extradenticle
Bithorax complex genes repress exd in the posterior of the embryo (Rauskolb 1993).
In Drosophila, the morphological diversity is generated by the
activation of different sets of active developmental regulatory genes in the
different body subdomains. This study investigates the role of the
homothorax/extradenticle (hth/exd) gene pair in the
elaboration of the pattern of the anterior mesothorax (notum). These two genes
are active in the same regions and behave as a single Hox independent functional unit. Their original uniform expression in the notum is downregulated during development and becomes restricted to two distinct, alpha and ß subdomains. This modulation appears to be important for the formation of distinct patterns in the two subdomains. The regulation of hth/exd expression is achieved by the combined repressing functions of the Pax gene eyegone (eyg) and of the Dpp pathway. hth/exd is repressed in the body regions where eyg is active and that also contain high levels of Dpp activity. Evidence is presented for a molecular interaction between the Hth and the Eyg proteins that may be important for the patterning of the alpha subdomain (Aldaz, 2005).
This study deals with a novel hth/exd function: its patterning role
in the notum. It is not related to the specification of notum identity because
notum identity is not affected by alterations of hth/exd activity. For example, in the absence of hth/exd, the cells still differentiate as notum, if an abnormal one. Conversely, high and uniform Hth levels also produce notum tissue but with abnormal pattern. This
function is only required in part of the notum and is therefore linked to the
modulation of hth expression during the development of the disc. The
final result of this modulation is the appearance of the alpha and ß
subdomains of hth that is reported in this study. These two subdomains
differentiate distinct notum patterns, suggesting that Hth/Exd interact with
other localised products to generate these patterns (Aldaz, 2005).
Thus, there are two principal aspects in the patterning function of
hth/exd: (1) the spatial regulation, that eventually results in the
restriction of its expression to the alpha and ß subdomains, and (2)
the local interactions of Hth/Exd with other products in either of the
subdomains (Aldaz, 2005).
Although hth and exd form a single functional unit, their
mode of regulation is different: exd is expressed ubiquitously but is
regulated at the subcellular level by hth, which promotes Exd nuclear
transport. Therefore, the key element of hth/exd regulation is the
transcriptional control of hth (Aldaz, 2005).
Originally, hth is expressed in all the notum cells and later becomes restricted to the alpha and ß subdomains. Consequently, the principal aspect of hth regulation is the mechanism(s) leading to its repression in the regions outside the alpha and ß subdomains. Two negative regulators have been identified, the
eyg gene and the Dpp pathway, which probably acts through some
unidentified downstream gene. In the notum hth behaves as a
downstream target of both the Dpp pathway and eyg (Aldaz, 2005).
The role of Eyg as a negative regulator of hth is based on the
following observations: (1) the beginning of the modulation of hth
expression in the notum at the early third instar coincides with the
initiation of eyg expression; (2) in eyg mutants the hth domain is expanded, extending to most of the notum; (3) mutant eyg clones show hth derepression in the inter-subdomains region, and conversely, ectopic eyg activity in the ß subdomain represses hth. The fact that this ectopic activity fails to affect hth in the alpha subdomain was expected since eyg and hth are normally co-expressed in this subdomain. In conclusion, eyg suppresses hth in the inter-subdomains region and also acts as a barrier for hth in the eyg/ß-hth
border (Aldaz, 2005).
The role of the Dpp pathway as a negative regulator of hth is
based on results showing that Mad - mutant clones in the
inter-subdomains region show activation of hth. This is in contrast
to the behaviour of those clones in the alpha subdomain, where they have no
effect, or in the ß subdomain, where they show suppression of hth. It is believed that the reason for the latter effect is that eyg is up regulated in those clones, and in turn Eyg suppresses hth. The lack of effect of Mad - clones in the alpha subdomain is probably due to the low activity of Dpp in that region. In principle, the observation that the high activity levels generated in the TkvQD clones suppress hth in this subdomain supports this view. Expectedly, TkvQD clones do not affect hth expression in the ß subdomain, because it normally possesses high Dpp activity levels (Aldaz, 2005).
Taking all the results together, the following model of
hth regulation is proposed. Since hth is originally expressed in all trunk embryonic cells and in all the notum cells in the early disc, the
regulation of hth during wing disc development essentially reflects
local repression in specific parts of the disc. The basic idea is that
hth is repressed by the joint contribution of eyg and
high/moderate levels of the Dpp pathway. Neither of these elements can repress
hth individually. Although eyg appears to act uniformly in
its domain, the repressing activity of Dpp is concentration dependent. Within
the eyg domain, the hth alpha subdomain is located in the
anterior region, in which the Dpp levels are too low to be effective and Eyg
alone cannot repress hth/exd. In the inter-subdomains region the Dpp
levels are high enough to repress hth, since here it acts together with
Eyg. The ß subdomain is outside the eyg domain and therefore in
the absence of Eyg even the high Dpp levels are not capable of repressing
hth/exd. The model is also supported by the experiments of
overexpressing eyg. The eyg-expressing clones in the ß
subdomain suppress hth because the two repressors are active in the
clones, while they have no effect in the alpha subdomain because it normally
contains high eyg levels. In principle the experiments overexpressing
the Dpp pathway (TkvQD clones) appear to support the model. These
clones have no effect in the ß subdomain, which normally possesses high
Dpp activity levels, but they suppress hth in the alpha subdomain.
However, these clones are known to suppress eyg and
therefore hth should not be repressed according to this model. It is
possible that in certain circumstances the very high Dpp activity levels
induced by these clones may be sufficient to down regulate hth, even
in the absence of eyg (Aldaz, 2005).
The presence of two distinct repressors may suggest that the hth
promoter region contains binding sites for Eyg and for Mad/Medea
that would be responsible for the transcriptional repression. The ubiquitous
expression in the absence of these two repressors may be due to a constitutive
promoter (Aldaz, 2005).
The second aspect of the late patterning function of hth/exd
arises from the observation that the alpha and ß subdomains form
different patterns with similar levels of hth. This suggests the
existence of interactions between Hth/Exd and products specifically localised
to the different subdomains. In the case of the alpha subdomain, the obvious
candidate for the interaction is Eyg. The joint activity of
hth/exd and eyg specifies a notum pattern that is different
from those specified by each of these genes alone (Aldaz, 2005).
The finding that the Eyg and Hth proteins associate to form a complex in
vitro suggests a mechanism to achieve the pattern difference between the
alpha and the ß subdomains. As it has been shown to be the case for the
in vivo specificity of the Hox genes, the association of Hth/Exd with the
different Hox products results in higher affinity and specificity for target
sites. Here, the formation of an Eyg/Hth/Exd complex in the alpha subdomain may result in a constellation of gene activity different from that in the ß subdomain where Eyg is not present. In the latter subdomain hth/exd may act alone, for after all the two genes encode transcription factors. Alternatively, the Hth/Exd products may interact with some other yet
unidentified co-factor (Aldaz, 2005).
An interesting aspect of the interaction of hth/exd and
eyg is that it acts in two different ways. At the gene regulation
level, eyg participates in the spatial control of hth/exd
activity, but where the two genes are co-expressed their proteins interact,
presumably to contribute to the in vivo affinity and specificity for target
genes (Aldaz, 2005).
The Extradenticle protein is ubiquitously expressed in early embryonic cells during the period when segmental identities are being determined. exd interacts genetically with partial loss-of-function Dfd mutant alleles, enhancing their lethality. Thus, exd function is
required for the autoactivation phase of Deformed expression in the posterior head: Exd partners Dfd in Dfd-directed Dfd autoactivation. An epidermal autoregulatory enhancer (EAE) maps in a 2.7 kb fragment about 4 kb upstream of the Dfd start site. Mutations
that change the affinity of the small autoactivation element (120 base pairs) for Exd protein result in
corresponding changes in the element's embryonic activity. The
Exd and Dfd proteins directly activate this element in maxillary cells without
cooperative binding. Based on the types of
homeotic transformations and changes in gene expression observed in exd mutant
embryos, a new model for Exd/PBX action is proposed in which these proteins are
required for HOX protein transcriptional activation functions, but dispensable for HOX
transcriptional repression functions. Although the selection of a specific target gene activation site by one
HOX protein versus another may be explained in some cases by Exd's selective modulation
of HOX binding specificity, the favored idea in this instance is that Exd can interact with HOX proteins to switch them into a state where they are
capable of transcriptional activation. The experiments provide no support for the idea that a specialized heterodimer-binding site that would bind a Dfd-Exd complex stably and tightly is required for the specific activation of the 120 bp element in embryos. In this case Exd functions as a coactivator and does not function to promote cooperative binding with Dfd. Binding of Exd without simultaneous binding of Dfd may mediate repression. At adjacent regions of the 120 bp element, a novel protein, DEAF-1 has been shown to bind. Mutant substitutions in these adjacent regions reduce their affinity for DEAF-1. It is possible the Exd and DEAF-1 collaborate in non-maxillary cells to prevent ectopic activation of this head-specific HOX element (Pinsonneault, 1997).
Two BX-C
genes, Ultrabithorax and abdominal-A, require exd activity for their maintenance and function. Using an antibody directed against the Ubx protein, Ubx expression was examined in haltere imaginal
discs containing exd clones induced at different times during larval development. In
exd clones induced at 48-60 hr after egg laying (AEL), Ubx expression is abolished or greatly
reduced in the region of the disc that will develop into metanotum. In exd clones
induced later (72-84 hr AEL), Ubx expression is variable; some cells retain the Ubx antigen, whereas it
is undetectable in others. As expected, exd clones in the region of the disc giving rise
to the haltere pouch, where Exd is cytoplamic, have no effect on Ubx expression. This observation
indicates that exd is involved in the maintenance of Ubx activity in the trunk region of the segment (metanotum), but not in the appendage. It is proposed that mutual interactions between Exd and BX-C proteins ensure the correct amounts of interacting molecules. Since the Hoxd10 gene has the same properties as Drosophila BX-C genes, it is suggested that the control mechanism of subcellular distribution of Exd found in Drosophila probably operates in other organisms as well (Azpiazu, 1998).
Homeotic gene transcription is not affected by EXD. EXD positively regulates wingless and teashirt, both target genes of homeotic genes. EXD is required for the correct expression of dpp in visceral mesoderm. EXD and UBX regulate dpp via the same visceral mesoderm enhancer. Thus EXD coordinates regulation of downsteam genes in cooperation with homeotic selector proteins (Rauskolb 1993).
In embryos lacking extradenticle, expression patterns for wingless,
teashirt and decapentaplegic are altered in the embryonic visceral mesodermal midgut. EXD acts with UBX to activate dpp expression in parasegment 7 (PS7), via a minimal visceral
mesoderm enhancer. Anterior to PS7, EXD represses dpp expression. Even when
Ubx is ubiquitously expressed at high levels in exd embryos, UBX is incapable of activating dpp
enhancer expression (Rauskolb, 1994). Thus EXD repression of dpp is independent of homeobox cluster genes.
Transcription of dpp in the
Drosophila midgut is activated by UBX protein and repressed by ABD-A protein.
A candidate cofactor, the EXD protein, binds to the dpp enhancer in close
proximity to homeotic protein binding sites. Mutation at either this site or another conserved motif
compromises enhancer function (Manek, 1994). Thus EXD is a cofactor both in the repression and activation of dpp.
The Drosophila Engrailed homeoprotein has been shown to directly activate a Polycomb-group gene, polyhomeotic,
during embryogenesis. A study of the molecular mechanism involved in this activation detected two different types of
Engrailed-binding fragments within the polyhomeotic locus. The P1 and D1 fragments contain
several 'TTAATTGCAT' motifs, whereas the D2 fragment contains a long 'TAAT' stretch to which multiple copies of
Engrailed bind cooperatively. Another homeodomain-containing protein, Extradenticle, establishes protein-protein
interactions with Engrailed on the D2 fragment. Both types of Engrailed-binding
sites (P1 or D1 and D2), as well as Extradenticle, are necessary to obtain activation by Engrailed. In vivo, normal polyhomeotic expression depends on extradenticle expression. Moreover, in the absence of
Extradenticle, overexpression of Engrailed protein represses polyhomeotic expression (Serrano, 1998).
On the basis of these results, a model is proposed to explain ph regulation by En. In
the absence of Exd, En protein is probably bound to P1 and D1, while D2 might be bound either by
En or by other homeodomain-containing proteins. Under such conditions, no activation of ph is
observed. This situation might represent what happens in the embryo prior to full
germband extension.
When Exd is present, activation of ph occurs. Although Exd is expressed prior to the
time at which En activates ph, Exd might not be active at those earlier stages: Exd activity has been
shown to be regulated by nuclear import and was described as exclusively cytoplasmic in the
embryo before germband extension. Because the En-binding sites are so far apart within the ph locus and because D2 is required for
activation, acting as an enhancer on both ph transcription units, it is further suggested that DNA bending
might be involved in activation. In particular, En binding to P1 and D1 could be involved in bringing
the proximal and distal ph promoters close to D2 in the presence of Exd, allowing ph activation
from both transcription units. En binding to P1 and D1 prior to germband extension
might thus prepare the chromatin for rapid activation. At least two lines of evidence support the idea
that D2 interacts with P1 as well as D1, to mediate activation of both the proximal and the distal
transcription units: (1) the P1-D2 and D1-D2 fusions behave similarly in CAT assays and (2) the
in vivo activation was observed with the phlac enhancer trap, which corresponds to an insertion in
the proximal transcription unit of ph (Serrano, 1998).
