

miRNA target prediction programs have identified multiple putative miRNA binding sites within the nerfin-1 1,622 bp 3' UTR and many of these sites are conserved in other nerfin-1 Drosophila orthologues. For example, a Drosophila EvoPrint (Odenwald, 2005) of the nerfin-1 locus (using D. melanogaster as the reference sequence and D. sechellia, D. yakuba, D. erecta, D. ananassae, D. persimilis, D. pseudoobscura, D. willistoni, D. mojavensis and D. grimshawi as test sequences) revealed conserved sequence blocks within the 3' UTR that contain or overlap 21 predicted miRNA binding sites for 18 different miRNAs. The conserved sequences are present in all, or all but one, species used in the analysis and represent over 100 million years of collective evolutionary divergence. The partial and/or interrupted conservation within the predicted miRNA binding sites may reflect the fact that initial base-pairing of an miRNA and its mRNA target sequence requires only eight bases to initiate translational regulation. EvoPrint analysis of the nerfin-1 3' UTR also identified additional conserved sequence blocks that do not contain or overlap predicted miRNA binding sites and their role(s) in gene function are currently unknown. In vivo cis-regulatory analysis of the nerfin-1 3' UTR failed to detect any transcriptional enhancer activity. In addition to the conserved miRNA target sites, less conserved predicted binding sites have been identified within the 3' UTR. For example, the central miR-279/miR-286 and miR-279 target sites are present in the species that are evolutionarily close to D. melanogaster but not conserved in the more distant D. persimilis, D. pseudoobscura, D. willistoni, D. mojavensis and D. grimshawi species (Kuzin, 2007).

The conservation of nerfin-1 miRNA sites suggests that miRNA mediated post-transcriptional regulation of nerfin-1 occurs in all members of this genus. MicroRNAs most likely regulate other EIN-domain containing zinc finger genes. For example, multiple miRNA binding sites have also been detected in the vertebrate IA-1 3' UTR, and EvoPrint analysis reveals that one of sites within the human IA-1 gene is highly conserved (Kuzin, 2007).

To determine if the conserved nerfin-1 3' UTR sequences are required for the embryonic NB post-transcriptional regulation, a series of reporter transgene constructs were generated that tested the silencing activity of different regions of its 3' UTR. The starting construct was prepared by replacing the nerfin-1 ORF and 3' UTR in an 11 kb nerfin-1 genomic rescue construct with a sequence that contains the ORF for a nuclear targeted Green Fluorescent Protein (GFP-NLS) linked to the viral SV-40 3' trailer that lacks any predicted miRNA binding sites. As expected, transformants that contain the P[nerfin-1.GFP-NLS.SV-40] construct expressed GFP in all early delaminating CNS NBs and no translational block of GFP expression was detected when compared to nerfin-1 mRNA expression. The full-length or different sub-regions of the nerfin-1 3' UTR containing the conserved sequence blocks were then inserted into a unique restriction site within the vector's SV-40 3' UTR. Embryo GFP-immunostains were performed on multiple independent transformant lines for each construct. As controls, multiple independent transformant lines that contain the nerfin-1 3' UTR sequences in the opposite orientation were also generated for each construct and embryo GFP-immunostains revealed that in all cases the translational block in GFP expression was orientation dependent (Kuzin, 2007).

Insertion of the full-length 3' UTR into the P[nerfin-1.GFP-NLS.SV-40] reporter recapitulated the silencing of nerfin-1 mRNA translation. Similar to the endogenous Nerfin-1 protein expression during embryonic stages 10 and 11, significant levels of GFP expression in the ventral cord were observed only in the MP2 NBs. However, reporter transgenes that contained sub-regions of the 3' UTR gave only partial or no block in NB GFP expression. For example, although the iB and iH constructs, consisting respectively of the conserved 5' and 3' multiple miRNA binding site sub-regions, significantly reduced GFP expression in stage 11 NBs, both of these sub-regions only partially blocked expression during stage 10. Further sub-division of the 5' conserved miRNA binding site cluster (constructs iC, iD and iE) revealed that the overlapping miR-9A, miR-9B and miR-9C binding sites and the miR-279/mir-286 both contributed to the partial inhibition observed with the iB construct, but the conserved Bantam miRNA-binding site did not. It is worth noting that the 5' predicted miR-279/mir-286 target site within the nerfin-1 rescue construct contains the sequence TCTAGTCA that agrees with the predicted miR-279/mir-286 binding site. This sequence differs in the second to last base from that of the D. melanogaster genomic sequence (FlyBase BLAST), in which there is a T in place of C. cDNA sequence analysis of all ESTs in the database reveals a C instead of a T at this position (Kuzin, 2007).