Homothorax is shown to limit Dpp and Wg expression in the leg disc. Expression of the Dpp and Wg targets omb and H15 is restricted to those cells that do not express Hth. To determine if hth inhibits target gene activation by Dpp and Wg, hth was either removed from its endogenous domain or either a GFP-Hth fusion protein or the murine hth homolog MEIS-1B was misexpressed in the distal portion of the leg disc. Removing hth function results in the expansion of wg and dpp target gene expression. Dorsally situated hth- clones result in the expansion of omb expression, as marked by the omb-lacZ reporter gene. Does hth repress Distal-less and dachshund? Similar to removing exd function, when hth loss-of-function clones were examined, dac was found to be only partially derepressed, and derepression was found to be more likely to occur in clones that arise near endogenous dac expression. hth- clones have no effect on Dll expression, regardless of where they are situated. However, when clones of GFP-Hth- or MYC-MEIS-expressing cells are generated, both Dll and dac can be repressed. These results suggest that the expression of Dll and dac requires two conditions: (1) the absence of Hth and (2) sufficient activity in the Dpp and Wg pathways. High levels of Wg and Dpp signaling are shown to repress the nuclear localization of Exd by repressing hth transcription. The direct action of both the Wg- and Dpp-signaling pathways is required to specify cell fates along the P/D axis. High levels of Wg and Dpp signaling are required to activate Dll, a determinant of distal cell fates, and to repress expression of dac, a determinant of intermediate fates along the P/D axis. At intermediate levels of Wg and Dpp signaling, dac, but not Dll, is activated. The distal edge of hth expression coincides with the proximal edge of dac expression, suggesting that the threshold of Dpp and Wg signaling required to activate dac is similar to that required to repress hth. To test this idea, either Wg or Dpp signaling was elevated in the hth expression domain by generating clones of cells that express either a membrane-tethered form of Wg or an activated Dpp receptor, Thickveins QD (TKV QD). When Wg-expressing clones were generated dorsally, where endogenous Wg levels are low but where Dpp is present at high concentrations, there was a loss of Hth protein and a shift of Exd protein to the cytoplasm. This suggests that sufficient levels of both Wg and Dpp signaling are required to repress Hth (Abu-Shaar, 1998).
High levels of Wg and Dpp signaling are shown to affect Hth and Exd, at least in part, by repressing hth transcription. The ability of Wg and Dpp to repress hth appears to be indirectly mediated by Dll and dac. Like Dll, Dac appears to have the capacity to repress hth. The expression patterns of Hth and Dll were examined in leg discs that were entirely devoid of dac function. In these discs, the hth domain appears expanded distally and the Dll domain appears to be expanded proximally, consistent with the idea that dac normally represses both hth and Dll (Abu-Shaar, 1998).
The domains of gene expression for Hth, Dac and Dll, as well the regulatory interactions between them, suggest that the leg is functionally divided into two major domains. The first is a proximal domain, which expresses hth, has nuclear Exd and does not express at least some of the potential target genes of the Wg- or Dpp-signaling pathways. The second is a distal domain, which does not express hth, has Exd localized to the cytoplasm, and expresses the targets of Wg, Dpp and Wg+Dpp signaling. These data suggest that the proximal domain is what has been referred to as the coxopodite, or an extension of the body wall, and is distinct from the distal domain, the telopodite. hth expression and nuclear Exd in the coxopodite would restrict the ability of the Wg and Dpp signals to activate their target genes. This idea is consistent with the observation that these two domains differ with respect to their requirement for Hh signaling: unlike the telopodite, which exhibits severe truncations upon the reduction of hh function, the coxopodite is less severely affected. These two domains also appear to have different cell surface properties; cells from one domain prefer not to mix with cells from the other domain. For example, Dll mutant clones almost always relocalize to the hth-expressing domain and hth mutant clones frequently sort into distal regions of the leg disc. This phenomenon is not observed in the wing disc, where hth and Dll are restricted to outside and within the wing pouch, respectively: hth or Dll mutant clones are positioned randomly in this tissue. The mutant phenotypes displayed by the loss of coxopodite gene function are qualitatively different from those displayed by the loss of telopodite gene function. Removal of coxopodite genes such as exd results in either ‘nonsense’ or proximal to distal cell fate transformations, whereas removal of telopodite gene functions such as Dll and dac results in deletions of the appendage. In summary, the data support the idea that the proximal and distal regions of the leg have independent origins and differ from each other primarily due to the expression of hth, which limits or alters the ability of proximal cells to respond to Wg and Dpp signaling (Abu-Shaar, 1998 and references).
dac and Dll are shown to mediate Wg and Dpp mediated repression of hth. The demonstration that Wg and Dpp signaling repressed hth transcription and Exd’s nuclear localization was surprising, because these two signaling molecules induce Exd’s nuclear localization in the endoderm of the embryonic midgut. An investigation was carried out into the possibility that the repression of hth by Wg and Dpp is indirect and perhaps mediated by dac and Dll, which are not expressed in the midgut. TKV QD-expressing clones were generated and Hth, Dll and Dac were examined. Loss of function clones of Dll and dac were generated. When Dll- clones were generated before ~72 hours of development, hth was found to be derepressed and Exd was nuclear. However, clones generated after ~72 hours have no effect on hth or Exd, suggesting that there is an alternative mechanism for maintaining hth repression. Like Dll, Dac appears to have the capacity to repress hth. The ability of Dac to repress hth expression was confirmed by generating dac- clones. These dac- clones suggest that there might be other regulators of hth in addition to dac and Dll. Completely removing dac function results in viable animals that have deletions along the P/D axes of their legs. The expression patterns of Hth and Dll were examined in leg discs that were entirely devoid of dac function. In these discs, the hth domain appears expanded distally and the Dll domain appears to be expanded proximally, consistent with the idea that dac normally represses both hth and Dll. It is an apparent paradox that Wg and Dpp repress hth in the leg disc while these same signals activate hth expression and nuclear Exd in the midgut endoderm. This may be explained because in the leg, Wg and Dpp repress hth indirectly, by activating the hth repressors Dll and dac. In the absence of Dll or dac, hth is derepressed in the leg disc, even in cells that receive high levels of the Wg and Dpp signals. In contrast, in the embryonic endoderm, dac and Dll are not activated by Wg and Dpp, nor are any other known hth repressors, allowing hth to be activated in these cells (Abu-Shaar, 1998).
The 26 bp bx1 element from the regulatory region of Distal-less is capable of imposing control by the homeotic genes
Ultrabithorax and abdominal-A on a general epidermal activator in Drosophila. This provides an assay to analyze the sequence
requirements for specific repression by these Hox genes. Both the core Hox binding site, 5'-TAAT, and the adjacent Exd 5'-TGAT core site
are required for repression by Ultrabithorax and abdominal-A. The Distal-less bx1 site thus fits with the model of Hox protein binding
specificity based on the consensus PBX/HOX-family site TGATNNAT[g/t][g/a], where the key elements of binding specificity are proposed
to lie in the two base pairs following the TGAT. A single base pair deletion in the bx1 sequence generates a site, bx1:A-mut, which on the
consensus PBX/HOX model would be expected to be regulated by the Deformed Hox gene. It has been observed, however, that the bx1:A-mut site
is regulated predominantly by Sex combs reduced, Ultrabithorax and abdominal-A. The analysis of this site indicates that the specificity of
action of Hox proteins may depend not only on selective DNA binding but also on specific post-binding interactions (White, 2000).
A homeotic response element that mediates
repression by the Hox genes Ubx and abd-A has been built. The element is based on two short sequence modules; the 21 bp binding site Grainyhead binding site element
(Gbe) for the transcription factor GRH and the 26 bp UBX/
ABD-A bx1 footprint site from the Dll regulatory
sequences. On its own the Gbe mediates uniform epidermal
activation. However, the combination of the Gbe and the
bx1 element produces a homeotically modulated response.
Specifically in the domain of expression of the Hox genes
Ubx and abd-A the epidermal expression is repressed. This
homeotic element thus successfully recapitulates the
features of endogenous regulatory elements from homeotic
target genes giving tissue-specific regulation by multiple
homeotic genes (e.g. connectin). However, while endogenous target
gene regulatory elements tend to be large (typically covering several kb) and are correspondingly difficult to analyze,
this constructed element is appealingly simple and provides
a manageable system for analyzing the specificity of the
homeotic response (White, 2000).
The basis of Hox target specificity has been proposed to
depend on the nucleotides immediately following the Exd
core site in the 5' -TGATNNAT[g/t][g/a] PBX/HOX
consensus target site. In vivo
studies have indicated that NN=GG produces a lab-specific response whereas NN=TA elicits a response to Dfd. Previous in vitro studies on the optimum
target sequences for the whole range of PBX/HOX heterodimers have emphasized the importance of the nucleotide at position 7 in the PBX/HOX consensus sequence 5' -
ATGATTNATGG. Preference for a
particular nucleotide at N7 varies across the Hox complex.
The most anteriorly-expressed proteins, HOXB1 and 2,
prefer G at this position, the next more posteriorly-expressed Hox proteins allow N7=A, and from
HOXB6-10 preference grows for N7=T. The optimum
consensus for binding site for the PBX/HOXB7 heterodimer, equivalent to Ubx or Abd-A/Exd in Drosophila, is
5' -ATGATTTATGG. This is similar to the sequence
ATGATTTAatt (differences in lower case)
in the bx1 element. In particular, the nucleotide at N7 is T
and thus fits with the predictions from the in vitro binding
data. Taking the two elements previously studied in vivo
into account, N7=G is in a lab (Hoxb1) element;
N7=A in a Dfd (Hoxb4) element, and now N7=T is present in the bx1 element, which responds to Ubx and abd-A.
Thus, the specificity of regulation of the bx1 element fits
well with the expectations of the PBX/HOX model where
the nucleotides immediately 3' of the TGAT PBX core
provide the specificity for a particular subset of Hox
proteins through interactions with the specific residues of
the N-terminal arm of the homeodomain (White, 2000).
The bx1 element on its own does not drive reporter gene
expression. It acts as a control module that together with the
Grh activation module constitutes a homeotic response
element. This may represent a general model for a target
gene regulatory element, where proteins bound to a PBX/
HOX site interact with neighbouring regulatory complexes
to modulate their activity. The PBX/HOX modules may act
to overlay homeotic control on a whole variety of tissue-specific, signal transduction pathway-specific, temporal or
other regulatory elements. It is worth noting that the regulatory regions that have been identified in homeotic target
genes all drive highly tissue-restricted patterns, indicating
the collaboration between tissue-specific and homeotic
control. These observations give an insight into the modular
construction of complex enhancers and also have important
implications for the specificity of homeotic gene function. If
the PBX/HOX complexes in target gene regulatory
sequences act by interacting with other regulatory
complexes, it seems very likely that different Hox proteins
will vary in their ability to mediate specific interactions.
Thus, there is clearly the potential for much of the specificity of responses to homeotic gene control to reside in post-binding interactions (White, 2000).
The cap'n'collar
locus encodes three transcript and protein isoforms. The cncB
transcript is expressed in an embryonic pattern that includes
the labral, intercalary and mandibular segments, while cncA
and cncC are expressed ubiquitously. CncB
suppresses the segmental identity function of the Hox gene
Deformed (Dfd) in the mandibular segment of Drosophila
embryos. Evidence has been provided that the CncB-mediated
suppression of Dfd requires the Drosophila homolog of the
mammalian small Maf proteins, Maf-S, and that the
suppression occurs even in the presence of high amounts of
Dfd protein. Interestingly, the CncB/Maf-S suppressive
effect can be partially reversed by overexpression of
Homothorax (Hth), suggesting that Hth and Extradenticle
proteins antagonize the effects of CncB/Maf-S on Dfd
function in the mandibular segment (Veraksa, 2000).
In Drosophila, differences between segments, such as the presence or absence of appendages, are controlled by Hox transcription factors. The Hox protein Ultrabithorax (Ubx) suppresses limb formation in the abdomen by repressing the leg selector gene Distalless, whereas Antennapedia (Antp), a thoracic Hox protein, does not repress Distalless. The Hox cofactors Extradenticle and Homothorax selectively enhance Ubx, but not Antp, binding to a Distalless regulatory sequence. A C-terminal peptide in Ubx stimulates binding to this site. However, DNA binding is not sufficient for Distalless repression. Instead, an additional alternatively spliced domain in Ubx is required for Distalless repression but not DNA binding. Thus, the functional specificities of Hox proteins depend on both DNA binding-dependent and -independent mechanisms (Gebelein, 2002).
This work begins with a characterization of a Ubx binding site in the Dll gene that is critical for Dll repression; both Exd and Hth play a role in Ubx binding and repression. The Dll304 enhancer is sufficient to recapitulate the early expression pattern of Dll in the embryonic leg primordia. In addition to activation functions, Dll304 contains two Hox binding sites, Bx1 and Bx2, that repress enhancer activity in the abdomen and thereby restrict Dll expression to the thorax. Most of the repression activity is conferred by Bx1, a sequence bound by Ubx and Abd-A. In agreement with this result, a Distalless minimal element (DME) that lacks the Bx2 site accurately recapitulates the expression of Dll304 in the embryonic thorax. The DME enhancer also shows no derepression within the abdomen, suggesting that Bx1 is sufficient to fully repress Dll (Gebelein, 2002).
To better understand how Bx1 represses Dll, the presence of Exd and Hth binding sites were sought near the previously characterized Hox binding site. A consensus Exd site and a near consensus Hth site are in close proximity to the Hox site of Bx1. The Hox/Exd site (5'-AAATTAAATCA-3'), however, is unlike other previously characterized Hox/Exd binding sites because it contains an additional base pair in between the Hox and Exd half-sites. The Bx1 region containing this Hox/Exd/Hth site is referred to as the Distalless repression element (DllR). To determine whether DllR is required to repress DME expression in the abdomen, it was deleted from the DME enhancer (DMEact) and its ability to activate a reporter gene was tested in vivo. DMEact drives gene expression in all abdominal segments as well as in the thoracic region. Because the thoracic expression driven by DMEact is similar to that of DME, the DllR region is not required for DME activation but solely functions in the repression of Dll in the abdomen (Gebelein, 2002).
To determine whether Exd and Hth stimulate Hox binding to DllR, electrophoretic mobility shift assays (EMSAs) were performed with purified Ubx, Exd, and Hth proteins. Unless stated otherwise, all of these experiments were performed with UbxIa, the most widely expressed of several Ubx isoforms. By themselves, Ubx or an Exd/Hth heterodimer are capable of weakly interacting with DllR. The combination of all three proteins results in a slower migrating band indicating the formation of a Ubx/Exd/Hth/DNA complex. The formation of this protein/DNA complex is highly cooperative when compared to the amount of binding observed with Ubx or Exd/Hth alone. To test the contribution of each binding site, point mutations were introduced within the individual Hox, Exd, and Hth sites. Mutation of any one of these sites results in a decrease in the formation of the trimeric protein/DNA complex, suggesting that all three are required for optimal binding to DllR (Gebelein, 2002).
To test whether the Hox, Exd, and Hth binding sites are also required for Dll repression in vivo, reporter constructs were created containing the lacZ gene under the control of mutant versions of the DME enhancer. Mutation of the Hox site (DMEHox) results in a similar level of derepression of reporter gene expression throughout the abdomen, as does the the complete deletion of DllR. Mutation of the Exd (DMEExd) and Hth (DMEHth) sites individually also results in derepression, albeit slightly weaker than mutation of the Hox site. However, if both the Exd and Hth sites are mutated together, full derepression is observed. Taken together, these results demonstrate that the efficient formation of a Hox/Exd/Hth trimeric complex on DllR is required for Dll repression within the abdomen (Gebelein, 2002).
These above data support a model in which a Ubx/Exd/Hth complex bound to DllR is necessary for Dll repression. Whether a single copy of DllR is sufficient to repress a heterologous enhancer element was tested. An artificial enhancer, called fkh(250con), is activated by Scr, Antp, and Ubx (with Exd and Hth), and thus provides a useful heterologous activator to test for DllR function. A reporter construct under the control of both fkh(250con) and DllR was created. Unlike fkh(250con), which is expressed in parasegments (PS) 2-6, the composite enhancer (fkh250con-DllR) is not expressed in PS 6, where Ubx is expressed. Ubx-mediated repression of fkh(250con)-DllR is more obvious in embryos mutant for abd-A, which derepress Ubx and, consequently, fkh(250con) throughout the abdomen. In this genetic background, fkh(250con)-DllR is still active only in PS 2-5. Furthermore, misexpression of Ubx throughout the embryo activates fkh(250con) but represses fkh(250con)-DllR. Taken together, these results indicate that DllR is sufficient to confer Ubx-mediated repression of a heterologous enhancer. In addition, these results also illustrate that Ubx/Exd/Hth complexes can mediate repression through DllR in the same cells as it mediates activation through fkh(250con) (Gebelein, 2002).
A general question for all transcription factors is how they achieve specificity in vivo. For the Hox proteins, a large number of studies have implicated sequences both within and outside the homeodomain as being important for their in vivo specificities. But how do these sequences function? Because DNA binding domains, including homeodomains, can also be protein interaction domains, studies that map the domains necessary for target gene regulation cannot answer this question by themselves. Instead, direct transcriptional targets must be identified and, once binding sites are characterized, DNA binding, in addition to target gene regulation, must be measured. The results allow two steps to be discriminated in the repression of Dll by Ubx. First, Exd and Hth stimulate Ubx, but not Antp, binding to DllR. In contrast, Ubx/Exd/Hth and Antp/Exd/Hth have similar affinities for a different "consensus" binding site (5'-CCATAAATCA-3'), suggesting that subtle differences in the DNA sequence, in addition to differences between Ubx and Antp, contribute to specificity. A C-terminal peptide in Ubx stimulates this cofactor-dependent binding to DllR. DNA binding, however, is not sufficient for Dll repression. Instead, an additional linker domain included in only a subset of Ubx isoforms is required for repression. Thus, a second step, the recruitment of additional factors to the Ubx/Exd/Hth complex bound to DllR, is implied by these data. In addition to the UbxIa linker, this step also requires the specific sequences and conformation imposed on the Ubx/Exd/Hth trimer by DllR (Gebelein, 2002).
Although the Ubx C terminus plays an important role in cofactor-dependent binding to DllR, additional domains contribute to optimal binding. In the presence of Exd and Hth, the AAUU chimera, but not heterologous AAUA or AAAU, binds DllR, suggesting that both the Ubx homeodomain and C terminus are important for optimal DNA binding to this site. The C terminus is not absolutely required for binding because a Ubx protein that lacks this domain (UUU*) is still able to bind well to DllR. Last, the finding that UUU*, but not AAU*, binds DllR suggests that a domain N terminal to the homeodomain also enhances DllR binding. Based on the crystal structures of Hox/Exd/DNA complexes, this difference could be due to the YPWM motif. Taken together, the data suggest that multiple regions of Ubx contribute to binding DllR and that no one domain is sufficient for full binding activity. This finding may be understood in light of the fact that the entire Ubx coding sequence has been constrained over millions of years of insect evolution to maintain leg (and Dll) repression in the abdomen (Gebelein, 2002).
How might the Ubx C terminus and YPWM motifs contribute to DNA binding? It is suggested that these regions could make additional protein-DNA contacts and/or protein-protein interactions that help stabilize the DllR-bound form of the trimeric complex. In support of this idea, the C termini of other homeodomain proteins also contribute to DNA binding. The Exd C terminus, for example, consists of an alpha helix that packs against its homeodomain and contributes to DNA binding. The C terminus of the MATalpha2 protein from yeast forms an alpha helix that contacts the MATa1 homeodomain to stabilize heterodimer formation on DNA. Interestingly, the two Hox proteins that repress Dll expression, Ubx and Abd-A, share sequence homology in their C termini, and are the only Drosophila Hox proteins predicted to form an alpha helix after their homeodomains (Gebelein, 2002).
The Ubx YPWM motif may also help stabilize complex formation on DllR. In the Hox/Exd/DNA crystal structures, this motif, together with flanking amino acids, directly contacts a hydrophobic pocket within the Exd homeodomain. These protein-protein contacts are thought to stabilize protein-DNA contacts made by the complex. The amino acids surrounding the YPWM motifs are different in Ubx and Antp and thus could contribute to DNA binding specificity by such an indirect mechanism (Gebelein, 2002).
The finding that UbxIa, but not UbxIVa, is able to repress Dll suggests that the linker region in UbxIa is required for repression. In addition, these results suggest that alternative splicing has the potential to modulate Ubx's control of gene expression. In support of this view, the expression of Ubx isoforms is temporally and spatially regulated. In addition, misexpression experiments using UbxIa and UbxIVa have shown that while both perform many of the same functions, only UbxIa efficiently transforms the peripheral nervous system. The finding that UbxIa and UbxIVa have different transcriptional regulatory properties provides a possible explanation for their distinct abilities to transform this tissue (Gebelein, 2002).
One argument against the idea that the different Ubx isoforms have distinct functions is that flies containing a genetic inversion that prevents the inclusion of the second microexon are, for the most part, normal. Although this mutation prevents the expression of UbxIa, it is unclear which other Ubx isoforms are expressed in this mutant because the inversion does not include both microexons. Furthermore, the effect that this mutation has on Dll expression has not been examined. A definitive test of the idea that Ubx isoforms have unique functions will require determining whether a Ubx allele in which both microexons are eliminated can provide all Ubx functions in vivo (Gebelein, 2002).
As in Drosophila, Dll expression is a marker for leg primordia in many animal phyla. Animals with appendages on their abdominal segments, such as crustaceans and onychophora, coexpress Ubx with Dll, demonstrating that Ubx is not a repressor of Dll in these species. The ability of Ubx to repress Dll probably arose in a subset of arthropods, the hexapods. Consistent with these findings, two recent studies suggest that one relevant difference between Ubx orthologs that repress Dll (for example, Drosophila Ubx) and Ubx orthologs that do not repress Dll (for example, onychophoran Ubx) maps to the C-terminal regions of these Hox proteins (Galant, 2002; Ronshaugen, 2002). These two groups, however, propose different mechanisms for how these sequences function. Galant suggests that the Drosophila Ubx C terminus actively represses transcription via a polyalanine motif that is present in the Ubx orthologs from all hexapods. Ronshaugen suggests that the Drosophila Ubx C terminus is only permissive for repression. Instead, they argue that crustaceans, which have abdominal legs, evolved a C-terminal sequence that inhibits Dll repression. However, neither study analyzed the binding of these proteins to the relevant binding sites in Dll, leaving open the possibility that the effects they observe could also be due to effects on DNA binding (Gebelein, 2002).
The data provide additional insights into how repression mechanisms may have evolved in these different species. It was found that the Drosophila Ubx C terminus contributes to DllR binding but is not sufficient for Dll repression in vivo. Thus, the positive role, observed by Galant, that the Drosophila sequence plays in Dll repression, could be due to an effect on DNA binding. These experiments also implicate the linker region of UbxIa as important for repression, but not DNA binding. Because some of the onychophora/ Drosophila and crustacean/ Drosophila chimeras lack this linker but are able to repress Dll, the crustacean and onychophoran Ubx orthologs must have repression domains that are different from the one identified in Drosophila Ubx (Gebelein, 2002).
Ronshaugen suggests that the phosphorylation of serine and threonine residues in the crustacean Ubx C terminus is necessary for it to prevent Dll repression (Ronshaugen, 2002). This is an intriguing possibility in light of the fact that phosphorylation of a Hox C terminus can inhibit cooperative DNA binding with Exd. Taken together with the current data that the C terminus of Ubx enhances DNA binding to DllR, it is suggested that the inhibition of Dll repression by the crustacean C terminus may be due to a reduced ability to bind DllR with Exd and Hth. This model accounts for why a Drosophila UbxIa protein containing the crustacean C terminus is unable to repress Dll (Ronshaugen, 2002) and for the inability of onychophora Ubx, which also contains a putative phosphorylation site in its C terminus, to repress Dll. Taken together, it is suggested that the evolution of limb suppression by Hox proteins, and probably many other Hox functions, depended upon the modification of both DNA binding-dependent and -independent mechanisms controlling Hox specificity (Gebelein, 2002).
Although these experiments focused on understanding why Antp is different from Ubx, the results provide some insights into the mechanism of transcriptional repression. The data strongly argue that a DNA-bound Ubx/Exd/Hth complex is necessary, but not sufficient, for repression. First, in addition to repressing Dll, Ubx/Exd/Hth activates fkh(250con). When both fkh(250con) and DllR simultaneously regulate the same reporter gene, DllR is able to repress gene expression in the same cells in which fkh(250con) normally activates gene expression. This result suggests that the repressor proteins required for DllR activity are not cell type specific and are widely expressed in the embryo. Further, these results suggest that differences between the fkh(250con) and DllR sequences determine whether transcription is activated or repressed. These sequences may recruit additional DNA binding factors that interact with the trimeric complex. These factors, which have not yet been identified, might provide or reveal a latent activation or repression domain within the Hox/Exd/Hth complex. Alternatively, another DNA binding factor may not be needed. Instead, the unique arrangement or spacing of the Hox, Exd, and Hth sites in these two elements may result in distinct conformations of the trimeric complex that recruit different coactivators or corepressors. Such a mechanism has been suggested for the nuclear receptor family of transcription factors and for the POU domain protein Pit-1, where a difference in spacing in a Pit-1 dimer binding site regulates the recruitment of a corepressor. Consistent with such a mechanism, it was found that the DllRcon binding site, which has one less base pair between the Hox and Exd half-sites than the DllR binding site, fails to repress transcription despite having a higher affinity for Ubx/Exd/Hth complexes. In addition, although repression activity for the UbxIa linker and C terminus in S2 cells can be measured, the experiments suggest that their activities are context dependent. The abdominal expression of DMEcon-lacZ suggests that the mere presence of these domains is not sufficient for repression. Thus, the data suggest that transcription factor domains have distinct properties when assayed by themselves versus when they are part of a multiprotein complex. Further, it is concluded that the unique architecture of the complex assembled on DllR is necessary for efficient repression (Gebelein, 2002).
During Drosophila embryogenesis, segments, each with an anterior and posterior compartment, are generated by the segmentation genes while the Hox genes provide each segment with a unique identity. These two processes have been thought to occur independently. This study shows tha abdominal Hox proteins work directly with two different segmentation proteins, Sloppy paired and Engrailed, to repress the Hox target gene Distalless in anterior and posterior compartments, respectively. These results suggest that segmentation proteins can function as Hox cofactors and reveal a previously unanticipated use of compartments for gene regulation by Hox proteins. The results suggest that these two classes of proteins may collaborate to directly control gene expression at many downstream target genes (Gebelein, 2004).
The segregation of groups of cells into compartments is fundamental to animal development. Originally defined in Drosophila, compartments are critical for providing cells with their unique positional address. The first compartments to form during Drosophila development are the anterior and posterior compartments and the key step to defining them is the activation of the gene engrailed (en). Expression of en, which encodes a homeodomain transcription factor, results in a posterior compartment fate, and the absence of en expression results in an anterior compartment fate. Once activated by gap and pair-rule genes, en expression and, consequently, the anterior-posterior compartment boundary later become dependent upon the protein Wingless (Wg), which is secreted from adjacent anterior compartment cells. Concurrently with anterior-posterior compartmentalization and segmentation, the expression of the eight Drosophila Hox genes is also initially established by the gap and pair-rule genes. The Hox genes, however, which also encode homeodomain transcription factors, do not contribute to the formation or number of segments but instead specify their unique identities along the anterior-posterior axis (Gebelein, 2004).
This flow of genetic information during Drosophila embryogenesis has led to the idea that anterior-posterior compartmentalization and segment identity specification are independent processes. In contrast to this view, this study shows that these two pathways are interconnected in previously unrecognized ways. Evidence is provided that Hox factors directly interact with segmentation proteins such as En to control gene expression. Moreover, Hox proteins collaborate with two different segmentation proteins in anterior and posterior cell types to regulate the same Hox target gene, revealing a previously unknown use of compartments to control gene expression by Hox proteins (Gebelein, 2004).
Distalless (Dll) is a Hox target gene that is required for leg development in Drosophila. In each thoracic hemisegment, wg, expressed by anterior cells adjacent to the anterior-posterior compartment boundary, activates Dll in a group of cells that straddle this boundary. A cis-regulatory element derived from Dll, called DMX, drives accurate Dll-like expression in the thorax. The abdominal Hox genes Ultrabithorax (Ubx) and abdominalA (abdA) directly repress Dll and DMX-lacZ in both compartments, thereby blocking leg development in the abdomen. DMX is composed of a large activator element (DMXact) and a 57-base-pair (bp) repressor element referred to here as DMX-R. Previous work demonstrated that Ubx and AbdA cooperatively bind to DMX-R with two homeodomain cofactors, Extradenticle (Exd) and Homothorax (Hth). In contrast, the thoracic Hox protein Antennapedia (Antp) does not repress Dll and does not bind DMX-R with high affinity in the presence or absence of Exd and Hth. Thus, repression of Dll in the abdomen depends in part on the ability of these cofactors to selectively enhance the binding of the abdominal Hox proteins to DMX-R (Gebelein, 2004).
Exd and Hth, as well as their vertebrate counterparts, are used as Hox
cofactors at many target genes. Moreover, Hox/Exd/Hth complexes are used for both gene activation and repression, raising the question of how the decision to activate or repress is determined. One view posits that these complexes do not directly recruit co-activators or co-repressors, but instead are required for target gene selection. Accordingly, other DNA sequences present at Hox/Exd/Hth-targeted elements would determine whether a target gene is activated or repressed. Consistent with this notion, DMX-R sequences isolated from six Drosophila species show extensive conservation outside the previously identified Hox (referred to here as Hox1) Exd and Hth binding sites, suggesting that they also play a role in Dll regulation (Gebelein, 2004).