Given that only the full-length insert recapitulates the silencing of endogenous expression in the CNS, it is concluded the miRNAs act in a cooperative fashion to regulate the onset of Nerfin-1 protein expression. The block in translation by sub-regions of the 3' UTR was more effective at stage 11 than at stage 10; this could reflect time of onset of miRNA expression or the possibility that the level of mRNA expression is too high for a complete block at the earlier stage. Previous studies have shown that ectopic expression of nerfin-1 outside the wild-type temporal/spatial boundaries during CNS development results in axon guidance defects. The requirement for multiple miRNA binding sites may reflect the need for tight spatial control of Nerfin-1 expression (Kuzin, 2007).

Dissection of the sub-regions reveals that the miR-9A, miR-9B and miR-9C combined site, as well as the miR-279/mir-286 site, contribute to silencing, but the Bantam site did not show an effect. The conservation of the Bantam site suggests that it is functionally important, but no effect on embryonic CNS expression of nerfin-1 was observed. Consistent with this, no effect on Nerfin-1 protein expression was detected in bantam minus embryos. Bantam has been shown to have developmental roles in post-embryonic development. Analysis of the 3' sub-region sites indicates that in the CNS, the combined miR-279/miR-286 site exhibits partial silencing, with no effect observed for the other miRNA binding sites. Interestingly, the less conserved centrally located miR-279/miR-286 and miR-279 sites did not promote silencing. These two sites share less homology to the miR-279 and miR-286 binding sites than the other conserved miR-279/mir-286 target sites. Construct iG, which contains the overlapping miR-92A, miR-92B, and miR-310-313 sites revealed no detectable miRNA silencing. In addition, construct iK that contains a predicted miR-5 binding site did not affect the reporter mRNA translation in the embryonic CNS and PNS. The other sites in the 3' sub-region exhibited an effect in PNS silencing, suggesting spatial specificity for microRNA effects on nerfin-1 expression (Kuzin, 2007).

During embryonic PNS development, nerfin-1 mRNA and protein are transiently expressed in secondary precursor cells that divide once to generate neurons, and then both its transcript and encoded protein are only transiently detected in nascent neurons. Unlike the post-transcriptional regulation observed in the developing CNS, when the full-length nerfin-1 3' UTR was included in the reporter transgene the onset of GFP expression was not blocked in precursor cells but the duration of GFP expression in the nascent neuron was significantly reduced. The rapid extinction of detectable GFP expression mirrored that of the endogenous Nerfin-1 transient expression; the short-lived expression was observed throughout the PNS in the ventral, lateral and dorsal neurons such that by stage 15 little or no GFP immunostaining was detected. Similar to the reporter results obtained in the CNS for the different 3' UTR sub-regions, no one sub-region or single miRNA binding site was able to fully limit GFP expression in older stage 14 and 15 neurons. However, except for the predicted Bantam miRNA-binding site that showed no detectable effect on silencing GFP expression, all of the other 3' UTR sub-regions exhibited different degrees of silencing. Each of the constructs had differential effects on reporter expression in different cells of the PNS, suggesting an involvement of miRNAs in cell-type regulation of Nerfin-1 expression. For example, construct iB, containing the 5' end of the 3' UTR, exhibited a higher levels of silencing in individual cells of the dorsal and lateral clusters; a construct containing the 3' end of the 3' UTR, exhibited a higher level of silencing in the chordotonal neurons in the lateral cluster than in other cells of the lateral and ventral clusters; another construct containing a subset of sites in the 3' UTR, exhibited a higher level of silencing in a subset of cells in the dorsal and lateral clusters than in other cells of the same clusters (Kuzin, 2007).