To test a role for these conserved sequences, a thorough mutagenesis of DMX-R was performed. Each mutant DMX-R was cloned into an otherwise wild-type, full-length DMX and tested for activity in a standard reporter gene assay in transgenic embryos. Thoracic expression was normal in all cases. However, surprisingly, many of the DMX-R mutations, such as X5, resulted in abdominal de-repression only in En-positive posterior compartment cells, whereas other mutations, such as X2, resulted in abdominal de-repression only in En-negative anterior compartment cells. Single mutations in the Hox1, Exd, or Hth sites also resulted in de-repression predominantly in posterior cells. In contrast, deletion of the entire DMX-R (DMXact-lacZ), or mutations in both the X2 and X5 sites (DMX[X2 + X5]-lacZ), resulted in de-repression in both compartments. These results suggest that distinct repression complexes bind to the DMX-R in the anterior and posterior compartments and that segmentation genes play a role in Dll repression (Gebelein, 2004).
One clue to the identity of the proteins in these repression complexes is that the sequence around the Hth site is nearly identical to a Hth/Hox binding site that had been identified previously by a systematic evolution of ligands by exponential enrichment (SELEX) approach using vertebrate Hox and Meis proteins. This similarity suggested the presence of a second, potentially redundant Hox binding site, Hox2. In agreement with this idea, mutations in both the Hox1 and Hox2 binding sites resulted in de-repression in both the anterior and posterior compartments of the abdominal segments. Similarly, although individual mutations in the Exd and Hth binding sites lead predominantly to de-repression in the posterior compartment, mutation of both sites resulted in de-repression in both compartments. These results suggest that a Hox/Exd/Hth/Hox complex may be used for repression in both compartments. Furthermore, they suggest that although single mutations in these binding sites are sufficient to disrupt the activity of this complex in the posterior compartment, double mutations are required to disrupt its activity in the anterior compartment (Gebelein, 2004).
To provide biochemical evidence for a Hox/Exd/Hth/Hox tetramer, DNA binding experiments were performed using DMX-R probes and proteins expressed and purified from E. coli. Previous experiments demonstrated that a Hox/Exd/Hth trimer cooperatively binds to the Hox1, Exd and Hth sites. The function of the Hox2 site was tested in two ways. First, binding was measured to a probe, DMX-R2, that includes the Exd, Hth and Hox2 sites, but not the Hox1 site. It was found that Exd/Hth/AbdA and Exd/Hth/Ubx trimers cooperatively bind to this probe and that mutations in the Hth, Exd or Hox2 binding sites reduced or eliminated complex formation (Gebelein, 2004).
Second, if both the Hox1 and Hox2 sites are functional, the full-length DMX-R may promote the assembly of Hox/Exd/Hth/Hox tetramers. Using a probe containing all four binding sites (DMX-R1 + 2), the formation of such complexes was observed. Mutation of any of the four binding sites reduced the amount of tetramer binding whereas mutation of both Hox sites or both the Exd and Hth sites eliminated tetramer binding. Furthermore, Antp, which does not repress Dll, formed tetramers with Exd and Hth that were approximately tenfold weaker than with Ubx or AbdA, but bound well to a consensus Hox/Exd/Hth trimer binding site. Because mutation of both Hox sites or both the Exd and Hth sites resulted in de-repression in both compartments, these experiments correlate the binding of a Hox/Exd/Hth/Hox complex on the DMX-R with the ability of this element to mediate repression in both compartments (Gebelein, 2004).
Although binding of a Hox/Exd/Hth/Hox tetramer is sufficient to account for the necessary abdominal Hox-input into Dll repression, it does not explain the compartment-specific de-repression exhibited by some DMX-R mutations. The X2 and X5 mutations, for example, result in abdominal de-repression but do not prevent the formation of the Hox/Exd/Hth/Hox tetramer. Sequence inspection of the DMX-R revealed that the X2 mutation, which resulted in de-repression specifically in the anterior compartment, disrupts two partially overlapping matches to a consensus binding site for Forkhead (Fkh) domain proteins. With this in mind, the expression pattern of Sloppy paired 1 (Slp1), a Fkh domain factor encoded by one of two partially redundant segmentation genes, slp1 and slp2, was examined. The two slp genes are expressed in anterior compartment cells adjacent and anterior to En-expressing posterior compartment cells. In the thorax, cells expressing Dll and DMX-lacZ co-express either Slp or En at the time Dll is initially expressed. In the abdomen, the homologous group of cells, which express DMXact-lacZ (a reporter lacking the DMX-R), co-express either Slp in the anterior compartment or En in the posterior compartment. The expression patterns of Slp and En were compared with Ubx and AbdA. Ubx levels are highest in anterior, Slp-expressing cells whereas AbdA levels are elevated in posterior, En-expressing cells. In contrast, both Exd and Hth are present at similar levels in both compartments throughout the abdomen (Gebelein, 2004).
On the basis of these data, a model is presented for Hox-mediated repression of Dll in both the anterior and posterior compartments of the abdominal segments. In the anterior compartment it is proposed that Slp binds to DMX-R directly with a Ubx/Exd/Hth/Ubx tetramer. In the posterior compartment it is suggested that En binds to DMX-R directly with an AbdA/Exd/Hth/AbdA tetramer. One important feature of this model is that Antp/Exd/Hth/Antp complexes fail to form on this DNA, thereby accounting for the lack of repression in the thorax. Furthermore, the model proposes that Slp and En should, on their own, have only weak affinity for DMX-R sequences because repression does not occur in the thorax, despite the presence of these factors. The Hox/Exd/Hth/Hox complex, perhaps in conjunction with additional factors, is required to recruit or stabilize Slp and En binding to the DMX-R. Both Slp and En are known repressor proteins that directly bind the co-repressor Groucho. Thus, the proposed complexes in both compartments provide a direct link to this co-repressor and, therefore, a mechanism for repression. DNA binding and genetic experiments are presented that test and support this model (Gebelein, 2004).
To test the idea that En is playing a direct role in Dll repression, the ability of En and Hox proteins to bind to DMX-R probes was examined. On its own, En binds to DMX-R very poorly. Surprisingly, it was found that En binds DMX-R with the abdominal Hox proteins Ubx or AbdA in a highly cooperative manner. The thoracic Hox protein Antp does not bind cooperatively with En to this probe. Mutations in the Hox1 or X5 binding sites block AbdA/En binding in vitro, consistent with these mutations showing posterior compartment de-repression in vivo. In contrast, the X6, X7 and Hth mutations do not affect AbdA/En complex formation (Gebelein, 2004).
On the basis of DMX-R's ability to assemble a Hox/Exd/Hth/Hox tetramer, whether En could bind together with an AbdA/Exd/Hth/AbdA complex was tested. Addition of En to reactions containing AbdA, Exd and Hth resulted in the formation of a putative En/AbdA/Exd/Hth/AbdA complex. This complex contains En because its formation is inhibited by an anti-En antibody. A weak antibody-induced supershift is also observed. Moreover, this complex fails to form on the X5 mutant, which causes posterior compartment-specific de-repression. It is noted that En/Exd/Hth complexes also bind to the DMX-R and that it cannot be excluded that an En/Exd/Hth/AbdA complex may be important for Dll repression. The model emphasizes a role for an En/AbdA/Exd/Hth/AbdA complex because it better accommodates the cooperative binding observed between En and AbdA on the DMX-R (Gebelein, 2004).
Repression in the anterior compartments of the abdominal segments requires the sequence defined by the X2 mutation, which is similar to a Fkh domain consensus binding site. The model predicts that this sequence is bound by Slp. Consistent with this view, Slp1 binds weakly to wild type, but not to X2 mutant DMX-R probes. However, in contrast to En, no cooperative binding was observed between Slp and Hox or Hox/Exd/Hth/Hox complexes, suggesting that additional factors may be required to mediate interactions between Slp and the abdominal Hox factors (Gebelein, 2004).
Together, these results suggest that En and Slp play a direct role in DMX-lacZ and Dll repression. However, these experiments do not unambiguously determine the stoichiometry of binding by these factors. Furthermore, in vivo, additional factors may enhance the interaction between these segmentation proteins and Hox complexes, thereby increasing the stability and/or activity of the repression complexes (Gebelein, 2004).
The model for Dll repression is supported by previous genetic experiments that examined the effect of Ubx and abdA mutants on Dll expression in the abdomen. Ubx abdA double mutants de-repress Dll in both compartments of all abdominal segments. In contrast, Ubx mutants de-repress Dll in the anterior compartment of only the first abdominal segment, which lacks AbdA. abdA mutant embryos de-repress Dll in the posterior compartments of all abdominal segments, where Ubx levels are low (Gebelein, 2004).
Several genetic experiments were performed to provide in vivo support for the idea that Slp and En work directly with Ubx and AbdA to repress Dll. The design of these experiments had to take into consideration that the activation of Dll in the thorax depends on wg, and that wg expression depends on both slp and en. Consequently, Dll expression is mostly absent in en or slp mutants, making it impossible to characterize the role that these genes play in Dll repression from examining en or slp loss-of-function mutants. However, some of the mutant DMX-Rs described here provide the opportunity to test the model in alternative ways (Gebelein, 2004).
According to the model, DMX[X5]-lacZ is de-repressed in the posterior compartments of the abdominal segments because it fails to assemble the posterior, En-containing complex. Repression of DMX[X5]-lacZ in the anterior compartments still occurs because it is able to assemble the anterior, Slp-containing complex. According to this model, DMX[X5]-lacZ should be fully repressed if Slp is provided in posterior cells. A negative control for this experiment is that ectopic Slp should be unable to repress DMX[X2]-lacZ because this reporter gene does not have a functional Slp binding site. To mis-express Slp, paired-Gal4 (prd-Gal4), which overlaps both the Slp and En stripes in the odd-numbered abdominal segments, was used. As predicted, ectopic Slp repressed DMX[X5]-lacZ but not DMX[X2]-lacZ, providing strong in vivo support for Slp's direct role in Dll repression in the anterior compartments (Gebelein, 2004).
Conversely, the model posits that DMX[X2]-lacZ is de-repressed in the anterior compartment because it cannot bind Slp, but remains repressed in the posterior compartment because it is able to assemble the En-containing posterior complex. Thus, providing En in the anterior compartment should repress DMX[X2]-lacZ. A complication with this experiment is that En is a repressor of Ubx, which is the predominant abdominal Hox protein in the anterior compartment. It was confirmed that prd-Gal4-driven expression of En represses Ubx and that AbdA levels remain low at the time Dll is activated in the thorax. Consequently, ectopic En expression is not sufficient to repress DMX[X2]-lacZ, consistent with the observation that low levels of abdominal Hox proteins are present. Therefore, to promote the assembly of the posterior complex in anterior cells, En was co-expressed with AbdA using prd-Gal4. As predicted, this combination of factors repressed DMX[X2]-lacZ but not DMX[X5]-lacZ, providing strong in vivo evidence for En playing an essential role in Dll repression in the posterior compartments (Gebelein, 2004).
Several observations provide additional support for the model. First, ectopic expression of AbdA or Ubx in the second thoracic segment (T2) represses DMX[X5]-lacZ in the anterior compartment, but not in the posterior compartment. Conversely, expression of AbdA or Ubx in T2 represses DMX[X2]-lacZ only in posterior compartment cells. Second, co-expression of Slp with Ubx completely represses DMX[X5]-lacZ in T2 but does not repress DMX[X2]-lacZ in T2. Third, in those cases where repression is incomplete (for example, En + AbdA repression of DMX[X2]-lacZ in the abdomen), cells that escape repression have low levels of either an abdominal Hox protein or Slp/En. Together, these data provide additional evidence that the abdominal Hox proteins work together with Slp and En to repress Dll (Gebelein, 2004).
The segregation of cells into anterior and posterior compartments during Drosophila embryogenesis is essential for many aspects of fly development. The results presented in this study reveal an unanticipated intersection between anterior-posterior compartmentalization by segmentation genes and segment identity specification by Hox genes. Specifically, it is suggested that the abdominal Hox proteins collaborate with two different segmentation proteins, Slp and En, to mediate repression of a Hox target gene (Dll) in the anterior and posterior compartments of the abdomen, respectively. This mechanism of transcriptional repression suggests a previously unknown use of compartments in Drosophila development. The mechanism proposed here contrasts with the alternative and simpler hypothesis in which the abdominal Hox proteins would have used the same set of cofactors to repress Dll in all abdominal cells, regardless of their compartmental origin (Gebelein, 2004).
These results provide further support for the view that Hox/Exd/Hth complexes do not directly bind co-activators or co-repressors but instead indirectly recruit them to regulatory elements. Consistent with previous analyses, it is suggested that Hox/Exd/Hth complexes are important for the Hox specificity of target gene selection. Additional factors, such as Slp or En in the case of Dll repression, are required to determine whether the target gene will be repressed or activated. In the future, it will be important to dissect in similar detail other Hox-regulated elements, to assess the generality of this mechanism (Gebelein, 2004).
These results also broaden the spectrum of cofactors used by Hox proteins to regulate gene expression. Although the analysis of Exd/Hth in Drosophila and Pbx/Meis in vertebrates has provided some insights into how Hox specificity is achieved, there are examples of tissues in which these proteins are not available to be Hox cofactors and of Hox targets in which Exd and Hth seem not to play a direct role. This study shows that En, a homeodomain segmentation protein, is used as a Hox cofactor to repress Dll in the abdomen. Although the complex defined at the DMX-R includes Exd and Hth, the DNA binding studies demonstrate that Hox and En proteins can bind cooperatively to DNA in the absence of Exd and Hth. These findings suggest that En may function with Ubx and/or AbdA to regulate target genes other than Dll, and perhaps independently of Exd and Hth. Consistent with this idea are genetic experiments showing that, in the absence of Exd, En can repress slp and this repression requires abdominal Hox activity. Although these experiments were unable to distinguish whether the Hox input was direct or indirect, the results suggest that En may bind directly with Ubx and AbdA to repress slp, and perhaps other target genes (Gebelein, 2004).
Finally, these results raise the question of why a compartment-specific mechanism is used by Hox factors to repress Dll. The activation of Dll at the compartment boundary by wg may be important for accurately positioning the leg primordia within each thoracic hemisegment, but this mode of activation requires that Dll is repressed in both compartments in each abdominal segment. The utilization of segmentation proteins such as En and Slp may be the simplest solution to this problem. Compartment-specific mechanisms may also provide additional flexibility in the regulation of target genes by Hox proteins by allowing them to turn genes on or off specifically in anterior or posterior cell types. For these reasons, compartment-dependent mechanisms of gene regulation may turn out to be the general rule instead of the exception (Gebelein, 2004).
decapentaplegic is a direct target of Ultrabithorax (Ubx) in parasegment 7 (PS7) of the embryonic visceral mesoderm. This study demonstrates that extradenticle (exd) and homothorax (hth) are also required for dpp expression in this location, as well as in PS3, at the site of the developing gastric caecae. A 420 bp element from dpp contains Exd binding sites necessary for expressing a reporter gene in both these locations. Using a specificity swap, Exd was demonstrated to directly activate this element in vivo. Activation does not require Ubx, demonstrating that Exd can activate transcription independently of homeotic proteins. Restoration is restricted to the domains of endogenous dpp expression, despite ubiquitous expression of altered specificity Exd. Nuclear Exd is more extensively phosphorylated than the cytoplasmic form, suggesting that Exd is a target of signal transduction by protein kinases (Stultz, 2006).
Previous studies (Sun, 1995) demonstrated that Ubx directly regulates dpp in PS7 of the VM using a specificity swap strategy. Subsets of six Ubx binding sites were mutated in a 420 bp reporter construct (PX) from binding sites for Q50 homeodomains to binding sites for K50 homeodomains. For example, the wild-type UBX site 5/EXD site e2 was AGGCCTATCAATTAGCACC (with the EXD site underlined) and the mutant UBX site 5/EXD site e2 was AGGCCTAGGGATTAGCACC. It was then possible to restore the expression of these constructs by changing Q50 to K50 in the Ubx protein (called Ubx K50). However, it was not possible to restore expression of a reporter in which all six Ubx sites were altered. This suggested that an additional factor was required, and it was noted that the alterations in the fully substituted PX reporter also disrupted closely apposed Exd binding sites, suggesting that Ubx and EXD may co-regulate dpp (Stultz, 2006).
In previous work (Sun, 1995), it was not possible to restore expression of the fully substituted PX4–9 reporter using Ubx K50. This study shows that ubiquitous and simultaneous induction of Ubx K50 and Exd K50 restores expression of PX4–9 in a manner that is similar to wild-type PX. Induction of Exd K50 alone also restores PX4–9 in these domains but changes the balance of staining intensity between them, with PS7 expression appearing less prominent. This reflects a sufficiency of Exd K50 for activation of gene expression at both sites, but with an additional requirement for Ubx K50 to achieve wild-type levels in PS7. These experiments identify Exd as a direct activator of dpp's VM expression in both PS3 and PS7 (Stultz, 2006).
No HOX proteins are expressed in PS3. Thus, Exd K50 activates gene expression independently of HOX family proteins in this location. In cases where Ubx K50 restored partially substituted PX constructs, restoration was never seen in PS3 (Sun, 1995), further indicating that dpp expression here does not require HOX proteins. In addition, in PS7, where it is clearly established that Ubx contributes to activation of dpp expression, the results demonstrate that Ubx is not absolutely required for Exd K50 to activate transcription. Ubx increases the level of dpp expression, as demonstrated by the reduced PS7 expression in Exd K50-alone restorations, but is not required for Exd function. This point is further reinforced by the ability of Exd K50 to activate PX4–9 gene expression, even in Ubx homozygous mutants. On simple Exd binding sites, PBX proteins have not demonstrated transcriptional activation, but the data suggest that Exd can participate in gene activation without a HOX gene. Other unidentified factors in PS3 or PS7 could also be involved, and one candidate would be HTH, which is genetically required for dpp's VM expression and capable of binding to the PX element in concert with Exd. Genetic evidence for the ability of Exd/HTH to act in the absence of HOX proteins has been steadily accumulating, based on mutant phenotypes that cannot be attributed to HOX genes, and both genetic and in vitro data suggest that HTH/MEIS may have transcriptional activation capabilities (Stultz, 2006).
Two models for the role of Exd in regulating HOX targets have been proposed. The data indicate that the PX element is directly regulated by both Exd and Ubx, allowing evaluation of these two models based on the results. The 'co-selective binding' model proposes that Exd enhances the specificity and affinity of its HOX partner for a DNA binding site. This model requires that Exd and HOX proteins bind cooperatively as heterodimers to closely spaced Exd and HOX binding sites. This model predicts that the relative spacing and orientation of PBX/Exd and HOX binding sites must be tightly constrained, as has been shown by in vitro studies. Although the dpp cis-regulatory PX element contains multiple Ubx and Exd sites identified by DNA footprinting (Sun, 1995), only site e2 resembles the optimal site for binding by a PBX1/HOXB7 heterodimer. Even this site is not a perfect match, and data indicate that this site may be more likely to bind Exd/HTH in vivo. The electrophoretic mobility shift data demonstrate that Exd K50 can bind TAATCCC sites (the optimal site for HOX K50) that replace Ubx sites, as well as unaltered Exd sites. Thus, Exd K50 restores PX4–9 by binding to some or all of these sites. This demonstrates that an Exd protein altered only in its binding specificity can act in vivo through sites of altered spacing and orientation and is not necessarily constrained to act in close proximity to a HOX protein (Stultz, 2006).
The second model, 'widespread binding', proposes that Exd determines the outcome of HOX protein action. According to this model, either Exd or HOX proteins in isolation can bind DNA and act as transcriptional repressors. When both proteins are present, a complex that activates transcription is formed. For Deformed, Exd activates an otherwise silent transcriptional activation domain within the Deformed protein. The physical association between the proteins stabilizes their binding to DNA, but they do not have to bind as heterodimers. This model is more consistent with both the spacing of Exd and HOX sites in the dpp PX element and the apparent flexibility in the location of Exd-responsive sites observed in the experiments. However, this model predicts that independent Exd action is repressive, based on a Deformed-responsive target. In contrast, the data indicate that Exd can also activate reporter gene expression without a HOX partner, suggesting that repression is not the default action of Exd in the absence of HOX proteins (Stultz, 2006).
This study has shown that Exd is a direct activator of dpp expression in the VM. In PS3, the normal action of Exd does not require input from any homeotic protein. In PS7, input from Ubx is critical to achieving the correct level of gene expression, but the data do not support a model where Ubx is absolutely necessary for transcriptional activation. The data suggest that Exd can activate transcription in the absence of HOX proteins but that, in many cases, it also collaborates with HOX proteins, allowing the complex to achieve a more robust level of transcriptional activation. The current notion is that Exd is an essential cofactor for homeotic proteins. An equally tenable model for gene activation is that HOX proteins are the cofactors of Exd, imparting additional spatial regulation, site specificity, and activity to this transcriptional regulator (Stultz, 2006).
The striking restriction of reporter restoration to domains influenced by kinase-mediated signaling pathways led to an examination Exd protein for evidence of phosphorylation. The primary sequence of Exd contains more than 15 potential sites for various protein kinases, including Protein Kinase A (PKA) and Casein Kinase II upstream of its NLS. Protein kinase action is required for gene activation by PBX proteins in tissue culture cells, PKA converts HOX/PBX complexes from repressors to activators on the Hoxb1 autoregulatory element, and phosphorylation by PKA induces nuclear import of PBX1 independently of the PBX/MEIS nuclear localization mechanism. While it was not possible to establish a connection between DPP signaling and Exd phosphorylation, nonetheless, Exd clearly exists in multiple phosphoprotein forms, and the increased phosphorylation is clearly correlated to subcellular localization in Drosophila as well. Thus, Exd must be a target of kinase action, although whether this activity is solely required for nuclear translocation or for activity once in the nucleus is unresolved (Stultz, 2006).
dpp requires both its own expression and that of wg to achieve normal gene expression in the VM. These data led to a hypothesis that the spatial restriction observed in the restoration must be connected to DPP or WG signaling. However, the data do not support this hypothesis, and it is more likely that the major inputs generating dpp's localization in the VM are repressive in nature. In previous work, it was postulated that dpp's spatial regulation in the VM was the result of dual modes of regulation involving both general activation and spatially specific repression and spatially restricted activation (Sun, 1995 To this model of multiple general activators and spatially specific repressors is added the spatially localized strong activator Ubx. Ubx directly regulates dpp and may also have indirect inputs to dpp's PS7 gene expression, as the reduced restoration in Ubx9.22 null embryos indicates. Ubx is itself repressed via chromatin factors such as Polycomb and osa in the anterior midgut and Abd-A posterior to PS7. dpp autoregulation provides additional weak activation via inputs from SMAD proteins and through DPP-mediated schnurri repression of the repressor brinker. Thus, dpp expression is the cumulative result of general activation constrained by spatially specific repression and augmented by spatially specific activation. Clearly, evolution has deemed the formation of the embryonic midgut of sufficient importance to create a highly buffered, reinforced system of gene expression (Stultz, 2006).
The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).
To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).
Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).
During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).
One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).
The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).
Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).
This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).
In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).
Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).
Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).
Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).
Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).
This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).
A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).
A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).
Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).
Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).
EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).
Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).
The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).
EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).
The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).
The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).
In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).
Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).
Hox factors are key regulators of distinct cells, tissues, and organs along the body plan. However, little is known about how Hox factors regulate cell-specific gene expression to pattern diverse tissues. This study shows an unexpected Hox transcriptional mechanism: the permissive regulation of EGF secretion, and thereby cell specification, by antagonizing the Senseless transcription factor in the peripheral nervous system. rhomboid expression in a subset of sensory cells stimulates EGF secretion to induce hepatocyte-like cell development. A rhomboid enhancer was identified that is active in these cells; an abdominal Hox complex directly competes with Senseless for enhancer binding, with the transcriptional outcome dependent upon their relative binding activities. Thus, Hox-Senseless antagonism forms a molecular switch that integrates neural and anterior-posterior positional information. As the vertebrate Senseless homolog is essential for neural development as well as hematopoiesis, it is proposed Hox-Senseless antagonism will broadly control cell fate decisions (Li-Kroeger, 2008).
Hox genes have long been known to specify distinct cell types along the body axes of both vertebrates and invertebrates. However, it has remained elusive how Hox factors regulate transcription in a tissue- or cell-specific manner. In this study, a Hox-regulated enhancer (Rho654) active within a subset of PNS cells was identified. Rho654 drives gene expression in abdominal C1-SOP cells to induce oenocytes, and an Exd/Hth/Abd-A complex stimulates gene expression by directly competing with Sens for this enhancer. These findings have three main implications: (1) They demonstrate how a Hox selector gene integrates A-P positional information with a PNS factor to differentially regulate gene expression along the body plan. (2) They uncover a permissive rather than instructive role for Hox factors in regulating transcription. (3) As Hox and Sens binding sites share a common core sequence, they suggest that additional target genes will be regulated through this mechanism. Moreover, genetic studies in mice have linked Gfi1 and Hox factors to both neural and blood cell development, and this study found that vertebrate Hox and Gfi1 factors compete for binding sites in blood cells (Li-Kroeger, 2008).
Sensory organs within the fly head, thorax, and abdomen require sens for their development. However, the type, location, and number of sensory organs that form in different body regions are regulated, at least in part, by Hox factors. The results provide new insight into how Hox factors provide positional information to modify gene expression in sensory cells. A series of point mutations was used to demonstrate that Hox-Sens competition forms a molecular switch whose outcome correlates with the binding activity of each factor. Intrinsic to this model is the following prediction: If Hox factors differ in their ability to interact with composite sites, then A-P differences in Hox-Sens target expression will be observed. Previous biochemical studies revealed that posterior Hox factors have higher affinity for DNA when bound with Pbx (Exd) than anterior Hox proteins (LaRonde-LeBlanc, 2003). Consistent with these results, this study found that a posterior Hox complex (Abd-A/Hth/Exd) that stimulates Rho654 binds 5-fold more RhoA than an anterior Hox complex (Antp/Hth/Exd) that fails to stimulate Rho654. Thus, differences in binding activities between Hox factors for Hox-Sens composite sites result in the differential regulation of gene expression along the A-P axis of the sensory system (Li-Kroeger, 2008).
Hox proteins instructively regulate gene expression by either activating and/or repressing transcription. In fact, the same Hox factor can perform both functions. Abd-A directly binds regulatory elements to activate wingless (wg) and repress decapentaplegic (dpp) in the same cells of the visceral mesoderm. So what determines if a Hox factor activates or represses transcription? Two recent studies revealed that the transcriptional outcome depends upon the binding of additional transcription factors (Gebelein, 2004; Walsh, 2007). The repression of Distal-less (Dll) by the Abd-A and Ultrabithorax (Ubx) Hox factors requires the binding of two transcription factors in addition to Exd and Hth. In posterior compartment cells, the Engrailed (En) protein collaborates with Abd-A/Exd/Hth to bind DNA and repress Dll. In anterior compartment cells, the Sloppy-paired (Slp) protein binds DNA near the Hox complex to repress Dll (Gebelein, 2004). As both En and Slp interact with the Groucho (Gro) corepressor, their recruitment by Hox factors suggests a mechanism to repress transcription. Similarly, Walsh and Carroll found that Ubx and Smad binding are required to repress spalt-major (salm) in the wing. In this case, the Smad proteins recruit the Schnurri corepressor to inhibit transcription. Thus, Hox factors collaborate with additional factors to determine the transcriptional outcome (Li-Kroeger, 2008).
Studies on Abd-A stimulation of a rho enhancer reveal an unexpected mechanism by which Hox factors control gene expression: through competition with the Sens repressor for DNA binding sites. Sens binds RhoA to repress thoracic gene expression, whereas in the abdomen Exd/Hth/Abd-A is permissive for activation by out-competing Sens. Importantly, mutations that disrupt both Sens and Hox binding to RhoA (SensM/HoxM) are expressed in the thorax and abdomen, revealing that Exd/Hth/Abd-A binding is not required to activate gene expression. In addition, coexpression of Exd, Hth, and Abd-A in cultured cells failed to stimulate Rho654- or RhoAAA-luciferase unless Abd-A is fused to a potent activation domain. Thus, unlike other Hox target genes, Hox complexes on RhoA are permissive rather than instructive and stimulate Rho654 by interfering with the binding of a transcriptional repressor (Li-Kroeger, 2008).
A comparison of consensus Sens, Hox/Exd, and Exd/Hth sites reveal a shared core sequence, suggesting that additional target genes will be regulated through Hox-Sens antagonism. In fact, bioinformatics reveals many Hox-Sens composite sites throughout the Drosophila and mammalian genomes. However, both the Sens and Hox sites extend beyond this core sequence, indicating that only a subset of target genes will comprise composite sites. Thus, three types of target genes for those factors are proposed: (1) those regulated by only Hox factors, (2) those regulated by only Sens/Gfi1, and (3) those regulated by both Hox and Sens/Gfi1. For example, many of the previously characterized Hox target genes in the Drosophila embryo are controlled in tissues that do not express Sens, suggesting they are only regulated by Hox genes. However, the Hox and Sens/Gfi1 factors are coexpressed in many neural cells of the developing PNS in both flies and vertebrates, indicating that similarly to rho regulation in abdominal SOP cells, additional targets will be coregulated by Hox and Sens (Li-Kroeger, 2008).