Taken together, the data suggest that the miRNA binding sites in the 3' UTR are required to restrict the onset (CNS) and extinction (PNS) dynamics of Nerfin-1 protein expression. The limited expression of Nerfin-1 protein may be the result of translational inhibition and/or enhanced miRNA mediated degradation of the nerfin-1 mRNA. To determine whether mRNA expression dynamics were different for different constructs and thus were affected by the presence of different combinations of nerfin-1 miRNA binding sites, the mRNA expression dynamics of the nerfin-1.GFP-NLS.SV-40 transgene was compared to mRNA expression dynamics of this transgene containing the various nerfin-1 3'UTR fragments. The in situ hybridization mRNA study of embryos containing these different nerfin-1 3' UTR transgene constructs revealed that none of the nerfin-1 miRNA binding site constructs exhibited a marked alteration of the PNS or CNS expression dynamics of the reporter transgene during embryonic development. However, because the in situ hybridizations only reveal relative steady state mRNA levels, the possibility that the miRNAs may be promoting nerfin-1 mRNA degradation cannot definitely be ruled out(Kuzin, 2007).

Whereas the overlapping miR-9A, miR-9B, and miR-9C target sites showed partial silencing of nerfin-1 expression in the CNS, no effect was observed in the PNS. Interestingly, mutational analysis of a miR-9a mutant reveals that it is required for embryonic PNS development, and it has been shown to silence expression of senseless mRNA. However, the current studies show that miR-9A is unlikely to be a dominant regulator of embryonic Nerfin-1 protein expression; analysis with a number of cell fate markers reveal that nerfin-1 mutation is not likely to effect embryonic PNS cell fate and staining miR-9a mutants with antibody to Nerfin-1 reveals no alteration in the number or positions of Nerfin-1 positive cells. In contrast, the miR-305 and miR-13B sites partially reduced reporter expression in the PNS but not in the CNS, and the combined miR-34/315/305, miR-307 sites also exhibited partial silencing in the PNS but not in the CNS. This observation suggests that part of the reason for the complexity of miRNA binding sites in the nerfin-1 3'UTR could be due to tissue specificity of miRNA expression (Kuzin, 2007).

This study has examined the ability of the predicted miRNA binding sites within the Drosophila nerfin-1 3' UTR to silence mRNA translation in vivo. The principle finding of this study is that multiple miRNAs act cooperatively to regulate the spatial and temporal expression of Nerfin-1 in the developing embryonic nervous system. Indeed, no single miRNA-binding site is sufficient to recapitulate the endogenous post-transcriptional regulation in either the embryonic CNS or PNS. In the CNS, mRNA binding sites for multiple miRNAs are required to regulate the spatial expression of Nerfin-1 by silencing expression in all but the MP NBs. In the developing PNS, these studies indicate that miRNA mediated regulation does not restrict the onset of Nerfin-1 expression but rather it helps accelerate the rate of disappearance of Nerfin-1 in nascent neurons (Kuzin, 2007).

Whereas the whole 3' UTR was required for wild-type expression of nerfin-1, three individual sites had a partial effect of silencing in the CNS and four individual sites had only a partial effect in silencing in the PNS. The incomplete silencing in the CNS was stronger at a later stage of development than at an earlier stage, pointing to temporal effects of individual miRNAs. In two instances, partial silencing of nerfin-1 expression is accomplished by different sites in the CNS and PNS pointing to a potential tissue specificity of miRNA effects. miR-9A, miR-9B and miR-9C showed an effect in the CNS but not in the PNS, and, in contrast, the combined miR-34/315/305, miR-307 sites exhibited partial silencing in the PNS but not in the CNS. The same differential effect was observed for combined miR-305 and miR-13B binding sites. In addition, in the PNS, partial effects exhibited a degree of cell type specificity, suggesting that individual miRNAs exhibit cellular specificity even within a single tissue. The results suggest that the high number of conserved miRNA binding sites in the nerfin-1 3' RNA are likely to reflect differential temporal and spatial specificity of miRNA function. Further confirmation of this awaits in depth studies of the tissue specificity of miRNA expression (Kuzin, 2007).


nervous fingers 1: Biological Overview | Evolutionary Homologs | Developmental Biology | Effects of Mutation | References

Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.

The Interactive Fly resides on the
Society for Developmental Biology's Web server.