Like Hox genes, the Sens gene family is conserved in C. elegans (Pag-3), Drosophila, and vertebrates (Gfi1 and Gfi1b). These zinc finger transcription factors are essential for nervous system development in all three organisms. In addition, Gfi1 plays a critical role in hematopoiesis, where it participates in regulating stem cell renewal as well as specific blood cell lineages. Interestingly, Hox factors also regulate blood cell differentiation, proliferation, and stem cell renewal. HoxA9, for example, is required for normal hematopoiesis in mice, and alterations in HoxA9 expression have been implicated in acute myeloid leukemia (AML). In fact, a study analyzing the expression profile of 6817 genes in AML patients who either responded or did not respond to treatment found the highest correlated gene associated with poor prognosis is HoxA9. To determine if the Hox-Sens mechanism uncovered in Drosophila is conserved in mammals, in vitro DNA binding assays were used to show that HoxA9 forms a complex with Pbx and Meis that competes with Gfi1 for common binding sites. Moreover, mouse genetic studies support the hypothesis that Hox-Gfi1 factors antagonize each other to regulate gene expression and blood cell development. Thus, Hox-Sens/Gfi1 competition for composite binding sites is likely a conserved mechanism for the regulation of gene expression in organisms from flies to humans (Li-Kroeger, 2008).
The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, this study showed that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. These results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence (Joshi, 2007).
It is well established that homeodomain-DNA recognition utilizes hydrogen bonds formed between recognition helix side chains and base-specific moieties in the major groove. However, the residues making these contacts are identical in all Hox proteins. While some N-terminal arm residues have been seen in the minor groove, these interactions have not been sufficient to account for specificity differences among Hox proteins. In particular, although Arg5 is often observed in the minor groove, it is common to all homeodomains. Conversely, residues 1 to 4 are important for Hox specificity, but are often not observed in homeodomain-DNA structures. The structure reported in this study, of a complex formed between a Scr-Exd dimer and an in vivo paralog-specific binding site, fkh250 (see Overview of structures and sequences), reveals Hox-DNA contacts that provide new insights into the molecular basis of Hox specificity. Minor groove contacts from linker (His-12) and N-terminal arm (Arg3) residues are critical for Scr's specific in vitro and in vivo properties. Moreover, both residues insert into an unusually narrow region of the minor groove, which in turn creates a local dip in electrostatic potential through the phenomenon of electrostatic focusing (see Protein-DNA contacts). In contrast, in the fkh250con* complex, the minor groove does not have these features, and, like many of the previous structures, there are no DNA contacts N-terminal to Arg5 (Joshi, 2007).
Based on these findings, it is suggested that there are two conceptually separable components to Hox-DNA binding. First, contacts between the DNA major groove and the recognition helix are sufficient to target Hox homeodomains to 'AT-rich' DNA sequences. Second, contacts made between the DNA minor groove and N-terminal arm/linker residues help to discriminate among AT-rich binding sites. Unlike recognition-helix residues in the major groove, the residues that insert into the minor groove recognize a specific DNA structure instead of forming base-specific hydrogen bonds. Below the implications are discussed of these findings for binding site recognition by Hox proteins as well as other DNA binding proteins (Joshi, 2007).
Consecutive ApA, TpT, or ApT base pair steps are known to result in a narrow minor groove due to negative propeller twisting that is stabilized by inter-base pair interactions in the major groove. In contrast, due to poor base stacking interactions, TpA steps tend to widen the minor groove and, for example, produce significant unwinding in the case of the TATA box. It is suggested that these sequence-dependent effects on DNA structure can account for the conformations of the two DNAs observed in this study. The fkh250con* binding site is TGATTTATGG (TpA steps are underlined). ATTT is expected to have the observed narrow minor groove where Arg5 binds. The AT sequence 3' to the TpA step is too short to produce the pattern of inter-base pair contacts required for minor grove narrowing. Moreover, the minor groove that is widened by this TpA step remains wide, in part due to the 3' guanines which introduce amino groups into the minor groove. In contrast, the fkh250 binding site is AGATTAATCG. Here, the ATT and AAT sequences flanking the TpA step both have the pattern of inter-base pair contacts and propeller twisting required for minor groove narrowing. Consequently, two minor groove width minima are observed. The second minimum, where His-12/Arg3 insert, is reinforced by a positive roll introduced by a 3′-CpG step (Joshi, 2007).
The DNA conformations observed in the crystal structures were qualitatively reproduced by Monte Carlo simulations, and the importance of the TpA steps and 3' flanking G-C base pairs in affecting DNA structure were supported by the simulations of DNAs containing individual base pair differences. Interestingly, the standard deviations observed in these simulations are different for fkh250 and fkh250con. This difference, which may reflect an inherent difference in flexibility, is also consistent with known sequence-dependent properties of DNA. The fkh250con* sequence, which shows a smaller standard deviation, is expected to be rigid due to the presence of an 'A-tract', a sequence that consists of at least three consecutive ApA, ApT or TpT steps. In contrast, the larger deviations seen in the fkh250 simulations indicate greater conformational flexibility that can be attributed to the absence of an A-tract and the presence of a TpA step in the middle of the sequence (Joshi, 2007).
The N-terminal arm has been known for some time to play an important role in Hox specificity. Consistent with this idea, this study found Arg3 and Arg5 in the minor groove of fkh250. However, Arg5 is conserved in all homeodomains and Arg3 is present in many Hox proteins, raising the question of what makes Scr's N-terminal arm unique. One answer is that other N-terminal arm differences are important for Scr's properties. In agreement with this notion, it was found that changing RQR to RGR reduced the affinity for fkh250 by ∼six-fold, similar to the effect observed when Arg3 was mutated to Ala. These data suggest that, unlike RQR of Scr, it is energetically unfavorable for the RGR motifs of Antp, Ubx, and AbdA to assume the conformation of the RQR motif as seen in the fkh250 complex. This may be due in part to the increased entropic cost associated with fixing a Gly in any given conformation but also to the fact that its lack of a Cβ precludes the formation of the hydrophobic contact formed between Gln4 and Thr6 in the fkh250 complex (the distance between the Cδ of Gln4 and the Cγ of Thr6 is about 4.7 Å) (Joshi, 2007).
Taken together, these results suggest that the conformational preferences of Hox N-terminal arms are an important determinant of Hox specificity. However, there is clearly more to the story because, like Scr, Deformed (Dfd) also has an RQR motif in its N-terminal arm, but Dfd does not activate fkh250-lacZ in vivo. Thus, while the sequence of the N-terminal arm plays an important role, and allows Hox proteins to be categorized into RGR and RQR subgroups, other specificity-determining factors must also exist. Based on these results, and as discussed below, it is suggested that other important contributors are the paralog-specific residues neighboring the YPWM motif (Joshi, 2007).
His-12 is located in Scr's linker region, four residues away from its YPWM motif. Interestingly, not only is His-12 conserved in all Scr orthologs, residues on both sides of its YPWM motif are also well conserved (see Overview of structures and sequences). This pattern is not unique to Scr and its orthologs: residues in the vicinity of Hox YPWM motifs are generally conserved in a paralog-specific manner. In fact, the evolutionarily conserved sequences in the vicinity of YPWM are sufficient to distinguish between Hox paralogs, and can even discriminate between Scr and Deformed (Dfd), which, like Scr, also has a His in the same position relative to its YPWM motif. These observations suggest that paralog-specific residues near the YPWM motif, together with the N-terminal arm, may be considered as specificity-determining 'signature' residues. Analogous to the findings with Scr-fkh250, it is suggested that these paralog-defining residues in other Hox proteins are critical for the recognition of specific binding sites in vivo. These residues may, as shown here for His-12 and Arg3 of Scr, contact DNA. Alternatively, as shown here for Scr's Gln4, they may be important for specifying the correct conformation of the DNA-contacting residues. A general role for linker and N-terminal arm residues in Hox specificity is supported by the in vivo specificities of Hox protein chimeras (Joshi, 2007).
Although His-12 is conserved among all Scr orthologs, mutating it to an Ala had, for most readouts, only a partial effect on binding or in vivo activity. In contrast, the Arg3 to Ala mutation had a much larger effect, and the strongest effect was observed when both His-12 and Arg3 were mutated to Ala. Some simple considerations can in principle account for the data. First, it is suggested that the main contribution of His-12/Arg3 is to provide a positive charge and, consequently, a favorable electrostatic interaction between Scr and fkh250. Second, given the N-N distance of 2.9 Å in the His-Arg hydrogen bond, His-12 is likely neutral in the fkh250 complex, so that the net charge for both residues is +1. In the double mutant this charge is lost. The His-12 to Ala mutation leaves Arg3 intact and the net charge unchanged. The Arg3 to Ala mutation would likely result in the protonation of His-12 given the negative electrostatic environment in the minor groove, also leaving the net charge of the protein unchanged. While these considerations can explain why the effect of the double mutant is stronger than of either single mutant, they do not explain why ScrArg3A binds more weakly to fkh250 than ScrWT or ScrHis-12A. One possibility is that there is an unfavorable free energy cost of proton uptake to His-12 when it is bound to DNA since, as opposed to Arg3, the free His is only partially protonated (Joshi, 2007).
These results suggest that the interaction of Hox proteins with Exd/Pbx through the YPWM motif is important, not only because the presence of two homeodomains allows for a larger and more specific DNA sequence readout in the major groove, but also because it favors conformations of the linker and N-terminal arm residues such that they can recognize structural patterns in the minor groove. Indeed, it appears that these residues are unable to assume these conformations in the absence of Exd/Pbx. That these residues have not been observed in two other Hox-Exd/Pbx ternary complexes may suggest that their intrinsic flexibility is designed to inhibit binding to the wrong DNA site. That is, only when the protein sequence is compatible with the structure of the minor groove will the stabilizing interaction be strong enough to overcome the entropic loss associated with binding (Joshi, 2007).
Studies on homeodomain-DNA binary complexes also suggest that the N-terminal arm has a tendency to be disordered, unless presented with a DNA structure that provides sufficient stabilizing interactions to compete with conformational entropy. For example, residues 1 to 4 are not observed in the Antp and Engrailed X-ray complexes. In contrast, most of the N-terminal arm is structured in an Even-skipped-DNA complex where, notably, both Arg3 and Tyr4 insert into the minor groove. In that complex the minor groove is quite narrow where Arg3 inserts, consistent with the idea that a narrow groove is required to structure a region of the protein which is intrinsically disordered. In the HoxA9-Pbx-DNA ternary complex, the N terminal arm is also ordered but in that case, a very short linker severely limits the conformational freedom of the N-terminal arm (Joshi, 2007).
As seen in the crystal structure, binding of Scr-Exd to fkh250con* involves residues that are present in all Hox proteins, thus providing an explanation for why this site is not specific for a particular paralog. As discussed above, the answer to the inverse question, of why fkh250 preferentially binds Scr-Exd, involves the insertion of His-12 and Arg3 into the minor groove, which is narrower than the equivalent region in fkh250con*. That a narrow groove is an inherent feature of the fkh250 site suggests the more general idea that Hox proteins recognize their specific binding sites by reading a sequence-dependent DNA structure which, in turn, enhances the negative electrostatic potential and attracts the positively charged Arg/His pair. Thus, local differences in electrostatic potential provide an explanation for why sequence-dependent DNA conformations can attract basic amino acids. This shape-dependent DNA recognition mechanism is distinct from 'direct readout' mechanisms that involve specific hydrogen bond formation and hydrophobic contacts between amino acid side chains and bases. It is also distinct from 'indirect readout' where protein binding is influenced by the global shape of a DNA molecule or by sequence-dependent DNA bending and deformability (Joshi, 2007).
Scr's ability to recognize the shape of the minor groove via basic residues may provide an example of a more general class of protein-DNA recognition mechanisms. For example, an Arg of phage 434 repressor inserts into the minor groove of its operator and a His in the DNA binding domains of interferon regulatory factors (IRFs) inserts into a compressed minor groove. Moreover, the sequence (either FGR, RGR or RGGR) in the minor groove binding region of monomeric human estrogen related receptors, hERR, is an important specificity determinant for that family of transcription factors. The analogy between Hox and hERR2, a nuclear receptor, is particularly striking as the Zn finger domain of nuclear receptors makes major groove contacts while a normally extended peptide expands the binding site by making minor groove contacts. It will be interesting to determine if, as suggested in this study for Hox proteins, other families of DNA binding proteins use a common set of major groove contacts to recognize large sets of degenerate binding sites with individual family members distinguishing among these sites via more specific minor groove contacts. For Hox proteins, it is suggested that such a two-tiered recognition system gives them the flexibility to bind both shared and paralog-specific binding sites (Joshi, 2007).
Homeotic/Hox genes are known to specify a given developmental pathway by regulating the expression of downstream effector genes. During embryonic CNS development of Drosophila, the Hox protein Abdominal-A (AbdA) is required for the specification of the abdominal NB6-4 lineage. It does so by down regulating the expression of the cell cycle regulator gene cyclin E (CycE). CycE is normally expressed in the thoracic NB6-4 lineage to give rise to mixed lineage of neurons and glia, while only glial cells are produced from the abdominal NB6-4 lineage due to the repression of CycE by AbdA. This study investigated how AbdA represses the expression of CycE to define the abdominal fate of a single NB6-4 precursor cell. Both in vitro and in vivo, the regulation was examined of a 1.9 kb CNS-specific CycE enhancer element in the abdominal NB6-4 lineage. CycE was shown to be a direct target of AbdA and it binds to the CNS specific enhancer of CycE to specifically repress the enhancer activity in vivo. These results suggest preferential involvement of a series of multiple AbdA binding sites to selectively enhance the repression of CycE transcription. Furthermore, the data suggest a complex network to regulate CycE expression where AbdA functions as a key regulator (Kannan, 2010).
All progenies of both thoracic and abdominal NB6-4 can be traced using Eagle (Eg) as a lineage marker, and Reversed polarity (Repo) for differentiating glial cells. Thus, Eg-only expression marks neuronal fate. The thoracic variant of NB6-4 (NB6-4t) gives rise to both neuronal and glial cells, whereas the abdominal variant (NB6-4a) gives rise to only glial cells. The Hox gene Antennapedia (Antp) is expressed in the NB6-4t lineage of thoracic segments (T1-T3) whereas abdominal A (abdA) and Abdominal B (AbdB) are expressed in the NB6-4a lineage of abdominal segments A1-A6 and A7-A8, respectively. However, loss of Antp function does not affect the lineage development in contrast to loss of abdA or AbdB, which results in NB6-4a to NB6-4t homeotic transformations. Thus, thoracic identity of NB6-4 lineage acts as a default state without the requirement of any Hox gene input, while abdominal identity of the lineage is imposed by the function of abdA and AbdB. AbdA and AbdB function by suppressing the expression of CycE, a cell cycle molecule necessary for G1-S phase transition. This study has focused on the mechanism by which AbdA regulates CycE expression (Kannan, 2010).
Exd and AbdA cooperatively bind as a heterodimer to a consensus DNA sequence. During development, nuclear localization of Exd is regulated by interaction with another homeodomain protein Homothorax. The expression pattern of the cofactors Exd and Hth was examined in NB6-4 lineages of wild-type embryos. Exd expression was detected in glial precursors of the NB6-4a lineage, Interestingly, it was not found in the NB6-4t lineage, although in the ectoderm expression levels of nuclear Exd are higher in thoracic segments than in the abdominal segments. In the case of Hth, the protein was detected in NB6-4a glial cells only after late stage 11, and also weakly in NB6-4t derived glia. Thus, consistent with their requirement to modulate the function of Hox proteins, Exd was found expressed in the NB6-4a lineage and not in NB6-4t lineage, although weak expression of Hth was detected in glial cells of NB6-4t lineage. Assuming that both are required together to modulate Hox function, modulation of Hox function is predicted only in NB6-4a lineage (where abdA and AbdB are expressed) and not in NB6-4t (where Antp is expressed). Indeed, loss of abdA and AbdB show NB6-4a to NB6-4t transformations, while loss of Antp has no phenotypic consequence (Kannan, 2010).
To gain additional evidence on the relevance of exd and hth expression in the NB6-4a lineage, their loss of function mutations were analyzed. exd mutant embryos showed an increase in the number of NB6-4a progeny. Some of these cells migrated medially in a pattern similar to glial cells of NB6-4t, while others migrated to the dorso-lateral cortex, suggesting neuronal identity. Abdominal hemisegments of hth mutant embryos did not show an increase in glial progeny, but generated ectopic neurons in the dorsal lateral cortex suggesting homeotic transformation of NB6-4a to NB6-4t. The fact that mutations in both the cofactors of AbdA independently induced homeotic transformations, although at much lesser degree (11% in exd mutants and 7% in hth mutants, compared to 100% in abdA mutants), suggests that this observation is a phenocopy of the abdA loss of function phenotype. The mildness of the phenotypes could be an indication of their role as cofactors to enhance the effect of AbdA rather than essential factors to regulate cell-fate specification (Kannan, 2010).
Next the expression pattern of CycE transcripts was investigated in the transformed abdominal NB6-4 lineage in exd mutant embryos. Consistent with the phenotype at the cellular level, CycE mRNA was observed exclusively in neuronal cells of transformed NB6-4a (Eg expressing cells) in exd mutant background as is the case for the thoracic NB6-4. In hemisegments that show no transformation and thus represent the wild-type NB6-4a, absence of CycE mRNA was found (Kannan, 2010).
The complex cis-regulatory region of zygotic CycE comprises of tissue and stage specific activator and repressor elements within an at least 10 kb genomic region including upstream and downstream elements. Based on the expression pattern of a 1.9 kb lacZ reporter gene (CycE-lacZ) in transgenic assays, it is evident that this region includes cis-acting sequences that drive zygotic CycE transcription both in epidermis (mitotic cycles 14-16) and CNS and regulatory elements responsible for CycE down regulation at the end of st11. Similar to CycE transcripts and CycE protein, CycE-lacZ is not expressed in NB6-4a and is activated in abdA, AbdB double mutant embryos. Thus, this 1.9 kb lacZ reporter reliably reflects the CycE expression in the abdominal NB6-4 lineage (Kannan, 2010).
To elucidate the mechanisms that AbdA specifies in collaboration with Exd/Hth, the 1.9 kb CNS-specific CycE regulatory element for known AbdA, Exd and Hth-binding sites. The element harbours at least 3 binding sites for AbdA, and one each for Exd and Hth in close association. Since strong repression of β-Gal expression from the 1.9 kb CycE-lacZ regulatory element was observed in the NB6-4a lineage, it was wondered whether this regulation could be due to the presence of AbdA and Exd/Hth-binding sites. Therefore, the 1.9 kb CycE-lacZ fragment in more detail both in vitro and in vivo (Kannan, 2010).
Binding of AbdA, Exd and Hth to the regulatory sequences of CycE was tested by electro-mobility shift assays (EMSAs) on three spatially separated AbdA binding sites named AbdA-1, -2 and -3. AbdA-2 is in close association with binding sites of cofactors Exd and Hth, named as 68 bp fragment. EMSA suggested physical association of AbdA protein with all the three putative binding sites (AbdA-1, -2 and -3) when tested independently with corresponding oligosequences. In addition, the association of AbdA, Exd and Hth complex was observed in the 68 bp fragment. To check whether the putative AbdA, Exd and Hth sites identified within the CycE enhancer are responsible for assembling the complex, the core sequences that make critical contact to each of these factors was mutated. Mutations in Hox binding sites resulted in the loss of association of AbdA, Exd and Hth to the core sequence. These results suggest cooperative binding of AbdA and its cofactors Exd and Hth to the CycE enhancer element (Kannan, 2010).
To test the functional relevance of binding of AbdA, Exd and Hth in vivo, reporter gene constructs were constructed, with presence or absence of either of three AbdA binding sites, upstream of a minimal promoter driving β-Gal expression. Transgenic flies were generated by P-element mediated transformation (Kannan, 2010).
Embryos homozygous for lacZ transgenes (two independent insertion lines for each transgene to rule out position variation effects) were stained for Eg, Repo and β-Gal to visualize the regulatory behaviour of the CNS-specific CycE element in the abdominal NB6-4 lineage. The enhancer elements deleted independently for putative binding sites AbdA-1 and AbdA-2 drive β-Gal expression in abdominal NB6-4 cells, suggesting the preferential requirement of both sites for transcriptional repression of CycE. In contrast, the transgene deleted for AbdA-3 showed the wild-type 1.9 kb CycE-lacZ expression pattern i.e. no expression in NB6-4a, suggesting that AbdA-3 may not be a preferred binding site for repressive activity. As expected, regulatory elements deleted for both AbdA-1 and AbdA-3 or AbdA-2 and AbdA-3 drive lacZ expression in abdominal NB6-4 progenies. However, deletion of both the repressor elements abdA1 and abdA2 (CycE-lacZAbdA-1&2) did not result in de-repression of lacZ in NB6-4a. Interestingly, deletion of all the three elements resulted in the activation of lacZ in NB6-4a. This suggests that AbdA-3 may act as a cryptic repressor, functional only in the absence of both AbdA-1 and AbdA-2. In addition, while deletion of AbdA-2 alone resulted in the activation of β-Gal expression in NB6-4a, CycE-lacZ68bp element deleted for Exd/Hth and AbdA-2 mimicked wild-type β-Gal expression pattern suggesting that in its absence, AbdA-1 and AbdA-3 may maintain repression of CycE in NB6-4a (Kannan, 2010).
These results do not rule out the possibility of other sequences in the regulatory region of CycE that contribute to the AbdA-mediated repression. The fact that lacZ is strongly repressed in CycE-lacZAbdA-1&2 and CycE-lacZ68bp embryos, but de-repressed in CycE-lacZAbdA-1,2&3, CycE-lacZAbdA-1&3 and CycE-lacZAbdA-2&3 embryos, suggest that other regulators may function together with this enhancer in vivo. There is a possibility that this regulatory region is between AbdA-1 and AbdA-2, which is required to assemble a repressor complex. Computational screening of the 1.9 kb enhancer fragments revealed the existence of at least 3 Engrailed (En)-binding sites. Two of the En sites are between AbdA-1 and AbdA-2. It is likely that a minimum of two AbdA binding sites along with this regulatory region is required to assemble a repressor complex that also involves Exd/Hth and probably En. When either AbdA-1 or AbdA-2 is deleted, this repressor complex fails to assemble and hence leads to activation of CycE-lacZ in NB6-4a. In the absence of both AbdA-1 and AbdA-2, the putative En-binding region may come closer to AbdA-3 and still be able to assemble a repressor complex. Interestingly, repression of lacZ was observed when the whole 68 bp region is deleted. This could also be due to the fact that AbdA-3 is now much closer to the putative En-binding sites. Unfortunately, this could not be tested in the background of loss of function of en since NB6-4 itself is not born in those embryos. Nevertheless, the above mentioned model appears to be identical to the way Dll expression is repressed in the epithelial cells, which is mediated by Ubx and En. Further investigation in this direction involves Chromatin immunoprecipitation for AbdA or En followed by Western blot analyses for the other protein under different conditions (Kannan, 2010).
To conclude, these results suggest the preferential involvement of a series of multiple AbdA binding sites for enhanced repression of CycE transcription. These data suggests a complex network to regulate CycE expression where AbdA functions as a key regulator. This may have evolved to ensure tight repression of CycE as it is a potent regulator of cell fate in NB6-4 and possibly other CNS lineages (Kannan, 2010).
The Drosophila Hox gene Ultrabithorax (Ubx) produces a family of protein isoforms through alternative splicing. Isoforms differ from one another by the presence of optional segments-encoded by individual exons-that modify the distance between the homeodomain and a cofactor-interaction module termed the 'YPWM' motif. To investigate the functional implications of Ubx alternative splicing, this study analyzed the in vivo effects of the individual Ubx isoforms on the activation of a natural Ubx molecular target, the decapentaplegic (dpp) gene, within the embryonic mesoderm. These experiments show that the Ubx isoforms differ in their abilities to activate dpp in mesodermal tissues during embryogenesis. Furthermore, using a Ubx mutant that reduces the full Ubx protein repertoire to just one single isoform, specific anomalies were obtained affecting the patterning of anterior abdominal muscles, demonstrating that Ubx isoforms are not functionally interchangeable during embryonic mesoderm development. Finally, a series of experiments in vitro reveals that Ubx isoforms also vary in their capacity to bind DNA in presence of the cofactor Extradenticle (Exd). Altogether, results indicate that the structural changes produced by alternative splicing have functional implications for Ubx protein function in vivo and in vitro. Since other Hox genes also produce splicing isoforms affecting similar protein domains, it is suggested that alternative splicing may represent an underestimated regulatory system modulating Hox gene specificity during fly development (Reed, 2010).
The experiments described in this study indicate that the generation of structural differences among Ubx proteins by alternative splicing is relevant for the functional specificity of Ubx in vivo. These structural features modulate essential biochemical properties of Ubx proteins such as their DNA-binding profiles in the presence of a cofactor (Reed, 2010).
The differential effects of Ubx in vivo are apparent in the posterior visceral mesoderm, but not in the anterior. To understand this it must first be noted that the mechanism of dpp674 visceral mesoderm enhancer repression is different anterior and posterior to PS7. In the anterior visceral mesoderm, repression requires Exd, since in Exd null mutants, dpp674 is ectopically expressed anterior to PS7. But Hox genes appear to play no role in the normal repression of dpp in this region. The same Exd-dependent mechanism may also be acting in the posterior, but it is not necessary, for no posterior ectopic expression is observed in Exd null mutants. The posterior repression depends instead on the Hox protein Abd-A, which is presumably able to repress dpp674 in the absence of Exd as a cofactor (Reed, 2010).
All Ubx protein isoforms are able to induce dpp ectopically in the anterior, suggesting that they can all override the normal repression mediated by Exd. However, they exert differential effects in the posterior, where Abd-A is the controlling repressor. Abd-A has a very similar DNA-binding specificity to that of Ubx. It binds to multiple sites in the dpp674 enhancer, including those to which Ubx binds. Through some of these sites it serves as an activator, but through others it acts as a repressor. With Ubx form Ia, the repressing effect by Abd-A is dominant. The results suggest that Ubx form IVa is either able to compete more effectively as an activator with the repressing action of Abd-A bound at other sites or able to displace the binding of Abd-A at the sites where it mediates repression (Reed, 2010).
Ubx form IVa also overrides the normal specificity of the dpp-lacZ enhancer for the visceral mesoderm, activating it ectopically in the somatic mesoderm of most trunk segments. It is not known whether the activity of this enhancer is normally restricted to the visceral mesoderm by a required cofactor that is present only in the visceral mesoderm, by repressors present in other tissues, or by both mechanisms. However, UbxIVa at high levels seems able to override this normal tissue specificity. The more efficient DNA binding of this isoform (in the presence of Exd) may bypass the requirement for a cofactor or displace a repressor more effectively (Reed, 2010).
A quantitatively controlled study showed that the levels of Ubx protein are very important to determine the functional outcome of Ubx in vivo. In this context, the results show that in spite of significant variation across expression, levels of UbxIVa protein in different transgenic lines, this isoform is consistently able to produce a similar output in terms of dpp target activation in posterior regions. This suggests that for UbxIVa dpp target activation and protein concentration may relate to one another in the form of a sigmoidal function with a narrow protein concentration interval acting as a threshold that is crossed by all UbxIVa lines tested in this study. Given that UbxIa lines achieving comparable protein expression levels to UbxIVa lines, it was possible to activate dpp in posterior regions of the embryo, it is concluded that qualitative differences in Ubx protein structure as determined by alternative splicing are causal to the observed differential behavior in target activation (Reed, 2010).
The tissue-specific effects of Ubx isoform ectopic expression emphasize the likely role that the splice isoforms play in mediating specific Ubx functions in different tissues. Indeed, the isoforms have different tissue distributions in embryogenesis with UbxIa expressed predominantly in epidermis, mesoderm, and peripheral nervous system whereas UbxIVa appears to be exclusively expressed in the central nervous system. The analysis of the UbxMX17 mutation, which retains the full Ubx expression pattern but generates only isoform UbxIVa, supports the endogenous relevance of splice isoforms for tissue-specific Hox function. Although in UbxMX17 embryos UbxIVa can replace the function of Ubx isoforms I and II in the epidermis with the generation of a normal cuticle pattern, the peripheral nervous system is affected, and in this study clear defects were found in the segmental specification of somatic muscles. Tissue-specific isoform functions may be mediated by effects on cofactor interaction or may also involve effects on collaborative regulatory interactions between Hox proteins and tissue-specific regulators (Reed, 2010).
The results of in vitro binding studies of the Ubx/Exd element show that Ubx isoforms differ in their capacity to interact with DNA in the presence of the cofactor Exd. A possibility that emerges from these results is that different Ubx isoforms display differential levels of interaction with Exd (in the presence of target DNA) and, accordingly, could perform specific functions in vivo as a consequence to the distinct levels of nuclear Exd available in different regions of the embryo (Reed, 2010).
in vitro studies also show that ablation of the YPWM motif has little effect on the ability of Ubx form Ia to form a complex with Exd, but it significantly reduces complex formation by Ubx form IVa (Reed, 2010).
The observation that mutated forms of the Ubx protein lacking the hexapeptide interact with Exd at all is at first sight surprising, especially in view of the structural studies showing that the YPWM motif provides the major contact between Hox and Exd proteins bound to DNA. However, this finding is not inconsistent with earlier work. The article that originally described cooperative interactions between Ubx and Exd used Ubx proteins deleted of all sequences located amino-terminal to the homeodomain. These proteins therefore lacked the hexapeptide motif entirely. Interactions with Exd that do not require the hexapeptide have also been reported in a study focused on Ubx functions independent from Exd and Hth proteins. In addition, alanine replacement of the hexapeptide does not affect the way another Hox protein (i.e., Abd-A) interacts with Exd. Furthermore, a recent study suggests that Ubx-Exd recruitment may rely not on a single, but on several different mechanisms, some of which require a short evolutionarily conserved motif originally termed UbdA. Thus, the hexapeptide is unlikely to be the only Hox protein motif that interacts with Exd (Reed, 2010).
Crystallographic studies show that the Ubx and Exd homeodomains are closely adjacent, almost touching each other, the extent of this proximity being revealed by a significant reduction in solvent-accessible surface area within the area of putative contact. In addition, the distance between the Ubx recognition helix C terminus and the Exd recognition helix N terminus is just 9 Å, with one particular residue of Ubx (Lys58) well positioned to form hydrogen bonds with a residue of Exd (Ser48). Thus, regions within the Ubx homeodomain may be responsible for additional interactions with Exd. Sequences elsewhere in the proteins may also contribute to these interactions. A fine combination of protein mapping and crystallographic studies may be required to reveal the structural details of such interactions (Reed, 2010).
These experiments would be consistent with the possibility that the Ubx linker region itself could be a previously uncharacterized region of Ubx that makes contacts with Exd. This would be supported by experiments of protein-protein interaction in yeast, which also suggest that the Ubx linker region could affect the interaction between Ubx and Exd, and by the high evolutionary conservation of these sequences across phylogenetically distant species of flies. The results could also be accommodated in a model in which the Ubx linker region induces a conformational change elsewhere in the Ubx protein, such that the degree of interaction with Exd is affected. Alternatively, the regulatory potential of the Ubx protein could be affected. In particular, linker-dependent conformational changes may affect the behavior of critical regulatory motifs of Ubx, such as the recently studied QA motif involved in the modulation of Ubx activities in a tissue-specific manner (Hittinger, 2005) and the SSYF motif (Tour, 2005), an evolutionarily conserved motif close to the N terminus of the Ubx protein that is involved in transcriptional activation (Reed, 2010).
Other reports have also emphasized that the Hox linker regions are not just passive spacers. One such study shows that mutation of the short linker region in the Hox protein Abd-A specifically disables its capacity to activate wingless, a natural target gene, without affecting its ability to repress dpp. When comparing cofactor and DNA-binding properties of this Abd-A mutant protein with those of the wild-type Abd-A on a repressor element of the Distalless gene (DllR), no differences were seen in the interaction between the mutant form of Abd-A and Exd protein. (It is perhaps worth noting that these in vitro experiments required the presence of Homothorax protein; on this particular DNA target (DllR), the formation of complexes with Abd-A and Exd alone was below the limit of detection of the assay. Another report described Ubx isoform-specific functions for the repression of the Dll gene. These studies suggest that sequences within the Hox linker regions may modify the trans-regulatory potential of Hox proteins without necessarily affecting the DNA-binding properties of these proteins. The results extend these studies, showing that linker regions may at times affect target gene regulation and the DNA binding/cofactor interaction abilities of a Hox protein. The binding results are consistent with a recent study that integrates DNA-binding tests with computational predictions of ordered and disordered segments of the Ubx protein (Liu, 2008), proposing that sequences outside the homeodomain can reduce the DNA-binding activities of the Ubx protein by twofold (Reed, 2010).
Beyond the effects that alternative splicing may have on modulating Hox interactions with cofactors, other possibilities must also be considered. Given that in these experiments a very unstable binding of the Ubx proteins to target DNA was observed in the absence of Exd, it is difficult to advance arguments regarding the affinities of the individual Ubx isoforms for this molecular target on firm grounds. In spite of this, given that in various physiological contexts the binding of Hox proteins to target sites in the absence of cofactors has been demonstrated, it is pertinent to suggest that alternative splicing might also be influencing Hox DNA binding independently from cofactor interactions, at the level of changing DNA-binding affinities of the individual isoforms for their target DNAs. This possibility would be suitable for experimental investigation in the physiological context of Drosophila adult appendage development, as Ubx is known to act independently from cofactors during the development of these structures (Reed, 2010).
Examples from other Drosophila Hox genes further support a more general role of differential splicing in the diversification of Hox function during development, affecting protein modules outside the Ubx linker region discussed above. For instance, genetic dissection of the Abd-B gene demonstrated the existence of two distinct gene functions, originally termed morphogenetic (m) and regulatory (r). The spectrum of mRNAs derived from the Abd-B locus have been cloned, and a family of Abd-B transcripts generated by differential promoter use has been revealed , that, in turn, leads to different splicing variants affecting 5' sequences of the gene. Two proteins products, called m and r, are produced from the Abd-B transcripts; m differs from r in that it encodes an additional large glutamine-rich amino-terminal domain. Furthermore, ectopic expression of each Abd-B protein class leads to specific effects on the larval cuticle, suggesting that the isoforms have specific developmental functions (Reed, 2010).
Given that in Drosophila several Hox proteins possess alternatively spliced modules modifying the distance between the hexapeptide and the homeodomain, while others produce functionally different isoforms via differential promoter use coupled to alternative splicing, alternative splicing may truly represent a very important, yet underexplored regulatory mechanism modulating the functional specificity of Hox proteins during development (Reed, 2010).
Segmentation involves subdivision of a developing body part into multiple repetitive units during embryogenesis. In Drosophila and other insects, embryonic segmentation is regulated by genes expressed in the same domain of every segment. Less is known about the molecular basis for segmentation of individual body parts occurring at later developmental stages. The Drosophila transcription factor AP-2 gene, dAP-2, is required for outgrowth of leg and antennal segments and is expressed in every segment boundary within the larval imaginal discs. To investigate the molecular mechanisms generating the segmentally repetitive pattern of dAP-2 expression, transgenic reporter analyses was performed and multiple cis-regulatory elements were isolated that can individually or cooperatively recapitulate endogenous dAP-2 expression in different segments of the appendages. An enhancer specific for the proximal femur region, which corresponds to the distal-most expression domain of homothorax (hth), was analyzed in the leg imaginal discs. Hth is known to be responsible for the nuclear localization and, hence, function of the Hox cofactor, Extradenticle (Exd). Both Hth and Exd were shown to be required for dAP-2 expression in the femur, and a conserved Exd/Hox binding site was found to be essential for enhancer activity. These loss- and gain-of-function studies further support direct regulation of dAP-2 by Hox proteins and suggest that Hox proteins function redundantly in dAP-2 regulation. This study reveals that discrete segment-specific enhancers underlie the seemingly simple repetitive expression of dAP-2 and provides evidence for direct regulation of leg segmentation by regional combinations of the proximodistal patterning genes (Ahn, 2011).
The segmentally repeated expression of dAP-2 in the developing leg and antennal discs may suggest that its expression in each segment is regulated in a similar manner by upstream segmentation genes. Alternatively, each domain (ring) of dAP-2 expression could result from the combinatorial activities of multiple transcription factors, which themselves are not expressed in a repeated pattern, but instead occupy distinct and broader domains along the PD axis of the appendages. Current data provide strong evidence that the latter strategy is utilized to establish dAP-2 expression in all but the tarsal segments. It seems that the tarsus has adopted a strategy different from that of other leg segments to regulate dAP-2 expression (Ahn, 2011).
In an effort to understand molecular mechanisms controlling dAP-2 expression during leg development, the regulatory potential of dAP-2 genomic fragments was tested using transgenic reporter analyses. Multiple enhancers were successfully isolated which can independently direct reporter expression in specific leg segments and together recapitulate, almost completely, the endogenous expression pattern. It is intriguing that the relative positions of these enhancers on the chromosome are well correlated with the position of their activity along the PD axis of the leg. Importantly, the presence of segment-specific enhancers suggests that dAP-2 expression is differentially regulated in each leg segment. It is likely that each domain of dAP-2 expression in the true joints is regulated by a combination of upstream regulators involved in PD patterning using segment-specific enhancers similar to the distinct enhancers used to regulate expression of the pair-rule gene, even-skipped, in every other parasegment during embryonic segmentation. Interestingly, dAP-2 expression in the coxa is differentially regulated along the DV axis and depends on two region-specific enhancers. In addition, the EB fragment displayed relatively weaker activity in the ventral region compared to the larger E6 fragment. These data raise the possibility that DV patterning genes are also involved in dAP-2 regulation in the proximal segments. It is possible that the use of multiple region-specific enhancers is a general mechanism establishing expression of segmentation genes during leg development (Ahn, 2011).
Current data indicate that dAP-2 expression in antennal discs also requires multiple region-specific enhancers. Some of the leg enhancers showed an antennal expression pattern similar to their leg patterns with respect to the PD axis. However, there are also enhancers specific for either antennal or leg discs implying that the genes required for normal identity of the two homologous appendages might be involved in regulation of dAP-2 expression in some segments. One of the features that distinguish antennae from legs is that in antennal discs, hth expression is expanded to the intermediate region where dac expression is missing. In contrast, the expression patterns of Dll, dac and hth are very similar in the proximal and distal regions of the two appendages. It is interesting to note that the dAP-2 enhancers for the most proximal and distal regions are shared between the two appendages while the intermediate region utilizes distinct enhancers. This implies that dAP-2 expression in the intermediate region is more likely to be regulated by antennal- or leg-specific regulatory pathways. For example, although the femur and the AIII are homologous structures, the Hox-dependent proximal femur enhancer is active in the leg, but not in the antenna. Likewise, the BE enhancer is active in the proximal AIII of the Hox-free antenna, but not in the leg (Ahn, 2011).
The Hox gene Antp has been considered to be a key factor in determining leg identity since Antp mutant clones in the T2 leg cause a leg-to-antenna transformation, mainly outside of the Hth domain. Previous studies suggested that Antp performs its selector function by acting as a repressor of hth and other antennal genes in the intermediate leg. In contrast, both Antp and hth are expressed in the proximal leg, and are required for growth and segmentation of this region. Therefore, it has been proposed that the role of Antp as a repressor of hth is limited to the intermediate leg, and that both Antp and Hth contribute to proper development of the proximal leg (Ahn, 2011).
The similar loss-of-function phenotypes of hth and exd suggest that Hth and Exd act on common target genes during development of the proximal leg. In certain developmental contexts, Hth can directly bind to DNA through its homeodomain in a ternary complex including Exd and Hox proteins to regulate expression of target genes. However, it has been shown that a Hth isoform lacking the homeodomain can execute the function of Hth in PD patterning of Drosophila leg discs indicating that direct DNA binding is not necessary for its function in proximal leg discs. Since no conserved, consensus Hth binding site were found in the proximal femur enhancer of dAP-2, Hth is likely functioning in dAP-2 expression through a mechanism independent of its direct binding to DNA through its homeodomain. Instead, Hth may regulate dAP-2 expression in the proximal femur by facilitating the nuclear localization of Exd or by interacting with other transcription factors which bind DNA (Ahn, 2011).
As a cofactor of Hox proteins, Exd, and its mammalian homolog Pbx, cooperatively bind DNA with Hox proteins and regulate expression of their target genes which are involved in a variety of developmental processes in both vertebrates and Drosophila. Although previous genetic analyses have revealed essential functions of Exd and Hox proteins in leg development, it has been unclear whether these factors act together on common target genes during this process. This study has identified a conserved Exd/Hox binding site which is required for activity of the proximal femur enhancer of dAP-2. Through clonal analyses, it was demonstrated that hth, exd and Antp are necessary for dAP-2 expression in the presumptive proximal femur of leg imaginal discs. This is the first example of a direct target gene of an Exd/Hox complex in Drosophila limb development. This study also provides insight into the molecular mechanism integrating the combinatorial actions of PD patterning genes in the regulation of region-specific expression of leg segmentation genes (Ahn, 2011).
Although Antp is expressed in all three pairs of legs, most of the prothoracic (T1) and metathoracic (T3) legs with Antp mutant clones appeared to be normal, except for a rare fusion between the femur and tibia. However, Scr/Antp double mutant clones in T1 legs and Antp/Ubx double mutant clones in T3 legs generated leg defects indistinguishable from those generated by Antp mutant clones in T2 legs. It was proposed that the low penetrance of the Antp mutant phenotypes in T1 and T3 legs is due to redundancy with Scr and Ubx, which are expressed in T1 and T3 leg discs, respectively. This idea is consistent with the previous observations that Scr and Ubx both can induce antenna-to-leg transformations when ectopically expressed in antennal discs. It is proposed that Antp, Scr and Ubx can redundantly activate dAP-2 expression in the proximal femur as Exd/Hox heterodimers based on the following observations. First, dAP-2 expression in T2 leg discs, but not in T1 and T3 leg discs, requires Antp. Secondly, EMSA results demonstrate that all three Hox proteins bind strongly to the binding site in the proximal femur enhancer as Exd/Hox heterodimers. Thirdly, all three Hox proteins can activate PrF enhancer function when ectopically expressed in antennal discs (Ahn, 2011).
Home page: The Interactive Fly © 1997 Thomas B. Brody, Ph.D.
The Interactive Fly resides on the
extradenticle:
Biological Overview
| Evolutionary Homologs
| Protein Interactions
| Developmental Biology
| Effects of Mutation
| References
Society for Developmental Biology's Web server.